Cytogenomics of the Flea Beetle Podagrica fuscicornis (Coleoptera, Chrysomelidae): Karyotype and Satellitome Analysis of an Alticinae Species with a High Chromosome Number

TL;DR

This study explores the high chromosome number and repetitive DNA in the flea beetle Podagrica fuscicornis, revealing insights into its karyotype evolution.

Contribution

The study provides the first detailed satellitome analysis of an Alticinae species with a high chromosome number.

Findings

The male karyotype of P. fuscicornis is 2n = 40 (38 + XY) with an Xyp sex chromosome system.

The satellitome comprises 70 satDNA families, 9.51% of the genome, with 10 shared with other Alticinae species.

SatDNA families are mainly pericentromeric and show differential distribution between autosomes and sex chromosomes.

Abstract

Background/Objectives: Flea beetles (Coleoptera, Chrysomelidae: Alticinae) show extensive karyotypic diversity, yet cytogenetic and genomic data remain scarce for many taxa. Species of the genus Podagrica are characterized by unusually high chromosome numbers compared with the modal condition in Alticinae, suggesting a history of chromosomal fissions. This study aimed to characterize the karyotype and repetitive DNA composition of Podagrica fuscicornis, with special emphasis on the satellitome and its contribution to chromosome organization. Methods: Male specimens of P. fuscicornis collected in southern Spain were analyzed using conventional cytogenetic techniques, including Giemsa staining, DAPI staining, and C-banding. Fluorescence in situ hybridization was employed to map nucleolar organizer regions (NORs), telomeric repeats, and major satellite DNA (satDNA) families. The satellitome was characterized using Illumina short-read sequencing and analyzed with the RepeatExplorer2/TAREAN pipeline to identify satDNA families and estimate their genomic abundance and divergence. Results: The male karyotype of P. fuscicornis was 2n = 40 (38 + XY), with an Xyp sex chromosome system. Constitutive heterochromatin was mainly pericentromeric, and the Y chromosome was largely heterochromatic. NORs were located on a single autosomal pair, and the ancestral insect telomeric motif (TTAGG)n was detected at chromosome ends. The satellitome comprised at least 70 different satDNA families, representing 9.51% of the genome, some of them related to transposable elements. Ten of these 70 satDNAs are shared in other Alticinae species. The most abundant families were primarily localized in pericentromeric regions and showed differential distribution between autosomes and sex chromosomes. Conclusions: These results indicate that extensive chromosomal fissions and high satDNA dynamics could drive the high chromosome number and heterogeneous genome organization in P. fuscicornis, highlighting the role of repetitive DNA in karyotype evolution within Chrysomelidae.

Figures

Full text

1. Introduction

Species of the subfamily Alticinae (Chrysomelidae) are characterized by their remarkable jumping ability, earning them the common name “flea beetles”. Nowadays, the taxonomic status of Alticinae remains controversial. Although traditionally treated as a distinct subfamily within Chrysomelidae (Alticinae), recent phylogenetic studies suggest they constitute a tribe (Alticini) within the subfamily Galerucinae [1,2,3,4,5]. These analyses indicate that the jumping capacity, conferred by the metafemoral spring, may be homoplastic rather than indicative of a monophyletic group [6]. Comprehensive phylogenomic datasets, incorporating mitogenomic and multi-marker evidence, increasingly support the placement of Alticini within Galerucinae, but a full consensus remains elusive.

Alticinae comprises approximately 8000–10,000 species [7], representing one of the most diverse lineages within Chrysomelidae. All species are phytophagous, and several are economically significant due to their potential to cause severe crop damage [8]. Conversely, some species have been explored as biological control agents against invasive weeds [9]. The diversity and distribution of Alticinae are only partially resolved, and many genera, particularly in tropical regions, remain incertae sedis at the suprageneric level [4].

