A Fluorescent Aptasensor Based on Tb-MOFs and Its Application for the Detection of Pseudomonas aeruginosa in Foods

TL;DR

This paper introduces a new fluorescent sensor for detecting Pseudomonas aeruginosa in food and drinks, offering a fast and sensitive method to ensure food safety.

Contribution

The novel contribution is a Tb-MOFs-based fluorescent aptasensor for rapid and sensitive detection of Pseudomonas aeruginosa.

Findings

The sensor shows a linear detection range from 1 to 106 CFU/mL of Pseudomonas aeruginosa.

The detection limit is as low as 0.63 CFU/mL.

The sensor was successfully applied to bottled water and orange juice samples.

Abstract

Pseudomonas aeruginosa is an important waterborne pathogen that is harmful to food safety and human health. Therefore, the detection of Pseudomonas aeruginosa has become an essential item in food sampling. This article constructs a fluorescent aptamer sensor based on Tb-MOFs, using Tb-MOFs as the fluorescence signal source, colloidal gold (AuNPs) as the signal conversion switch, and aptamers as the target recognition element, to establish a quantitative detection method for Pseudomonas aeruginosa. The constructed sensor exhibits a good linear relationship within the concentration range of Pseudomonas aeruginosa from 1 to 106 CFU/mL, with a detection limit of 0.63 CFU/mL. Moreover, the sensor was also applied to the detection of Pseudomonas aeruginosa in actual samples of bottled drinking water and orange juice. The fluorescent aptasensor based on Tb-MOFs provides a rapid and sensitive new sensing method for the detection of Pseudomonas aeruginosa in food.

Figures

Full text

1. Introduction

Pseudomonas aeruginosa is an important waterborne pathogen that is widely present in various types of water. It has strong resistance to physical and chemical factors such as disinfectants, ultraviolet radiation, and adverse environments [1,2]. As a opportunistic pathogen, it can cause diseases such as acute intestinal inflammation, sepsis, and skin inflammation [3,4]. Pseudomonas aeruginosa can contaminate various foods such as drinking water, milk, meat, fruits, and vegetables, and is often transmitted through bottled or barreled drinking water [5]. Its strong vitality in various environments poses a serious threat to food safety [6,7,8,9]. Therefore, the detection of Pseudomonas aeruginosa has become an essential item in food sampling.

The current standard method for detecting Pseudomonas aeruginosa is colony counting method [10]. This method usually takes 2–3 days to obtain confirmed results. Many researchers have developed new methods for detecting Pseudomonas aeruginosa [11,12], such as polymerase chain reaction (PCR) based methods [13] and enzyme-linked immunosorbent assay (ELISA) [14], which require complex equipment and specialized knowledge in molecular biology. Therefore, it is necessary to develop rapid, sensitive, and cost-effective detection methods to sensitively identify Pseudomonas aeruginosa and reduce the risk of food contamination.

