Aspergillus conicus Endophyte Improves the Development of Eucalyptus camaldulensis Seedlings In Vitro

TL;DR

A fungus called Aspergillus conicus helps Eucalyptus camaldulensis seedlings grow faster and better in lab conditions.

Contribution

This study identifies A. conicus as a beneficial endophyte for E. camaldulensis seedling development.

Findings

Inoculated seedlings showed faster development, more leaves, and greater biomass.

Seeds treated with A. conicus filtrate had higher germination rates and less fungal contamination.

The fungus colonized roots, stems, and leaves, indicating a strong endophytic relationship.

Abstract

Fungi of the genus Aspergillus promote plant growth and resistance, enhance nutrient uptake, protect plants against pathogens, and increase tolerance to environmental stress. We examined the symbiosis between Aspergillus conicus and seedlings of Eucalyptus camaldulensis, a forest species widely grown in Brazil for its valuable wood and resilience. The fungus was identified as an endophyte of E. camaldulensis seeds grown in Murashige and Skoog basal medium. We observed that inoculated seedlings developed faster than those without the fungus. In xerophilic medium, A. conicus produced abundant spores. Analysis of the internal transcribed spacer region grouped the isolate with other A. conicus species. Seedlings grown on Murashige and Skoog medium with fungal fragments showed significant shoot growth, more leaves, and greater biomass than uninoculated seedlings. Seeds immersed in A. conicus filtrate for 24 h showed less contamination by other fungi and a higher germination rate than those in the control group. Indole acetic acid production was below the detection limit. The fungus was endophytic, extensively colonizing the roots and present in the stems and leaves of inoculated plants. We investigated the implications of this fungal association with E. camaldulensis seedlings and highlighted its potential benefits for plant growth and development.

Figures

Macroscopic and microscopic characteristics of the endophytic fungus A. conicus. (A) Macroscopic image of A. conicus grown on PDA medium for 7 days (scale: 20 mm). (B) Image of A. conicus spores under an optical microscope (scale: 50 μm). (C) Image of A. conicus sporangiophore under an optical microscope (scale: 1 μm).

Phylogenetic tree of the endophytic fungal isolate A. conicus based on the ITS sequence in rDNA genes. The Neighbor‐Joining method with the Jukes and Cantor sequencing DNA parameter (FASTA) was used for sequence alignment in MEGA 11.

(A) Eucalyptus camaldulensis seedlings with fungal inoculum (left) and without fungal inoculum (right). (B) Difference in shoot fresh mass between the control group (bottom) and the group with the fungal isolate (top).

Evaluation of biometric variables in E. camaldulensis seedlings inoculated with A. conicus. (A) Root length (cm). (B) Shoot length (cm). (C) Number of leaves. (D) Shoot fresh mass (g). (E) Shoot dry mass (g). (F) Root fresh mass (g). (G) Root dry mass (g). All bar charts were plotted with mean ± SD (N = 10) and significance at 5% probability according to the Kruskal–Wallis test. *: significant at 5% probability (p < 0.05).

Tables

TABLE 1. Molecular identification of the endophytic fungus A. conicus by sequencing the ITS region of rDNA submitted to the NCBI GenBank database.

Sample: MZ088045	Taxonomic classification
Identification	Aspergillus conicus
Taxonomic Classification (NCBI)	Phylum Ascomycota Class Eurotiomycetes Order Eurotiales Family Aspergillaceae Genus Aspergillus
Similarity (%)	99.32%
Coverage (%)	100%

TABLE 2. Proportion of E. camaldulensis seedlings colonization by the fungus A. conicus. Inoculation was via seedling, and re‐isolation occurred in different plant tissues.

Treatment	Parts of the plant
	Roots	Leaf	Stem
Control	0%	0%	0%
A. conicus	47%a	36%ab	17%b

TABLE 3. Effect of A. conicus filtrates on the germination of E. camaldulensis seeds.