The genus Podagrica constitutes a well-defined group characterized by small adults (2–6 mm) closely associated with plants of the family Malvaceae [10,11]. This host specificity is a consistent feature across the genus. Adults produce characteristic shot-hole feeding damage on leaves, while larvae develop in the roots or, in certain species, within leaf tissue. Several species, particularly P. fuscicornis, P. decolorata, and P. malvae, are recognized as major pests of cotton and ornamental Hibiscus [12]. Beyond their agricultural relevance, Podagrica species have been subjects of biomechanical studies, exhibiting performance traits (acceleration, take-off velocity, and energy efficiency) typical of highly specialized flea beetles.

Despite the extensive ecological and morphological knowledge available for Chrysomelidae, cytogenetic data remain comparatively scarce. Approximately 900 species have reported chromosome numbers [13], revealing substantial karyotypic diversity across the family. Diploid numbers range from 2n = 8 in Homoschema nigriventre to 2n = 72 in Xanthogaleruca luteola, although 2n = 24 is the most frequent count [13,14]. Within Alticinae the karyotypic spectrum is similarly broad (2n = 8–64); however, the most common number is 2n = 22, a state considered to be derived from the ancestral 2n = 24 through chromosome fusion events [14,15]. In this context, the genus Podagrica stands out for possessing some of the highest chromosome numbers described within the subfamily. Previous studies have reported a meiotic formula of n = 19 + Xy_p_ in the genus [14], indicating diploid complements far exceeding the basal condition proposed for Alticinae, suggesting a lineage-specific history dominated by chromosomal fissions. Chromosomal morphology in Alticinae is dominated by metacentric elements, but acrocentric chromosomes, conspicuous size heterogeneity, minute Y chromosomes, and enlarged sex chromosomes are also documented [16,17], indicating a dynamic chromosomal evolution within the group.

Patterns of constitutive heterochromatin in Alticinae, as revealed by C-banding, generally show pericentromeric localization, often accompanied by additional blocks on sex chromosomes as reported in Omophoita genus [17,18]. The chromosomal distribution of nucleolar organizer regions (NORs) varies widely across Chrysomelidae, occurring on one or several autosomal pairs and occasionally on sex chromosomes [19,20,21,22]. FISH studies in Alticinae usually detect a single autosomal NOR-bearing pair [23,24,25], but exceptions, such as Omophoita magniguttis with two NOR-bearing pairs, point to rearrangements affecting rDNA loci [26]. Additional variability is observed in telomeric organization, with some Coleoptera species frequently replacing the insect ancestral (TTAGG)n sequence with alternate motifs such as (TCAGG)n or (TTAGGG)n [27]. Notably, a novel telomeric motif, (TTTGG)n, was recently reported in the genus Lachnaia (Cryptocephalinae), underscoring the evolutionary dynamism of repetitive sequences in this group [28].

Understanding the origin of the unusually high chromosome number in Podagrica species, including P. fuscicornis, requires consideration of the repetitive DNA fraction, particularly satellite DNA (satDNA) sequences. Satellite DNA is one of the major components of constitutive heterochromatin and has shifted from being considered “junk” to being recognized as functionally integral to chromosome architecture, functioning, and genome evolution. Satellite DNAs frequently constitute the principal sequence content of centromeres, participating in chromatin assembly and function, thereby influencing chromosome segregation and stability [29,30,31,32]. Transcription of satDNA has been implicated in heterochromatin formation, centromere identity, and stress response; consequently, dysregulation of satDNA expression can affect gametogenesis and genome stability [30,33,34,35]. Monomer length, nucleotide composition, genomic abundance, and chromosomal distribution of satDNAs vary widely among closely related species. The genomic fraction occupied by satDNA ranges from negligible percentages to more than half of the genome [36,37,38]. Advances in high-throughput sequencing and bioinformatic pipelines (e.g., RepeatExplorer2, TAREAN) now allow the characterization of the complete library of satDNAs (the “satellitome”) directly from unassembled short-read data, overcoming limitations of genome assemblies in repetitive regions [39,40,41]. Notably, comparative satellitome analyses across the few Chrysomelidae species studied so far reveal substantial variability in the number, composition, abundance, and TE-related origins of satDNA families, suggesting links with chromosomal reduction, sex-chromosome differentiation, and broader genomic restructuring.