Fluorescence sensing has become a new approach in the field of rapid food safety detection due to its speed and specificity in the detection process [15]. Compared with traditional sensors, fluorescent sensing designed and assembled using various materials have advantages such as strong stability, real-time analysis, high-throughput screening ability, high selectivity and sensitivity, and low detection limit [16]. There is enormous potential for innovative and designable multifunctional materials, such as metal organic frameworks (MOFs) [17,18], covalent organic frameworks (COFs) [19,20], hydrogen bonded organic frameworks (HOFs) [21], quantum dots (QDs) [22], carbon nanotubes, metal nanomaterials, and metal oxides [23], which have become ideal materials for constructing high-sensitivity sensors due to their excellent physical and chemical properties. Fluorescent sensors based on MOFs can be divided into two categories according to their sensing mechanisms: physical adsorption and chemical interactions [24]. Physical adsorption relies on the affinity between MOFs materials and target analytes, where the target diffuses into the pores of MOFs and interacts with fluorescent probes, resulting in changes in fluorescence intensity or wavelength [25]. On the other hand, chemical interactions involve the specific recognition of analytes by functional groups of MOFs, which can lead to fluorescence quenching or enhancement [26]. In addition, due to the electron transport capability of MOFs, electron excitation is transmitted to the target material in various forms, thereby generating quenching signals; Multiple excited states can also suppress signal enhancement. Therefore, MOFs materials promote the interaction between sensors and targets through the following four strategies: (1) Using lanthanide metals with fluorescent properties. (2) Utilize organic ligands composed of coupling or aromatic groups with fluorescent properties. (3) Encapsulate fluorescent guest molecules or nanoparticles into non fluorescent MOFs. (4) Introducing specific functional groups onto the organic ligands of MOFs materials through functionalization modification for fluorescence purposes. Many fluorescence sensors have been developed based on the above fluorescence response strategies for detecting different food pollutants [27]. For example, Hu et al. [28] synthesized a fluorescent sensor Fe_3_O_4_@Cu-MOF with a core-shell structure and combined it with agarose gel to develop a portable visual detection method for organophosphorus pesticides. Sun et al. [29] developed an “on” type fluorescence aptamer sensor based on FRET, which consists of DNA templated silver nanoclusters and porous Fe_3_O_4_/carbon octahedra derived from MOFs. The sensor has been used for detecting zearalenone. Overall, fluorescence sensors based on MOFs exhibit excellent stability and specificity, which can selectively capture and detect target substances. In particular, lanthanide elements with excellent fluorescence performance and organic ligands of MOFs can be modified to specifically recognize different target substances, which is crucial for ensuring food safety and maintaining quality control.

MOFs based on lanthanide metal ions have fluorescence properties and low toxicity. The use of lanthanide MOFs provides fine adjustability, pore size, selectivity, and sensitivity for the determination of pollutants in food, thereby saving time and resources [15,16,30,31]. Theanchai et al. [32] synthesized a water stable 3D lanthanide based MOFs, in which ligand 1,2,4,5-phenyltetracarboxylic acid was incorporated into Tb-MOFs as a detection and recognition site for selective interaction with paraquat, resulting in severe fluorescence quenching; The synthesized Tb-MOFs are not only stable to water, but also resistant to acid and alkaline conditions, and have been proven to be a turn-off luminescence sensor for detecting toxic paraquat. Even in the presence of common pollutants in complex matrices, it can quickly detect paraquat in aqueous solutions with high sensitivity and selectivity. Gupta et al. [33] synthesized a water dispersible Tb-MOFs as a biological interface for E. coli antibodies and built a rapid and sensitive sensing platform for E. coli. This is the first study on the detection of E. coli using a fluorescent biosensor based on MOFs. This type of lanthanide metal organic framework material fluorescent sensor has excellent stability and fluorescence stability, and has been widely used in the field of food safety sensing and detection, demonstrating enormous development potential [34,35,36].

In this article, a fluorescent aptasensor based on Tb-MOFs was constructed to quantitatively detecting Pseudomonas aeruginosa, in which Tb-MOFs used as the fluorescence signal source, AuNPs as the signal conversion switch, and aptamers as the target recognition element. The principle of the sensor is that AuNPs aggregates under high concentration of NaCl. The aptamer protects the AuNPs from aggregating. When Pseudomonas aeruginosa are present, the aptamer is removed, and the aggregation of colloidal gold leads to the restoration of fluorescence. The higher the concentration of the Pseudomonas aeruginosa bacterial solution added, the greater the fluorescence intensity value of the sensor solution system will be. Therefore, the fluorescence signal change of the sensor can be used to achieve precise quantitative detection of Pseudomonas aeruginosa.