Treatments	% Germination	% Contamination	Root length (cm)
Control	0 ± 0b	99.1 ± 0.7a	0 ± 0b
T1	98.3 ± 1.5a	0 ± 0b	0.67 ± 0.06a
T2	0 ± 0b	100 ± 0a	0 ± 0b

Full text

Introduction

1

The symbiosis between fungi and plants is an ecologically vital phenomenon that plays a crucial role in the health of terrestrial ecosystems and enhances agricultural productivity. Recent research has shown that this symbiotic relationship provides essential mutual benefits, including improved plant nutrient uptake, protection against pathogens, and contributions to soil health [1]. Fungi of the genus Aspergillus are important in ecosystems, offering several benefits to plants. These fungi can increase the efficiency of low‐mobility nutrient absorption in plants, such as the solubilization of phosphorus, which is vital for plant growth and development [2, 3, 4]. Additionally, some Aspergillus species produce bioactive substances that stimulate plant growth and development and increase resistance to environmental stresses such as drought and salinity [4, 5, 6]. These fungi can also act as biological control agents by producing antimicrobial compounds that protect plants from various pathogens [7]. These aspects are particularly important for sustainable agriculture and the restoration of degraded ecosystems, where the interaction between fungi and plants is key to restoring soil health and biodiversity [8].

Furthermore, studies have shown that fungus–plant interactions can increase plant resistance to environmental stresses such as drought and salinity and are fundamental for the resilience and sustainability of ecosystems [6, 7, 8, 9]. The rational management of soil fungal communities can improve crop yield and soil health [9]. Therefore, understanding and applying these symbiotic interactions are essential for advancing environmental conservation practices and sustainable agriculture. In sustainable forestry, the strategic use of beneficial fungi, such as certain Aspergillus species, promises to improve tree growth and health, assist in the recovery of degraded soils, and provide biological control of pests and diseases [10].

Providing plants with physiological and genetic qualities is essential to meet growing market demand. Endophytic fungi, especially those of the Aspergillus genus, have emerged as strategic allies that play crucial roles in promoting plant growth, biocontrol of crop pests, nutrient solubilization, and hormone production [11, 12].

Molecular identification techniques and biometric tests have expanded our understanding of fungi associated with plants of the Eucalyptus genus. The internal transcribed spacer (ITS) region of DNA is widely used to identify fungi because of its highly variable and conserved characteristics. This region is present in the ribosomal DNA (rDNA) of fungi and comprises internal transcribed spacer 1 (ITS1) and internal transcribed spacer 2 (ITS2), which are separated by the 5.8S ribosomal gene sequence [13]. The main advantage of the ITS region is its ability to quickly and accurately provide taxonomic and phylogenetic information.

From this perspective, our study aimed to identify a fungal isolate potentially beneficial to plants and to investigate the effects of fungus–plant interactions on the development of E. camaldulensis seedlings in vitro.

Materials and Methods

2

Isolation of the Endophytic Fungus

2.1

The fungal inoculum was isolated directly from a seedling grown from Eucalyptus camaldulensis seeds supplied by Sementes Caiçara (Brejo Alegre, Brazil; https://sementescaicara.com/), cultivar LCFA 014, which exhibited natural colonization by the fungus. The seeds were cultivated on Murashige and Skoog Modified Multiplication Medium (Phytotec Labs, Lenexa, Kansas, USA, Product ID M555) at the Insect‐Microorganism Symbiosis Laboratory (LASIM) at the Federal University of Tocantins, Gurupi Campus. The isolate was transferred to potato dextrose agar (PDA; Ref. K25 1022; KASVI, São José dos Pinhais, Brazil), pH 6.5, and incubated in an air‐conditioned chamber at 25°C ± 2°C with a 12‐h photoperiod to obtain a pure fungal colony. After purification, the isolate was inoculated into a medium of the same composition and maintained under the same temperature and photoperiod conditions for 12 days.

Morphological and Molecular Identification of the Fungal Isolate and Phylogenetic Analysis

2.2

Preliminary morphological characterization was performed to identify the fungal isolate and investigate the nature of its association [14, 15, 16]. The isolate was cultivated in a xerophilic culture medium (200 g glucose, 200 g sucrose, 10 g yeast extract, 10 g agar, and 580 mL distilled water) to promote rapid growth and spore production [17]. The Petri dishes were incubated at 25°C ± 2°C with a 12‐h photoperiod for 7 days in an air‐conditioned chamber. The culture was sent to the Molecular Identification Laboratory (Desenvolvimento Sustentável e Monitoramento Ambiental) for DNA characterization, polymerase chain reaction (PCR), and rDNA gene sequencing. PCR was conducted using two universal primers, ITS1 (5′ TCCGTAGGTGAACCTGCGG 3′) and ITS4 (5′ TCCTCCGCTTATTGATATGC 3′), which were included in the reaction mixture [18]. Sequencing was performed using the Sanger method on an Applied Biosystems 3730XL instrument. The sequence of the ITS region of the rDNA was obtained and submitted to the National Center for Biotechnology Information (NCBI) GenBank, where it received the accession number MZ088045 for comparison with sequences in this database. The selected sequences were based on the highest similarity values obtained. Once the sequence was determined, it was analyzed using Molecular Evolutionary Genetics Analysis (MEGA) 11 software with the neighbor‐joining method and Jukes and Cantor DNA sequencing parameters (FASTA) [19].