Given the exceptionally high chromosome number inferred for Podagrica species and the likelihood that this condition arose through extensive chromosomal fissions, integrating cytogenetic evidence with satDNA characterization could provide a powerful framework to investigate genome reorganization in this lineage. Repetitive DNA, particularly satDNA, is expected to contribute to chromosomal rearrangements, as they are enriched in these rearranged areas, also acting in the formation, stabilization, and differentiation of newly generated chromosomal elements [30,42,43,44]. In this study, we combine classical cytogenetic methods (karyotyping, C-banding, NOR detection, and FISH) with high-throughput repeat analyses to characterize the karyotype and satellitome of P. fuscicornis. By mapping repetitive elements and integrating their distribution with chromosomal features, we aim to elucidate the genomic composition and karyotype evolution of this species, shedding light on the organization and distribution of satDNAs in a species of beetle with unusually high chromosome number among Alticinae species.

2. Materials and Methods

2.1. Insect Sampling, Chromosome Preparations, and Cytogenetic Methods

Male specimens of P. fuscicornis (Linnaeus, 1767) were collected in Puente de la Sierra, Jaén (Spain). As P. fuscicornis is not an endangered species, no special permission was required. Adults were dissected to extract their testes and subjected to a hypotonic treatment in distilled water for approximately 30 min. Samples were then fixed in modified Carnoy’s solution (absolute ethanol: glacial acetic acid, 3:1) and stored at −20 °C until further use. Once the testicles were removed, the individuals were stored in 100% ethanol.

For slide preparation, testes were macerated in 50% glacial acetic acid and dropped onto preheated microscope slides placed on a hot plate at 42 °C. Chromosome number and morphology were assessed using two staining approaches: conventional Giemsa staining and DAPI (4′,6-diamidino-2-phenylindole) fluorescence staining. For Giemsa staining, slides were incubated in a 10% Giemsa solution diluted in phosphate buffer (pH 7) for 10 min, rinsed in distilled water, and air-dried. DAPI staining was performed by mounting slides directly with VECTASHIELD containing DAPI (Vector Labs, Burlingame, CA, USA). Preparations were examined under an Olympus BX51 microscope (Olympus, Hamburg, Germany), using fluorescence optics for DAPI-stained slides. Images were captured with an Olympus DP70 camera controlled by DP Manager v1.1.1.71 software and further processed in Adobe Photoshop^®^ CS4 (Adobe Systems, San Jose, CA, USA).

C-banding followed the method of Sumner [19] with minor modifications. Slides were first treated with 0.2 M hydrochloric acid for 15 min at room temperature, followed by incubation in 5% barium hydroxide [Ba(OH)2] at 60 °C for 1 min and 30 s. After a brief rinse in 0.2 M hydrochloric acid, slides were incubated in 2 × SSC at 60 °C for 2 min. Preparations were subsequently stained either with 10% Giemsa or with DAPI.

2.2. Genomic DNA Sequencing and Satellitome Analysis

Genomic DNA (gDNA) was extracted from one pull of three adult males, as males represent the heterogametic sex (XY sex system). Extraction was performed using the NucleoSpin Tissue Kit (Macherey-Nagel GmbH & Co., Düren, Germany) following the manufacturer’s instructions.

A total of 3 µg of gDNA were submitted to Novogene (Ltd., Cambridge, UK) for high-throughput sequencing using the Illumina^®^ HiSeq™ 2000 platform. Libraries of 350 bp insert size and paired-end reads of 150 bp were generated, providing a total of 1.2 Gb of sequencing data.