2. Materials and Methods

2.1. Chemicals and Reagents

TbCl_3_·6H_2_O, 3,5-dicarboxyphenylboronic acid (5-BOP), HAuCl_4_, sodium citrate, N,N-Dimethylformamide (DMF), agar were purchased from aladdin. Peptone, beef extract were purchased from Beijing Aoboxing Universeen Bio-tech Co., Ltd. (Beijing, China). Pseudomonas aeruginosa was purchased from Beijing Biobank Biotechnology Co., Ltd. (Beijing, China). All other solvents were of analytical grade. All solutions were prepared with ultrapure water (>18 MΩcm) from a Millipore Milli-Q water purification system.

2.2. Apparatus and Characterization

Scanning electron micrographs (SEM) were carried out on a JSM–6390A (JEOL Ltd., Tokyo, Japan) scanning electron microscope using an accelerating voltage of 20.0 kV. X-ray diffraction (XRD) patterns of the samples were recorded using a D/MAX-3C (Rigaku, Tokyo Japan). Infrared spectra were measured on a VERTEX 70 Fourier transform infrared (FTIR) spectrometer (Bruker, Billerica, MA, USA). Fluorescence measurements were performed using a Cary Eclipse device (Varian, Palo Alto, CA, USA).

Pseudomonas aeruginosa aptamer employed in this research were purchased from TaKaRa (Dalian, China). The sequences were as follows: CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG.

2.3. Synthesis of Tb-MOFs

To Tb-MOFs were synthesized by solvothermal method. Briefly, 37.3 mg of TbCl_3_·6H_2_O was accurately weighed and dissolved in a 10 mL DMF/H_2_O mixture (7:3, v/v) solution, and then 20.9 mg of 5-BOP was added to the solution under magnetic stirring until completely dissolved. Next, the mixed solution was placed in a high-pressure reactor lined with polytetrafluoroethylene and reacted at 150 °C for 12 h. Finally, after centrifugation, the supernatant was discarded and the precipitate was collected and washed with DMF and anhydrous ethanol. Tb-MOFs were obtained by drying overnight at 50 °C in a constant temperature drying oven.

2.4. Synthesis of AuNPs

1.5 mL 1% (w/v) HAuCl_4_ solution was diluted to 100 mL and heated to boiling, followed by addition of 3.5 mL of 1% (w/v) sodium citrate solution. Then, the color of the solution changed from light yellow to wine red and stirred for 20 min. After being cooled down to room temperature, the prepared AuNPs was placed in a dark brown bottle and stored in a refrigerator at 4 °C for later use.

2.5. Preparation of Pseudomonas aeruginosa Bacterial Solution

5.0 g of peptone, 3.0 g of beef extract, and 5.0 g of sodium chloride were added to 1 L of deionized water, and adjust pH to 7.0. Then, the prepared liquid culture media was sterilized at 121 °C in a high-pressure sterilization oven to obtain beef extract peptone liquid culture medium. Under the same conditions, agar was added to yield beef extract peptone solid culture medium.

Preparation of Standard Bacterial Solution: The frozen glycerol bacterial strain was disinfected with 75% alcohol and then thawed. Subsequently, 100 μL of the thawed bacterial solution was evenly spread onto the solid culture medium using a spreader and placed in a constant temperature incubator at 28 °C for 24 h for the first activation. A certain amount of bacterial cells was picked from the second-generation activated strain by a clean inoculation loop and inoculated into the liquid culture medium. Then, the capped triangular flask containing the liquid culture medium was placed in a constant temperature shaker (28 °C, 200 rpm/min) for 24 h of cultivation.

After that, liquid culture was centrifuged at 6000 rpm/min for 2 min, then the bacterial precipitate was collected and washed with sterile water. Then, the washed bacteria was resuspend in sterile water and diluted with a gradient concentration. Each bacterial culture was separately inoculated onto solid culture medium plates and placed in a 28 °C constant temperature incubator for inverted cultivation for 24 h.

