RPS6KA1 Remodels Fatty Acid Metabolism and Suppresses Malignant Progression in Colorectal Cancer
Qixin Liu, Ziheng Peng

TL;DR
This study identifies RPS6KA1 as a key gene that suppresses colorectal cancer by regulating fatty acid metabolism and improving immune response.
Contribution
The study reveals RPS6KA1 as a novel tumor-suppressive gene linked to fatty acid metabolism in colorectal cancer.
Findings
RPS6KA1 is significantly downregulated in colorectal cancer and associated with poor prognosis.
RPS6KA1 modulates fatty acid metabolism and inhibits cancer progression in cellular and animal models.
RPS6KA1 enhances antitumor immune functions of CD8+T and follicular helper T cells.
Abstract
Background: Colorectal cancer (CRC), with high incidence but low rates of early diagnosis, poses significant challenges to public health worldwide. Lipid metabolic reprogramming has been closely associated with CRC occurrence and development. This study aimed to identify key fatty acid metabolism-related molecules involved in the development of CRC and to explore potential prognostic biomarkers and therapeutic targets. Methods: Based on The Cancer Genome Atlas (TCGA) data from colon adenocarcinoma (COAD) patients, we applied weighted gene co-expression network analysis (WGCNA), Cox regression, and least absolute shrinkage and selection operator (LASSO) to identify fatty acid metabolism-related signature genes in CRC. Expression validation and prognostic analysis were conducted. Summary-data-based Mendelian randomization (SMR) was used to infer causal relationships between target genes…
Genes, proteins, chemicals, diseases, species, mutations and cell lines named across the full text — each resolved to its canonical identifier and authoritative record.
Click any figure to enlarge with its caption.
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9- —Fundamental Research Funds for the Central Universities of Central South University
Peer Reviews
No public reviews on file for this paper yet. If you reviewed it on a platform where reviews are public (OpenReview, ICLR, NeurIPS, ICML), you can paste yours below so the community can read it here.
Videos
No videos yet. Explain this paper in a talk, walkthrough, or lecture? Add one.
Taxonomy
TopicsCancer, Lipids, and Metabolism · Ferroptosis and cancer prognosis · Lipid metabolism and disorders
1. Introduction
Colorectal cancer (CRC) is a malignant tumor originating from the epithelial cells of the colon or the rectum mucosa [1]. It ranks as the third most prevalent cancer and the second leading cause of cancer-related deaths globally, with over 1.9 million new cases and approximately 900,000 fatalities annually [2]. CRC is also the leading cause of cancer incidence in men under 50 years of age, with its prevalence increasing by 1–4% each year [3]. Despite recent improvements in the diagnosis and treatment strategies for CRC, such as colonoscopy, surgical resection, chemotherapy, and targeted therapy, late-stage diagnosis and treatment resistance remain major challenges for patients and healthcare systems [4,5]. Therefore, a comprehensive understanding of CRC pathogenesis is essential for identifying at-risk populations and developing targeted treatments.
The pathogenesis of CRC involves multiple factors, including genetic susceptibility [6] and metabolic reprogramming [7]. Among these, reprogramming of lipid metabolism is recognized as a hallmark of cancer. Fatty acid (FA) metabolism, a key aspect of lipid metabolism, has been increasingly implicated in cancer initiation and progression [8,9]. Cancer cells exhibit heightened dependence on de novo lipogenesis (DNL) and the uptake of exogenous FAs to meet the energy demands of rapid proliferation and to support oncogenic signaling that promotes tumorigenesis and disease advancement [10,11]. It has been established that reprogramming of lipid metabolism enhances cell proliferation, migration, and invasion by regulating membrane synthesis, energy storage, and cellular homeostasis in CRC [12,13]. Exogenous fatty acids can significantly promote KRAS activation and IL-8 expression, thereby mediating metastasis in KRAS/p53-mutant colorectal cancer [14]. Solute carrier family 44 member 4 inhibits fatty acid oxidation and suppresses CRC progression by promoting the interaction of the E3 ligase MUL1 with carnitine palmitoyltransferase 2, leading to CPT2 degradation [15].
Despite the recognized importance of fatty acid metabolism in CRC, research on this topic remains limited. To address this gap, we conducted multi-dimensional bioinformatic analyses and in vitro/in vivo experiments to identify fatty acid metabolism-related molecules involved in CRC biology and to further investigate their underlying mechanisms. Our findings provide valuable insights for future identification of at-risk populations and the development of targeted therapies modulating fatty acid metabolism in CRC.
2. Methods
The overall workflow of this study is illustrated in Figure 1.
2.1. RNA-Seq Data Acquisition
Gene expression and clinical data of CRC patients were obtained from The Cancer Genome Atlas (TCGA) database, comprising 483 colorectal adenocarcinoma (COAD) patients, 41 normal samples, and 19,937 genes. Among these, 459 patients with clinical information were used for survival analysis.