The FASTA files generated were uploaded to the Galaxy platform (https://galaxy-elixir.cerit-sc.cz/ (accessed on 20 November 2025)) and processed with the RepeatExplorer2/TAREAN pipeline. This tool implements a graph-based clustering approach for the identification and characterization of repetitive DNA [39,45]. Default settings were used, with the exception of the threshold defining “top clusters”, which was set to 0.001%. Automatic filtering of highly abundant satellite repeats was enabled, and a minimum of 64 GB RAM was allocated per analysis. To refine satDNA characterization, clusters identified by RepeatExplorer2/TAREAN v.0.3.8.1 as satDNA were complemented with a manual inspection of additional clusters exhibiting dense graph patterns, a feature typically associated with satellite repeats. Bioinformatic analyses were conducted in Geneious^®^ v11.1.5 [46] to determine monomer length and to generate consensus sequences for each family. After identifying the clusters that included satDNA sequences, homology among them was assessed using BLAST+ v.2.17.0 [47] to identify satDNA families split across multiple clusters. Additionally, BLASTn searches were performed against the NCBI database (https://blast.ncbi.nlm.nih.gov/Blast.cgi (accessed on 9 December 2025)) to assess similarity with previously described sequences. A targeted search for the P. fuscicornis satDNAs was additionally conducted in the available chromosome-assembled genomes of other Alticinae species in the NCBI database. For that, a CHRomosome In Silico MAPPing (CHRISMAPP) [48] analysis were performed in order to plot the satDNA consensus sequences in the chromosomes, using a percentage of homology of 60%.

Given that some satDNAs are known to originate from transposable elements (TEs), all satDNA consensus sequences were screened for homology against known TEs using CENSOR in Repbase [49]. Sequences showing >50% monomer coverage and >65% similarity to known TEs were classified as TE-related [50,51]. Only sequences showing homology with TEs from other insect genomes were considered.

The abundance and divergence of each satDNA family were estimated using RepeatMasker v4.1.4 [52] with the RMBlast search engine and default parameters, enabling the “−a” option to obtain alignment files for downstream analyses. For this purpose, two FASTA files were generated: one containing at least one million randomly selected reads, and another containing the consensus sequences of all satDNA families. Consensus sequences were included as dimers when the monomer length exceeded 100 bp, or as concatenated repeats totaling at least 200 bp when the monomer was shorter than 100 bp. Abundance values were normalized by the total number of base pairs used for mapping. Satellite DNA families were named following a system adapted from Ruiz-Ruano et al. [41], consisting of the first letter of the genus, the first three letters of the species, the suffix “Sat,” a numeric code indicating their relative abundance within the genome, and the monomer length. RepeatMasker output was used to estimate average divergence and to generate divergence profiles according to the Kimura two-parameter (K2P) model, using the Perl script calcDivergenceFromAlign.pl from the RepeatMasker suite. Graphical representations of abundance and divergence were generated in RStudio v4.1.0 [53] using the ggplot2 package v3.4.4 [54].

2.3. Chromosomal Mapping of Nucleolar Organizer Regions (NORs), Telomeric Repeats and satDNA Families

Most abundant satDNA families were physically mapped onto the chromosomes of P. fuscicornis by fluorescence in situ hybridization (FISH). Additional repetitive DNA sequences, including NORs, i.e., 18S rDNA (ribosomal DNA), and the ancestral insect telomeric repeat, were also localized. FISH was performed using sequence-specific probes following the protocol of Cabral-de-Mello and Marec [55], with minor modifications. Both single-probe and double-probe hybridizations were conducted, the latter combining probes labeled with different fluorochromes on the same preparation (biotin-16-dUTP and digoxigenin-11-dUTP).

The probe targeting the insect telomeric (TTAGG) motif [56] was generated using a non-template PCR-based method, following a protocol analogous to that of Ijdo et al. [57]. NORs were detected using a probe generated by PCR amplification of a ~700 bp fragment of the 18S rDNA gene using primers 18S-965 (GGCGATCAGATACCGCCCTAGTT) and 18S-1573R (TACAAAGGGCAGGGACGTAAT) [58], with Chrysolina americana (Coleoptera, Chrysomelidae) gDNA as template. PCR products were labeled with biotin-16-dUTP or digoxigenin-11-dUTP (Roche, Mannheim, Germany) by nick translation using the Polymerase I/DNase I mix (Invitrogen, San Diego, CA, USA), following the manufacturer’s instructions. Telomeric and ribosomal probes were diluted in hybridization buffer (50% deionized formamide, 10% dextran sulfate, and 2 × SSC) to a final concentration of 10 ng/μL.