Endophytic Colonization of Eucalyptus Seedlings In Vitro

2.3

Eucalyptus camaldulensis seeds were surface disinfected with 2% active sodium hypochlorite. The plates were kept in an air‐conditioned chamber at 25°C ± 2°C with a 12‐h photoperiod. After 7 days of germination, 10 of the most vigorous seedlings from each plate were transplanted into tubes (25 mm × 95 mm) containing Murashige and Skoog culture medium [20]. Three days after transplanting, three 10 mm diameter disks of actively growing endophyte colonies were inoculated into each tube. After 15 days of inoculation, the biometric characteristics of the seedlings were evaluated. The tubes were kept in an air‐conditioned chamber for 20 days at 25°C ± 2°C with a 12‐h photoperiod. During this period, the tubes were rotated twice a week to meet the experimental design requirements and to avoid possible differences in light, temperature, and shading.

Determining Endophytic Colonization

2.4

We followed the methodology proposed by [21] to assess endophytic colonization, with some modifications. Plant parts (roots, stems, and leaves) were sectioned in a laminar flow cabinet and surface‐sterilized in 70% alcohol for 30 s and 2% sodium hypochlorite for 40 s. These parts were then washed three times with distilled, autoclaved water. The fragments were cut with sterilized scissors and placed in Petri dishes containing PDA medium supplemented with 250 mg/L chloramphenicol. The plates were incubated in an air‐conditioned chamber at 25°C ± 2°C with a 12‐h photoperiod for 7 days.

Biometric Parameters

2.5

The experimental design was completely randomized, with two treatments and 10 replicates. One group served as the control (plants not inoculated with the fungus), and the other group was inoculated with the fungal isolate. The morphological parameters assessed were seedling height (cm), number of leaves, shoot fresh mass (g), shoot dry mass (g), root fresh mass (g), and root dry mass (g). To determine dry mass, the shoot and root were placed in a paper bag and dried in an oven at 60°C for 12 h until they reached a constant mass. An analytical balance (Shimadzu® model AUW220D) was used to measure fresh and dry biomass. The number of leaves was determined by counting the leaves from each sample, and height was measured using a graduated ruler.

Fungal Filtrate Preparation

2.6

The fungal isolate was propagated on PDA medium. The plates were incubated in a climate chamber at 25°C ± 2°C for 7 days. Inoculation was then performed in a liquid medium of the same composition, except without agar. Three mycelial discs (7 mm diameter) of the strain were transferred to 500 mL Erlenmeyer flasks containing 300 mL of the previously autoclaved medium. The flasks were incubated for 15 days in an orbital incubator (brand: Solab Laboratories Industry and Commerce, model: SL‐223/E, Piracicaba, São Paulo, Brazil) at 100 rpm and 28°C ± 2°C [22]. After incubation, 1.5 mL aliquots of the culture medium were centrifuged in Eppendorf tubes at 10,000 rpm for 10 min. The supernatant was filtered through a Whatman® membrane 1 (wt) to obtain a cell‐free filtrate containing the compounds released by the fungus. To ensure complete removal of remaining hyphae, the filtrate was ultrasonicated (brand: Sanders do Brazil – LTDA, model: Soniclean 15D ultrasonic cleaner) for 40 min. Sterilization of the filtrate was confirmed by inoculating 2 mL into a Petri dish containing PDA medium, followed by incubation under the same initial conditions and verification of the absence of fungal growth. The control group underwent the same treatment.