2.2. Weighted Gene Co-Expression Network Analysis (WGCNA)
The “WGCNA” R package (version 1.72.5) was used to perform WGCNA on TCGA-COAD transcriptomic data. After excluding outliers and low-variance genes, an optimal soft threshold power (β) was selected to satisfy scale-free topology. The adjacency matrix was converted into a topological overlap matrix. Gene modules were identified through hierarchical clustering and dynamic tree cutting, with a minimum module size of 30.
2.3. Differential Expression Analysis of Signature Genes
The “limma” R package (version 3.58.1) was used to generate paired boxplots illustrating differential expression of signature genes in the TCGA-COAD dataset. Protein-level differences between colon cancer and normal tissues were further analyzed using the CPTAC online dataset and immunohistochemistry data from the Human Protein Atlas.
2.4. Survival Analysis
Kaplan–Meier survival curves and log-rank tests were used to compare survival between high- and low-expression groups of signature genes. Additionally, the “survivalROC” R package (version 1.0.3.1) was used to plot ROC curves, and the predictive performance of the model for 1-, 3-, and 5-year survival probabilities was evaluated using the area under the curve (AUC), 95% confidence interval (CI), and p-value.
2.5. Summary-Data-Based Mendelian Randomization (SMR) Analysis
SMR analysis was performed using SMR software (smr-1.3.1-win) developed by Yang’s lab [16]. Results were filtered using SMR (p < 0.05) and HEIDI (p > 0.05) criteria.
2.6. Single-Cell RNA Sequencing Data Analysis (scRNA-Seq)
The scRNA-seq dataset GSE231559 [17] was retrieved from the Gene Expression Omnibus (GEO) database. The R packages “Seurat” (version 5.1.0) and “patchwork” (version 1.2.0) were used to analyze data from 3 normal colon tissue samples and 5 colon cancer patients. Quality control included exclusion of genes detected in fewer than 3 cells, cells with fewer than 200 genes detected, and cells with mitochondrial gene expression exceeding 10%. Expression profiles were normalized, and doublets were detected and removed using the “DoubletFinder” R package (version 2.0.4). PCA was performed on the top 2000 highly variable genes, followed by dimensionality reduction and clustering via UMAP. Cell types were annotated using marker genes and visualized on UMAP plots. A heatmap of gene expression across cell types was generated using the “DoHeatmap” function.
2.7. Cell Culture
Human embryonic kidney cells (293T), normal colon epithelial cells (NCM460), and colon cancer cell lines (SW480, Lovo, SW620, Caco2, HCT116) were obtained from the Central Cell Bank of Central South University. Cells were cultured in DMEM supplemented with 10% bovine calf serum (BCS) and 1% penicillin/streptomycin at 37 °C in a 5% CO_2_ atmosphere.
2.8. Overexpression Plasmid Construction
Target sequences for RPS6KA1 were synthesized by Tsingke Biotechnology (Beijing, China) and cloned into the PLVX-puro vector.
2.9. Lentiviral Packaging and Stable Cell Line Establishment
RPS6KA1 overexpression plasmids were co-transfected with packaging plasmids (pRSV-Rev, Gag-pol, and pCMV-VSV-G; Addgene, Cambridge, MA, USA, #12253, #14887, #8454) into 293T cells. The viral supernatant was collected after 48 h and filtered through a 0.45 μm filter. Lovo and HCT116 cells were infected and selected using puromycin to establish stable cell lines.
2.10. Quantitative Real-Time PCR (qPCR)
Primers for RPS6KA1 (forward: ATGCAGACCCCAGCAGATTT, reverse: GTGCAGCTTCACCACGAATG) and the reference gene Actin (forward: CATGTACGTTGCTATCCAGGC, reverse: CTCCTTAATGTCACGCACGAT) were synthesized by Tsingke Biotechnology (Beijing, China). Total RNA was extracted and reverse-transcribed into cDNA. qPCR was performed using the SYBR Green qPCR SuperMix Kit (Bimake, B7500, Houston, TX, USA) with at least three technical replicates.
2.11. Subcutaneous Xenograft Tumor Model in Nude Mice
A total of 30 female 4-week-old BALB/c nude mice were purchased from Hua Fu Kang Biotechnology Co., Ltd. (Beijing, China). Experiments were repeated 3 times, with a total of 5 mice in each group. This sample size was chosen to ensure sufficient statistical power (β > 0.8, α = 0.05). After one week of acclimatization, Mice were randomly assigned to subcutaneous injection in the left thoracic wall with 1 × 10^6^ HCT116-RPS6KA1-OE (hereafter referred to as the OE group) or control HCT116-RPS6KA1-NC (hereafter referred to as the NC group) cells suspended in PBS mixed with Matrigel (10%). Tumor volume was measured weekly. After three weeks, mice were euthanized, and tumors were excised and weighed. All animal experiments were approved by the animal ethics committee of Xiangya Hospital (2023111856, approved on 16 November 2023).