Satellite DNA probes were generated by designing family-specific primers based on the consensus sequences of the most abundant satDNA families. Primers were designed using Primer3 (https://www.ncbi.nlm.nih.gov/tools/primer-blast/(accessed on 1 December 2025)) (Table 1). These oligonucleotides were directly labeled with either biotin-16-dUTP (Roche) or digoxigenin-11-dUTP (Roche) using terminal transferase (Roche) and following the instructions provided by the supplier. Oligonucleotide probes were diluted in hybridization buffer to a final concentration of 3 pmol/μL. Probes for PfusSat03-814, PfusSat04-2629, and PfusSat05-2677, due to its larger monomer size, were amplified from gDNA via PCR. PCR reactions were carried out in a total volume of 50 μL, containing 50 ng of genomic DNA, 25 pmol of each primer, and 5 U of Taq polymerase. Amplifications consisted of 30 cycles of 95 °C for 1 min, 50–60 °C for 1 min, and 72 °C for 1 min 30 s, followed by a final extension of 72 °C for 10 min. PCR products were labeled with biotin or digoxigenin by nick translation, as described for telomeric and ribosomal probes, and diluted in hybridization buffer to a final concentration of 15 ng/μL.

The slides were subjected to incubation on a heated surface at a temperature of 70 °C for a duration of 2 min and 30 s, transferred to a humid chamber, and subjected to overnight incubation (16–18 h) at 37 °C. Immunological detection was performed using either streptavidin conjugated with Alexa Fluor™ 488 (Thermo Fisher Scientific, Waltham, MA, USA) at a concentration of 10 μg/mL or anti-digoxigenin-rhodamine (Roche) at a concentration of 1 μg/mL, depending on whether the probes were labeled with biotin-16-dUTP or digoxigenin-11-dUTP, respectively.

The preparations were mounted with VECTASHIELD with DAPI (Vector Labs, Burlingame, CA, USA). The mounted preparations were observed under an Olympus BX51 fluorescence microscope equipped with an Olympus DP70 camera and appropriate filters. Image acquisition and processing were carried out using DP Manager software v1.1.1.71 and Adobe Photoshop CS4.

3. Results and Discussion

3.1. Cytogenetic Characterization of P. fuscicornis

Cytogenetic analysis of P. fuscicornis revealed a male karyotype of 2n = 40 (38 + XY) (Figure 1A) with a meioformula of n = 19 + Xy_p_, as the sex chromosomes form the classical parachute configuration during metaphase I (Figure 2A). This diploid number and the Xy_p_ sex chromosome system had previously been reported for P. fuscicornis as well as for other Podagrica species: P. fuscipes, P. malvae, and P. menetriesi [59,60]. The Xy_p_ sex chromosome system is the most frequent in the Alticinae lineages studied to date [14]. All autosomes are meta- or submetacentric. The X chromosome is metacentric, whereas the Y chromosome is the smallest element of the complement, dot-like and apparently acrocentric. Similarly, karyotypes reported for other Podagrica species comprise medium to small metacentric chromosomes and some submetacentric ones, together with a small punctiform Y chromosome [59,60]. These features closely match the chromosomal morphology observed here in P. fuscicornis.

The diploid number observed in P. fuscicornis is clearly higher than the modal value reported for most Alticinae species (2n = 22), indicating a dynamic chromosomal history within the group. Because increases in chromosome number relative to modal values are typically attributed to centric fissions, the 2n = 40 recorded for P. fuscicornis likely reflects extensive autosomal fragmentation during the evolution of this lineage. This interpretation is consistent with general trends described for flea beetles, where rises in autosome number result from fission events that are commonly followed by pericentric inversions or the acquisition of secondary arms, thereby masking the primary telocentric condition produced by fissions [15,61]. The absence of telocentric chromosomes in P. fuscicornis fits this pattern, suggesting that any fission-derived telocentric elements have been subsequently transformed into the meta- and submetacentric chromosomes observed in the present karyotype.