Then the concentration of the original bacterial suspension was calculated. Finally, the known concentration of Pseudomonas aeruginosa bacterial solution was centrifuged at 6000 rpm/min for 5 min. The bacterial precipitate was resuspended in sterile water and diluted with sterile water at concentrations of 10, 10^2^, 10^3^, 10^4^, 10^5^, 10^6^ and 10^7^ to obtain standard bacterial solutions of different concentrations of Pseudomonas aeruginosa.

2.6. Detection of Pseudomonas aeruginosa

Firstly, 200 μL of AuNPs solution was mixed with 50 μL the 150 nM aptamer solution and incubated at room temperature for 10 min. Subsequently, 100 μL 140 mM NaCl was added into the mixture and incubated at room temperature for 10 min. Then, 20 μL of different concentration gradient Pseudomonas aeruginosa suspensions (0~10^6^ CFU/mL) were added to the above mixture. Finally, 120 μL of Tb-MOFs suspension (0.25 mg/mL) was added to the above mixture to prepare the detection solution. The mixture was incubated at room temperature for 10 min, and the fluorescence emission spectrum was recorded at an excitation wavelength of 256 nm. The fluorescence intensity value of the mixture at 556 nm was analyzed.

2.7. Actual Sample Testing

To verify the feasibility of applying this method to actual samples, spiked recovery experiments were conducted in bottled drinking water and orange juice beverages to test the fluorescence aptasensor on actual samples. Prior to measurement, the orange juice beverage was diluted tenfold with deionized water. During the detection, a certain concentration gradient (10^2^, 10^4^ and 10^6^ CFU/mL) of Pseudomonas aeruginosa suspension was added to water and orange juice samples, and the fluorescence intensity value was tested. At the same time, the plate counting method was used as a control experiment to test the reliability of the fluorescence sensor. Actual samples with different concentration gradients (10^2^, 10^4^ and 10^6^ CFU/mL) of Pseudomonas aeruginosa were diluted tenfold, and 100 μL of each concentration gradient was taken for plate coating. The plates were inverted and incubated in a constant temperature incubator at 28 °C for 24 h.

3. Results

3.1. Characterization Analysis of Tb-MOFs

The surface morphology of Tb-MOFs was observed through the SEM image in Figure 1A–C. The material presents a rod-like shape with varying lengths ranging from 0.4 to 1.5 μm. The surface is rather rough and exhibits a distinct granular structure. The TEM image (Figure 1D) showed the presence of small particles adhering to the surface of the material. The porosity of the Tb-MOFs is assessed using the N_2_ adsorption–desorption isotherms (Figure 1E). The Brunauer–Emmett–Teller (BET) surface area was calculated to be 55.1267 m^2^/g. All these results illustrate the efficient synthesis of the Tb-MOFs. The EDS spectrum (Figure 1F) verified that the Tb-MOF nanosheets comprised Tb, C, O, and B elements. The HAADF-STEM image and element mappings of Tb-MOF (Figure 1G) depicted that Tb, C, O, and B were uniformly distributed in the rod-like shape.

The crystalline structure of Tb-MOF was investigated via X-ray diffraction (XRD). As observed from the figure, the Tb-MOF sample exhibits diffraction peaks, and these peaks match well with the simulated XRD pattern created by single crystal X-ray diffraction data, confirming the successful preparation of the Tb-MOF material [37].

By FTIR of Tb-MOFs (Figure 2B), the characteristic peak at 1701 cm^−1^ in the 5-BOP ligand spectrum is attributed to the absorption band of the carboxyl group, and the peak at 1379 cm^−1^ corresponds to the symmetric stretching vibration of the carboxyl group. The disappearance of the peak at 1701 cm^−1^ in the Tb-MOFs spectrum indicates the disappearance of the absorption band of carboxyl groups in Tb-MOFs, proving that the carboxyl groups in the ligand coordinate with Tb^3+^ to construct Tb-MOFs. In addition, the disappearance of the characteristic peak at 980 cm^−1^ in the Tb-MOFs spectrum indicates the disappearance of the hydroxyl band in the carboxyl group, and the characteristic peak at 551 cm^−1^ corresponds to the formation of Tb-O bonds. These experimental results confirm the synthesis of Tb-MOFs.