Eucalyptus Camaldulensis Germination In Vitro

2.7

The bioassay for the germination of E. camaldulensis seeds was conducted using three germination test papers moistened with autoclaved distilled water [23]. The seeds were surface disinfected in sodium hypochlorite with 2% active chlorine for 5 min, followed by three rinses with distilled, sterilized water. The experiment was carried out in an acrylic box (gerbox) measuring 11 × 11 × 3.5 cm. Three treatments were applied: (i) control group (C), in which disinfected seeds were spread on germination papers moistened with 3 mL of liquid culture medium (without fungus); (ii) treatment T1, in which disinfected seeds were immersed for 24 h in the fungal filtrate and then spread on germination paper moistened with 3 mL of autoclaved distilled water; and (iii) treatment T2, in which seeds were spread on germination paper moistened with 3 mL of the fungal culture filtrate. A total of 400 seeds, divided into 10 replicates of 40 seeds per treatment group, were used in the experiment. The seeds were kept in a chamber at 25°C ± 2°C with a 12‐h photoperiod. Seed germination was recorded daily for 7 days [24]. To ensure uniform germination conditions, the acrylic boxes (gerboxes) were rearranged daily according to a predetermined experimental design. The paper and seeds were moistened daily with autoclaved distilled water to maintain optimal germination conditions. Seeds that developed a root longer than 2 mm were considered for statistical analysis, as described in the Rules for Seed Analysis (RSA) [23]. The data obtained were used to establish a germination table according to the equation proposed by [25]: G% = (number of seeds germinated/number of seeds used for germination) × 100.

Analysis of the Production of Indole Acetic Acid (IAA)

2.8

To determine the production and concentration of the phytohormone IAA, isolated A. conicus was incubated in Czapek broth (glucose 10 g, L‐tryptophan 1 g, NaNO3 3 g, K2HPO4 1 g, MgSO4 0.5 g, FeSO4 0.01 g) at pH 7. The culture was maintained for 7 days at 28°C ± 2°C in an incubator with orbital shaking at 120 rpm. The medium was then filtered through Whatman No. 1 quantitative filter paper and acidified to pH 3.0. The samples were concentrated and dissolved in methanol. IAA was quantified using Salkowski reagent (1 mL of 0.5 M FeCl₃ in 35% perchloric acid). Spectrophotometric analysis at 535 nm (standard range 0–64 µm/mL) was conducted to determine the IAA concentration according to a previously described method [26].

Statistical Analyses

2.9

The data were analyzed using analysis of variance with Statistica® 7.0 software. For the germination experiment, which included three treatment groups, means were compared using Tukey's test at a 5% significance level. In the other experiments, means were compared using the Student t‐test for two independent samples, and inoculation efficiency proportions were compared using the comparison of proportions test, both with significance set at 5%. When samples did not meet the assumptions for parametric mean tests, the non‐parametric Kruskal–Wallis test was used at the same significance level.

Results

3

Identification of the Fungal Isolate

3.1

Aspergillus conicus was identified based on morphological characteristics and molecular analysis of the ITS region of rDNA. Young cultures of the fungus grown in the medium described by [17] exhibited white coloration with flocculent mycelia, a pale‐yellow reverse side, and filamentous margins. In mature cultures, a light gray coloration was observed, along with flocculent mycelia, a dark brown reverse side, and filamentous margins. In both stages, the hyphae were hyaline, and the spores were spherical, with moderate growth and a velvety texture (Figure 1).

Macroscopic and microscopic characteristics of the endophytic fungus A. conicus. (A) Macroscopic image of A. conicus grown on PDA medium for 7 days (scale: 20 mm). (B) Image of A. conicus spores under an optical microscope (scale: 50 μm). (C) Image of A. conicus sporangiophore under an optical microscope (scale: 1 μm).

The ITS region sequence of the rDNA was deposited in GenBank under accession code MZ088045. Phylogenetic analysis enabled the construction of a tree based on nucleotide similarity, which placed the isolate within the genus Aspergillus, together with other members of the section Restricti (Figure 2). The isolate showed 99.32% similarity and 100% coverage with sequences from A. conicus (Table 1). These results support the identification of this species and confirm that it belongs to the class Eurotiomycetes in the phylum Ascomycota. These fungi are characterized by septate hyphae and reproduction through spores [27]. Based on combined morphological and molecular analyses, as well as a recent review by this group, the isolate was identified as taxonomically closely related to A. conicus [27, 28, 29].

Phylogenetic tree of the endophytic fungal isolate A. conicus based on the ITS sequence in rDNA genes. The Neighbor‐Joining method with the Jukes and Cantor sequencing DNA parameter (FASTA) was used for sequence alignment in MEGA 11.