C-banding revealed constitutive heterochromatin blocks located in the pericentromeric regions of all autosomes (Figure 1B), a pattern comparable to that reported for other Alticinae species [18] and for Coleoptera in general [62]. The X chromosome also carries a pericentromeric block, whereas the Y chromosome is almost entirely heterochromatic. The presence of heterochromatin on both sex chromosomes, particularly the extensive heterochromatinization of the Y, mirrors the pattern described for other taxa of the subfamily, such as Omophoita [17,63,64]. The markedly heterochromatic nature of the Y chromosome in P. fuscicornis likely reflects degenerative processes and the accumulation of repetitive sequences typical of heterogametic sex chromosomes.

NORs were mapped using FISH and were clearly detected on a single autosomal pair (Figure 2B). Regarding the organization of NORs, available data in Chrysomelidae remain limited and are restricted to the subfamilies Alticinae, Cassidinae, and Chrysomelinae. Most species exhibit NORs on a single autosomal pair; however, cases with two autosomal pairs and, less frequently, NORs located on the X chromosome have also been reported [22,23,65,66]. In Alticinae, NOR localization has been studied primarily in species of the tribe Oedionychina using silver staining (Ag-NOR). For example, in Paranaita opima, this technique revealed their position on autosomal pair 6 [18]. More recent studies employing FISH have confirmed NOR localization on one autosomal pair in several genera of this subfamily, including Alagoasa and Omophoita [23,24,25]. Nonetheless, exceptions do occur within Alticinae. In O. magniguttis, NOR signals were detected on two autosomal pairs, indicating that structural rearrangements affecting NORs have taken place [23]. In P. fuscicornis, the presence of NORs on a single autosomal pair supports the notion of a relatively stable NOR configuration within this lineage.

Hybridization with the ancestral telomeric repeat (TTAGG)n on the chromosomes of P. fuscicornis produced clear signals at the telomeric regions (Figure 2C). This result confirms the presence of the (TTAGG)n sequence in this species and is consistent with the few previous studies performed in Alticinae [24,25]. The analysis of telomeric sequences in Chrysomelidae has been conducted in only a small number of species. Nevertheless, in recent years, multiple telomeric motifs and organizational patterns have been documented in insects [27,67,68]. In Coleoptera, the motif considered ancestral in insects, (TTAGG)n, has been replaced in several species by the alternative motifs (TCAGG)n and (TTAGGG)n across three superfamilies, including Chrysomeloidea [27,56]. Chrysomelidae species that have lost the ancestral motif altogether have also been described, such as the newly reported telomeric motif in Lachnaia genus (TTTGG)n [28].

3.2. Satellitome Characterization

Genomic analysis using RepeatExplorer2 provided a detailed characterization of the repetitive sequences in P. fuscicornis. The analysis used a total of 2,225,550 reads (≈333.8 Mb), of which 1,869,284 were grouped into 81,944 clusters. Among all clusters, 2583 (representing 71% of the genome) exceeded the 0.001% abundance threshold and were classified as major genomic components (Figure S1). This analysis revealed the presence of at least 70 distinct satDNA families. Their genomic abundances, estimated with RepeatMasker, indicated that satDNA accounts for 9.51% of the P. fuscicornis genome (Table S1). In terms of diversity, the presence of 70 satDNA families places P. fuscicornis at an intermediate level compared to other eukaryotes, ranging from a single family in Cydalima perspectalis (Lepidoptera) to more than 600 in Pontastacus leptodactylus (Decapoda) [69,70]. This value also falls within the wide range reported for Coleoptera, which spans from 11 satDNA families in Tenebrio molitor to 165 in C. americana [48,71]. Regarding genomic abundance, the observed 9.51% represents a moderate fraction. This falls well within the broad fluctuations seen in insects, ranging from 0.2% in Diatraea saccharalis [72] to over 50% in Triatoma delpontei [38] or T. molitor [73].