The elemental composition and valence states of Tb-MOFs were analyzed by using XPS spectroscopy. As shown in Figure 3A, five typical peaks were observed at 149.86 eV, 285.46 eV, 532.19 eV, 1242.82 eV, and 1277.48 eV, corresponding to the characteristic peaks of B1s, C1s, O1s, Tb3d_5/2_, and Tb3d_3/2_, respectively. The C1s analysis spectrum in Figure 3B shows three characteristic peaks at 284.88 eV, 286.73 eV, and 288.56 eV, corresponding to C-C bond, C-O bond, and C=C bond, respectively. The Tb3d analysis spectrum in Figure 3C shows a distinct satellite peak and two main peaks, with binding energies of 1276.8 eV and 1242.6 eV, corresponding to Tb3d_3/2_ and Tb3d_5/2_, respectively.

3.2. Fluorescence Properties of Tb-MOFs

The fluorescence properties of Tb-MOFs were shown in Figure S1. Figure S1A showed that Tb-MOFs exhibited two high-resolution characteristic emissions at 503 nm and 556 nm under the excitation wavelength of 256 nm, corresponding to the Tb^3+^ transition from ^5^D_4_→^7^F_J_ (J = 6, 5). Figure S1B showed that the fluorescence intensity of Tb-MOFs did not change significantly within one month, indicating that Tb-MOFs has good stability and excellent fluorescence performance. The fluorescence intensity of MOF materials was highest at pH = 5, and relatively weak at pH = 13 and pH = 1114, indicating that strong acid and strong alkali conditions can affect the fluorescence performance of MOF materials (Figure S1C). As shown in Figure S1D, the concentration of NaCl can affect the fluorescence intensity of Tb-MOFs.

The detection principle of fluorescence sensors was mainly based on the interaction between dispersed (red) and aggregated (blue) AuNPs and Tb-MOFs. Figure 4A showed the UV absorption spectra of AuNPs in dispersed and aggregated states, which was attributed to the neutralization of charged citrate ions by NaCl, causing the AuNPs to transition from a dispersed state to an aggregated one, resulting color change from red to blue. From Figure 4B, it can be seen that dispersed AuNPs has a significant fluorescence quenching phenomenon on Tb-MOFs material, while aggregated AuNPs has a weak effect on the fluorescence intensity of the material.

Figure 4C showed the Zeta potential diagram of Tb-MOFs material, AuNPs, and AuNPs-aptamer, providing reliable evidence for the quenching mechanism (FRET) of fluorescent materials. Tb-MOFs material exhibited ultra-high positive charge, AuNPs exhibited strong negative charge, but the charge of AuNPs-aptamer was reduced, verifying that the aptamer can attach to the surface of AuNPs. It indicated that highly positively charged fluorescent materials can bind with negatively charged AuNPs, verifying that the quenching mechanism of fluorescent materials is the FRET pathway. Figure 4D showed the UV visible absorption spectra of dispersed AuNPs, aggregated AuNPs, and fluorescence spectra of Tb-MOFs material. The UV absorption peak of dispersed AuNPs significantly overlaps with the fluorescence emission peak of Tb-MOFs, satisfying the FRET condition; The UV absorption peak of the aggregated AuNPs shifts to 680 nm, showing less overlap with the fluorescence emission peak of the material, and does not meet the conditions for FRET. It once again confirmed that the quenching mechanism of the fluorescent material is through the FRET pathway.