Endophytic Colonization

3.2

Endophytic colonization of E. camaldulensis by A. conicus was investigated to determine the extent of association in different vegetative tissues. The colonization frequency analyzed ten days after inoculation was highest in the roots (80%), followed by the leaves (60%) and stems (30%; Table 2). These results indicate a preference of the fungus for the plant's root system.

No fungal colonies were found in the control plates, indicating that the sterilization procedure was effective, and that the growing fungal endophyte originated from the vegetative tissue of the E. camaldulensis seedlings. Some contaminating fungi and bacteria were occasionally observed growing from the inoculated plant tissue; however, such cases were rare. In summary, the results show that A. conicus was able to establish itself as an endophyte, with colonization occurring predominantly in the roots.

Biometric Parameters

3.3

The influence of the endophytic fungus A. conicus on the biometric parameters of E. camaldulensis seedlings was evaluated to determine its effects on plant growth. Symbiotic microorganisms affect the biometric parameters of their hosts in various ways. A significant difference was observed between seedlings inoculated with A. conicus and those in the control group for all morphometric variables analyzed. The height of inoculated seedlings was significantly greater than that of uninoculated seedlings (p < 0.001; Table 3).

Root length also differed significantly; the control group showed greater root growth than the group treated with the fungal isolate. Significant differences were found between the control and treated samples in the fresh and dry mass of roots and aerial parts (p < 0.001), with the fungus‐treated group showing higher values than the control. Additionally, significant differences were observed in the number of leaves among the treatments (p < 0.001; Table 3).

Seedlings associated with the endophytic fungus A. conicus had a significantly higher average number of leaves than the control group (Figure 3A). Shoot fresh mass was significantly higher in plants inoculated with the endophytic fungal isolate than in uninoculated plants (Table 3). Significantly greater increases in shoot height were observed in the group with fungal inoculation compared to the control group (Figure 3B). Overall, these results indicate that A. conicus positively affects the growth and biomass accumulation of E. camaldulensis seedlings under the conditions tested (Figure 4).

(A) Eucalyptus camaldulensis seedlings with fungal inoculum (left) and without fungal inoculum (right). (B) Difference in shoot fresh mass between the control group (bottom) and the group with the fungal isolate (top).

*Evaluation of biometric variables in E. camaldulensis seedlings inoculated with A. conicus. (A) Root length (cm). (B) Shoot length (cm). (C) Number of leaves. (D) Shoot fresh mass (g). (E) Shoot dry mass (g). (F) Root fresh mass (g). (G) Root dry mass (g). All bar charts were plotted with mean ± SD (N = 10) and significance at 5% probability according to the Kruskal–Wallis test. : significant at 5% probability (p < 0.05).

Analysis of E. camaldulensis Seed Germination

3.4

The effect of fungal treatments on the germination of E. camaldulensis seeds was studied to determine whether the isolate would affect seed viability and initial seedling establishment. Approximately 98% of the seeds in the T1 treatment germinated without fungal infection during the evaluation period, demonstrating the treatment's efficacy. In contrast, fungal contamination was detected in the seeds of E. camaldulensis in both the control (C) and fungal filtrate‐treated (T2) groups, which likely affected seedling development. In these groups, none of the germinated seedlings survived, illustrating the severity of fungal contamination (Table 3).

Quantification of IAA Production by the Fungal Isolate

3.5

Since indoleacetic acid is a phytohormone that promotes plant growth, the ability of the fungal isolate to produce IAA was investigated. Spectrometric analysis revealed that IAA production by the fungal isolates was below the detection limit of this method. These results indicate that the tested strain had no significant IAA production capacity under the experimental conditions.

Discussion

4

The aim of this study was to investigate the symbiotic interaction between the endophytic fungus A. conicus and seedlings of E. camaldulensis, focusing on effects on plant growth, seed germination, and colonization patterns. The successful colonization of the roots, leaves, and stems of E. camaldulensis seedlings can be explained by the fact that the isolate belongs to a diverse genus that is widespread in soils worldwide [27, 28, 29, 30]. This genus is known for its ability to develop under variable environmental conditions, which favors its interaction with host plants [31, 32, 33, 34].