Comparative analyses within Chrysomelidae further highlight the remarkable heterogeneity of satDNA organization. For instance, C. americana (2n = 24) contains 165 families (≈17.9%) but only three form large pericentromeric blocks [48]. In contrast, Colaspis laeta (2n = 22) presents 33 families (≈4.27%) and lacks TE-related satDNAs. Conversely, species with derived karyotypes, such as Endocephalus bigatus (2n = 10) (39 families; ≈14.77%) and Iphimeis dives (2n = 14) (36 families; ≈4.19%), exhibit an expanded representation of TE-related satDNAs [51], whereas O. octoguttata (2n = 22) (49 families; ≈8–9%) displays sex-specific accumulation in several families with no information regarding TE-related origin of any of the satDNAs described [64]. In P. fuscicornis, among the 70 families of satDNA, we have found only eight families that are TE-related (PfusSat05-2677, PfusSat10-3477, PfusSat13-3203, PfusSat14-4711, PfusSat15-2952, PfusSat18-4695, PfusSat41-275, and PfusSat44-89). Those families showed homology with Penelope, Gypsy, or Chapaev elements (Figure S2). These comparisons underscore that satDNA composition and abundance can vary significantly, even among closely related chrysomelids.

The satellitome of P. fuscicornis is dominated by three major families, PfusSat01-138, PfusSat02-500, and PfusSat03-814, which collectively represent 5.66% of the genome. The remaining families collectively contribute an additional 3.85%, although many occur at extremely low abundances (<0.001%), such as PfusSat70-196 (0.0007%). Overall, the satellite DNA families exhibit a marked A + T enrichment, with a mean A + T content of 67.6%, consistent with patterns commonly reported in beetle genomes [74]. Monomer lengths span a broad range, from 5 bp in PfusSat19-5-Tel to 4711 bp in PfusSat14-4711. Despite this variability, the most common monomer sizes fall between 150 and 300 bp. Comparable patterns are also observed in the satellitomes described for other Chrysomelidae species. As in P. fuscicornis, most satellite DNA families in these taxa fall within the typical monomer size range; however, a few families exhibit substantially longer repeat units, as reported for C. americana, E. bigatus, and I. dives [48,51]. An exceptional case is O. octoguttata, which exhibits extraordinarily long repeat units in most of its satDNA families, including OocSat31 (>5 kb) [64], exceeding even the monomer length of PfusSat14-4711 described here for P. fuscicornis.

Sequence divergence analysis (K2P distance) revealed values ranging from 0.38% to 26.69%, with an average of 7.71%. The abundance versus divergence landscape showed two major peaks: one at 1–2% and another at 7–8% (Figure 3). Families undergoing recent expansion, such as PfusSat01-138 and PfusSat02-500, exhibit highly homogeneous monomers and concentrate their abundance in specific peaks (low divergence). In contrast, families like PfusSat03-814 and PfusSat04-2629 display broader profiles (Figure S3), reflecting the accumulation of mutations since their last amplification. These patterns align with the life-cycle model of satDNA, where young, expanding families are homogeneous, while older families become more divergent unless maintained by concerted evolution [75,76].

The “library hypothesis” proposes that closely related species inherit a shared repertoire of satDNA families from a common ancestor and that satDNA evolution proceeds through the differential amplification and contraction of these pre-existing sequences within each lineage. This process explains why related species may harbor similar satDNAs but with marked differences in genomic abundance, chromosomal distribution, and genomic organization [75,77,78]. This process may also be accompanied by the gain or loss of specific satDNA families. To investigate this process, we conducted a targeted search for P. fuscicornis satDNAs in chromosome-level genome assemblies of Alticinae available in GenBank. This analysis revealed that ten of these satDNA families are organized in tandem arrays in at least one of the thirteen genomes examined (Figure S4). These thirteen species, together with P. fuscicornis, represent well-differentiated lineages according to suprageneric classifications of Alticinae into groups of genera [2,79]. The distribution patterns of each satDNA family varied substantially. Some families were detected in only a single species, such as PfusSat40-120 and PfusSat44-89, which were found exclusively in the genome of Psylliodes chrysocephalus. In contrast, other families exhibited a broader distribution and were present in most of the species analyzed, such as PfusSat16-84 and PfusSat57-228. Notably, PfusSat57-228 was detected in all species examined, suggesting that it represents an ancestral satDNA family within Alticinae that has been retained across most, if not all, evolutionary lineages. In agreement with the “library hypothesis,” more closely related taxa tended to share a greater number of satDNA families. Although the number of available chromosome-level assemblies remains limited, our results are consistent with this expectation. For example, the three species of the genus Crepidodera shared the same five satDNAs with P. fuscicornis (PfusSat16-84, PfusSat23-157, PfusSat32-142, PfusSat46-86, and PfusSat57-228) (Figure S4). Similarly, the two species of the genus Longitarsus shared the same four satDNAs (PfusSat16-84, PfusSat37-11, PfusSat38-143, and PfusSat57-228), whereas the two species of the genus Phyllotreta shared with P. fuscicornis only the PfusSat57-228 family.