3.3. Detection of Pseudomonas aeruginosa

In order to obtain excellent performance, some parameters were optimized: (a) the concentration of NaCl, (b) the concentration of aptamer, (c) amount of Tb-MOFs, (d) the concentration of bacterial Solution. Respective data and Figures are given in the Electronic Supporting Material (Figures S2–S5). The following experimental conditions were found to give best results: (a) Optimal NaCl concentration: 140 mM. As shown in Figure S2, when NaCl concentration is 0140 mM, the ratio of UV absorption peaks at 650 nm and 520 nm gradually increases, indicating that AuNPs aggregates in large quantities within this range, the particle size increases, and the UV absorption peak wavelength shifts towards longer wavelengths. After NaCl concentration exceeds 140 mM, the ratio of the UV absorption peaks at 650 nm to 520 nm slightly decreases. This is because the AuNPs particles reach saturation after a large amount of aggregation, and excessive NaCl cannot cause them to continue to aggregate; (b) Optimal aptamer concentration: 150 nM. This is because excessively high aptamer concentration may cause changes in the charge distribution on the surface of AuNPs particles, leading to a decrease in the stability of AuNPs and easy aggregation; At the same time, excessively high concentrations of aptamers may lead to increased non-specific binding between aptamers and AuNPs particles, resulting in the aggregation of AuNPs particles; (c) Optimal amount of Tb-MOFs: 120 μL. As the amount of Tb-MOFs added increases, the fluorescence quenching effect of AuNPs on Tb-MOFs gradually reaches saturation; (d) Suitable bacterial concentration detection range of 010^6^ CFU/mL. When the bacterial concentration was 10^5^ CFU/mL and 10^6^ CFU/mL, the UV absorption peak of AuNPs at 520 nm weakened and the UV absorption peak at 650 nm increased, indicating that AuNPs was induced to aggregate by NaCl (Figure S5). In order to prevent interference with experimental results caused by high bacterial concentration, a suitable bacterial concentration detection range of 0~10^6^ CFU/mL was selected.

Under the optimal detection conditions, the analytical performance of the fluorescence aptasensor were shown in Figure 5. Figure 5A showed that as the bacterial solution concentration continued to increase, the fluorescence intensity of the sensor also gradually increased, indicating that the sensor has a unique fluorescence signal response to Pseudomonas aeruginosa. Figure 5B showed a linear relationship between the fluorescence intensity of the target solution at 556 nm and the logarithmic value of the concentration of Pseudomonas aeruginosa solution. It was found that there is a good linear relationship in the concentration range of 1~10^6^ CFU/mL. The linear regression equation was I = 131.82 log C + 1065.15, where log C is the logarithmic value of the concentration of Pseudomonas aeruginosa solution and R^2^ is 0.9909. After testing 11 blank samples, the detection limit (LOD) of the fluorescence sensor was calculated to be 0.63 CFU/mL.

The response time of the fluorescent aptasensor based on Tb-MOFs was studied in detail. As illustrated in Figure S6, the target mixture (AuNPs, aptamer, NaCl, and Pseudomonas Aeruginosa) was added into Tb-MOFs and incubated for 10 min, the fluorescence intensity increased by 90 percent in 40 s, and reached a constant value after 160 s. Therefore, the response time is 160 s. The results showed that Tb-MOFs was a “fast response” fluorescent probe for Pseudomonas Aeruginosa detection. There’s no denying that recycling performance is an important factor to consider during fluorescence detection. Tb-MOFs is stable in water and alcohol, which made its recycling simple and fast. The used Tb-MOFs can be recovered after being cleaned with 95% alcohol for three times and dried in air. The fluorescence intensity of Tb-MOFs could be recovered to 90%, and the recovery time is 2 h.