Additionally, the soil provides favorable conditions for the development of microorganisms. In this study, the in vitro technology used was crucial for facilitating and observing colonization, as it enabled the cultivation of seedlings in an aseptic medium with controlled light, temperature, and other factors, minimizing interference from external contaminants [35, 36, 37]. However, this technology presents inherent limitations to the in vitro system. Some Eucalyptus species and hybrids are described as recalcitrant to in vitro cultivation, presenting difficulties in callus induction, organogenesis, shoot regeneration, adventitious rooting, and especially in the ex vitro acclimation phase, with a high mortality rate during transfer to field conditions [38, 39].

This result corroborates the well‐documented phenomenon of specificity in interactions between endophytic fungi and host plants, where each plant species tends to harbor a specific group of endophytic fungi, which are considered hyperdiverse [30]. The ability of A. conicus to colonize different organs of E. camaldulensis suggests that the fungus can adapt to different niches within the plant, provided the minimum requirements for its survival are met [30, 40]. This colonization can influence nutrient acquisition and growth, but the specific mechanisms still need to be elucidated.

Previous studies have shown that Aspergillus flavipes can colonize all vegetative organs of Eucalyptus and stimulate plant rooting and development [40]. These results indicate that colonization of plants by Aspergillus is a key factor in modulating the soil–plant system, acting not only as a growth promoter but also as a protective agent against abiotic and biotic stresses [40, 41].

Although beneficial to plants, the endophyte isolated in this study is an opportunistic pathogen in humans and can cause severe eye infections in immunocompromised individuals [42]. This duality emphasizes the need for further studies on the mechanisms of interaction between A. conicus and its hosts and on the risks associated with its large‐scale use in forestry. The use of endophytic fungi as bioinoculants should consider not only their benefits to plants but also their potential impact on human health and the ecosystem.

Regarding biometric characteristics, inoculation with the endophytic fungus A. conicus increased the variables evaluated in E. camaldulensis seedlings compared to the control treatment. These results are consistent with previous studies showing that Aspergillus fungi can significantly improve plant growth and abiotic stress tolerance [2, 40]. Several species of this genus, such as Aspergillus PB‐7, Aspergillus niger, Aspergillus tamarii, Aspergillus awamori, and Aspergillus cejpii DMKU‐R3G3, can produce IAA, gibberellin, and other compounds that stimulate plant growth [41, 42, 43, 44, 45, 46, 47].

IAA is produced by several endophytic fungi that directly affect root and shoot growth in plants. IAA production by A. conicus has not been demonstrated under experimental conditions. However, most Aspergillus isolates and other fungi may have other activities, such as gibberellin production, that require further investigation [48]. Improved plant growth and stress tolerance by Aspergillus species have been well documented [40, 49, 50]. The ability of A. conicus to colonize the roots, leaves, and stems of E. camaldulensis likely contributes to its ability to promote aerial growth and biomass accumulation, as observed in this study. However, the control group exhibited greater root length, suggesting that the presence of the fungus may influence resource allocation within the plant by favoring aerial growth over root growth.

In addition, the results of this study revealed significant challenges related to the presence of fungal contaminants in the seeds of E. camaldulensis that resisted the disinfection process. Both the control group C and the treated group T2 contained contaminants, which affected the development and survival of the seedlings, in contrast to group T1, which did not show the presence of contaminants. This post‐asepsis contamination can be mainly attributed to latent or internal seed‐borne fungi (not eliminated by surface disinfection) [48] or to airborne fungi that may have been deposited during the setup of the assays.

The difference observed in group T1 compared to the other groups can be attributed to the immersion of the seeds in the fungal filtrate for 24 h, which allowed greater absorption of bioactive compounds with possible antimicrobial action produced by the endophyte A. conicus. Aspergillus species are known to produce broad‐spectrum compounds such as alkaloids, terpenoids, and peptides with antifungal and antibacterial properties [49, 50], suggesting that the isolate suppressed latent contaminants in the seeds, preventing their proliferation during germination. These effects were not observed in the other treatment groups, where the absence or insufficiency of these bioactive compounds resulted in fungal contamination and compromised germination and seedling development.

Our study is the first to identify and demonstrate a positive association between the fungus A. conicus with E. camaldulensis seedlings. Our results showed that the endophyte promotes the development of Eucalyptus seedlings and possibly acts in the suppression of seed‐associated pathogens. The identification of these fungal metabolites is a promising area for the use of A. conicus‐based bioinoculants applicable to Eucalyptus cultivation.