3.3. Chromosomal Localization of the Main Satellite DNA Families in P. fuscicornis

Fluorescence in situ hybridization (FISH) revealed that the most abundant families (PfusSat01-138, PfusSat02-500, PfusSat03-814) are predominantly located in pericentromeric regions (Figure 4 and Figure 5A,B). This distribution supports the canonical structural role of satDNA in centromere function and chromosome segregation [29]. PfusSat01-138 was found on all chromosomes, while PfusSat02-500 and PfusSat03-814 showed more restricted distributions. The distribution of satDNA on sex chromosomes provides insights into their differentiation in P. fuscicornis. PfusSat01-138 is present on both X and Y chromosomes, whereas PfusSat02-500 is exclusively autosomal, and PfusSat03-814 is restricted to the X chromosome (and autosomes) but absent from the Y. The accumulation of specific repeats on sex chromosomes is a hallmark of differentiation in insects [80,81,82]. The shared presence of PfusSat01-138 on both sex chromosomes may indicate a pseudoautosomal region or the retention of ancestral sequences, while the absence of PfusSat02-500 and PfusSat03-814 on the Y suggests divergence and sequence loss associated with Y-chromosome degeneration.

Comparative analyses in other Chrysomelidae suggest that the organization of multiple satDNA families in pericentromeric regions is a conserved feature. In C. americana, three main families have been described: one predominant family present in the pericentromeric regions of almost all autosomes and the X chromosome, a second family also located in pericentromeric regions of all autosomes and the X, and a third family restricted to some autosomal pairs [48]. In Leptinotarsa decemlineata, although the complete satellitome has not been analyzed, two satDNA families (LEDE-I and LEDE-II) isolated by restriction enzymes are also pericentromeric, with some chromosomes bearing only one family, both, or neither, suggesting the possible presence of additional, unidentified repeats [83]. Similarly, in O. octoguttata, at least two families have been identified in pericentromeric regions [64]. These observations indicate that the accumulation of multiple satDNA families in pericentromeric regions is a recurrent pattern in Chrysomelidae, supporting a structural role in chromosome organization and function.

The following most abundant families, PfusSat04-2629 and PfusSat05-2677, displayed a dispersed hybridization pattern across all chromosomes, suggesting localization within euchromatic regions (Figure 5C–F). While satDNA is traditionally associated with heterochromatin, recent studies have documented that less abundant satDNA families colonizing euchromatin [48,75,84,85], as probably happen with P. fuscicornis.

4. Conclusions

In conclusion, the genomic architecture of P. fuscicornis illustrates how extensive chromosomal fissions could act as a driver for chromosomal differentiation in Chrysomelidae. The high diploid number, far above the modal condition of Alticinae, implies repeated fragmentation events that could generate new centromeric and pericentromeric environments. The occurrence of a higher number of chromosomes, and consequently more centromeres, increases the number of independent genomic contexts in which satDNAs evolve, potentially reducing the efficiency of concerted evolution that could promote heterogeneous divergence among satDNA families. In P. fuscicornis, it could be reflected by the dominance of a few families and the heterogeneous divergence patterns across the satellitome, but comparative analysis with related species harboring lower diploid numbers is needed to clarify the influence of chromosome number on satDNA evolution in this group. The differential accumulation of satDNAs on autosomes and sex chromosomes further suggests that fissions not only reshape chromosomal structure but may also influence the tempo of repeat turnover and the trajectory of sex-chromosome differentiation. Thus, P. fuscicornis highlights the chromosomal fissions and the remodeling of the repetitive landscape, shaping the evolution in Chrysomelidae.