3.4. Detection Principle of the Fluorescent Aptasensor Based on Tb-MOFs

The fluorescent aptasensor based on Tb-MOFs was constructed to quantitatively detecting Pseudomonas aeruginosa, in which Tb-MOFs used as the fluorescence signal source, AuNPs as the signal conversion switch, and aptamers as the target recognition element. The principle of the sensor is shown in Scheme 1. The aptamer of Pseudomonas aeruginosa can protect the AuNPs from aggregation in the presence of high concentration NaCl. Therefore, the dispersed AuNPs can effectively quench the fluorescence of Tb-MOFs materials. However, when Pseudomonas aeruginosa is added, it will specifically bind to the aptamer, pulling the aptamer away from the surface of the AuNPs. The AuNPs will aggregate by high concentration of NaCl, and has a negligible effect on the fluorescence intensity of Tb-MOFs materials, which results fluorescence intensity value of the system. The higher the concentration of the Pseudomonas aeruginosa bacterial solution added, the greater the fluorescence intensity value of the sensor solution system will be. Therefore, the fluorescence signal change of the sensor can be used to achieve precise quantitative detection of Pseudomonas aeruginosa.

3.5. Anti-Interference Performance

The anti-interference performance of sensor are shown in Figure 6. Most of the interfering substances of Ca^2+^, K^+^, Na^+^, Mg^2+^, Cl^−^, CO_3_^2−^, SO_4_^2−^, Escherichia coli, Staphylococcus aureus, Bacillus subtilis, Salmonella, and Bacillus cereus have little effect on the fluorescence intensity of the sensor. After HCO_3_^−^ was added, the fluorescence intensity increased. The reason may be that HCO_3_^−^ exists in the solution with both hydrolysis and ionization equilibrium. The surface of AuNPs acts as a micro-reactor, where local charges and ion concentrations may accelerate the movement of the equilibrium, thereby affecting the structure of the aptamer and weakening the binding force between the aptamer and the AuNPs surface, resulting in an increase in fluorescence intensity. In addition, only after adding Pseudomonas aeruginosa, the fluorescence intensity value of the sensor increased significantly. The experimental results showed that most of the interfering substances added, except for HCO_3_^−^, did not interfere with the detection results, verifying the reliability of the fluorescence sensor.

3.6. Real Sample Detection

The spiked recovery method was used to explore the practical applicability of the fluorescent sensor for an evaluation of Pseudomonas aeruginosa in bottled drinking water and orange juice samples. According to the method described in the previous section, the results were shown in Table 1. The fluorescence aptasensor was used to detect Pseudomonas aeruginosa in actual samples, with a recovery rate ranging from 89.59% to 107.93% and a relative standard deviation of 2.7% to 5.6%. This indicated excellent consistency between the spiked concentration and the concentrations detected in water and orange juice samples. At the same time, the plate counting method was used to calculate the concentration of bacterial solution in the actual sample. From the data in Table 1, it can be seen that the Pseudomonas aeruginosa concentration obtained by the plate counting method was basically consistent with the results of the fluorescence sensor detection method, which once again verified that this method can be used for the detection of Pseudomonas aeruginosa in complex substrate environments such as water and orange juice.

The method was compared with previously reported methods targeting at detection of Pseudomonas aeruginosa, as shown in Table S1 [38,39,40,41,42]. It is noticeable that our sensor has an excellent performance for the detection of Pseudomonas aeruginosa, with acceptable linear range and LOD. More importantly, the method is successfully applied in food samples (bottled drinking water and Orange juice) with intricate matrix. The fabrication of the biosensor and detection procedure are facile. Therefore, the biosensor can meet the demand for rapid, selective and sensitive detection of bacteria in food samples.

4. Conclusions

The Tb-MOFs fluorescent aptasensor was constructed for quantitative detection of Pseudomonas aeruginosa. Under the optimal detection conditions, a standard curve relationship between fluorescence intensity values and the concentration of Pseudomonas aeruginosa was established. In addition, the Tb-MOFs fluorescent aptasensor also exhibits good sensitivity and anti-interference ability, and is applied to the detection of Pseudomonas aeruginosa in actual samples (bottled drinking water and orange juice). In summary, the Tb-MOFs fluorescent aptasensor provides a rapid and sensitive new sensing method for the detection of Pseudomonas aeruginosa in food.