2.12. Immunohistochemistry (IHC)
Tumor sections were deparaffinized in xylene, rehydrated, and subjected to antigen retrieval via heat-induced epitope retrieval. Endogenous peroxidase activity was blocked with 3% H_2_O_2_, and nonspecific sites were blocked with 5% goat serum. Sections were incubated overnight at 4 °C with rabbit anti-human RPS6KA1 (Epizyme, Shanghai, China, P013408; 1:1000) or Ki67 (Proteintech, Wuhan, China, 27309-1-AP, 1:200), followed by HRP-conjugated secondary antibody and DAB development. Nuclei were counterstained with hematoxylin. The experimental operator was unaware of the grouping before the staining was completed to control confounding factors.
2.13. Oil Red O Staining
Cells grown on coverslips were fixed with 4% formaldehyde and stained using the Oil Red O Stain Kit (Nanjing Jiancheng, Nanjing, China, D027-1-1) according to the manufacturer’s instructions. Nuclei were counterstained with hematoxylin, and images were acquired under a microscope.
2.14. BODIPY 493/503 Staining
Cells on coverslips were fixed with 4% formaldehyde and stained using the BODIPY 493/503 Staining Kit (Beyotime, Shanghai, China, C2053S). Nuclei were stained with Hoechst 33342, and images were captured using a fluorescence microscope.
2.15. ATP Content Assay
Cells cultured in 6-well plates were washed with PBS and lysed. ATP levels were measured using the Enhanced ATP Assay Kit (Beyotime, Shanghai, China, S0027) with a luminometer. A portion of the lysate was used for protein quantification via BCA assay.
2.16. Free Fatty Acid (FFA) Assay
Cells were collected, washed with PBS, and homogenized with steel beads at 4 °C. The homogenate was centrifuged at 12,000 rcf for 5 min at 4 °C, and the supernatant was used for FFA measurement with the Amplex Red Free Fatty Acid Assay Kit (Beyotime, Shanghai, China, S2015S).
2.17. Mitochondrial Membrane Potential Assay
Cells were collected, washed with PBS, and stained using the JC-1 Mitochondrial Membrane Potential Assay Kit (Beyotime, Shanghai, China, C2006). Fluorescence was measured with a microplate reader, and data were analyzed accordingly.
2.18. Statistical Analysis
Statistical analyses were performed using R version 4.3.3, relevant R packages, and GraphPad Prism 8.3.0. Student’s t-test was used to compare two groups, and one-way ANOVA was used for comparisons among three or more groups. A p-value < 0.05 was considered statistically significant, with ns indicating not significant; * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.
3. Results
3.1. Identification of Fatty Acid Metabolism-Related Signature Genes in COAD
In the WGCNA, a soft threshold power of 8 was selected, achieving a scale-free fit index R^2^ = 0.9 (Figure 2A–C). Five co-expression modules were identified, among which the blue module showed the strongest correlation with tumor (cor = −0.83, p = 4 × 10^−133^) and normal (cor = 0.83, p = 4 × 10^−133^) samples (Figure 2D,E). Intersection with fatty acid metabolism-related genes from GeneCards yielded 244 key genes (Figure 2F). GO and KEGG enrichment analyses revealed that these genes were primarily involved in fatty acid metabolic processes (Supplementary Figure S1A–D). Univariate Cox regression identified RPS6KA1 and CHGA as significantly associated with colon cancer prognosis (Figure 2G). Subsequent LASSO and multivariate Cox regression analyses confirmed that both RPS6KA1 (HR = 0.987, 95% CI: 0.977–0.998, p = 0.016) and CHGA (HR = 1.003, 95% CI: 1.001–1.004, p < 0.001) were independent prognostic factors (Figure 2H–K). RPS6KA1 inhibited fatty acid oxidation in adipocytes [18,19], whereas CHGA produced the opposite effect [20]. However, Kaplan–Meier analysis in the TCGA-COAD dataset showed no significant association between CHGA expression and overall survival (p = 0.2061) (Supplementary Figure S2). Therefore, RPS6KA1 was selected for further investigation.
3.2. Expression of RPS6KA1 in COAD
Analysis via Timer2.0 revealed pan-cancer expression of RPS6KA1, with notably lower expression in COAD (Figure 3A). Both CPTAC and paired TCGA-COAD analyses confirmed decreased RPS6KA1 RNA expression in tumor tissues compared to normal colon tissues (Figure 3B,C). Similarly, protein-level analyses using CPTAC and HPA databases indicated reduced RPS6KA1 expression in COAD (Figure 3D). These findings were validated in vitro: qPCR and Western blot analyses demonstrated lower RPS6KA1 expression at both the RNA and protein levels in multiple colon cancer cell lines (HCT116, SW480, Lovo) compared to the normal colon epithelial cell line NCM460 (Figure 3F,G). To explore the mechanism underlying reduced RPS6KA1 expression, we assessed methylation levels and found no significant difference between tumor and normal tissues (p = 0.179) (Figure 3H). However, phosphorylation levels at S230, S372, and S3889 were significantly altered in tumor tissues (p = 1 × 10^−7^, p = 0.0213, and p = 9 × 10^−15^, respectively, Figure 3I–K).
3.3. Prognostic Value of RPS6KA1 and Clinical Prediction Model
Survival status distribution and Kaplan–Meier analysis based on TCGA-COAD data indicated that high RPS6KA1 expression was associated with better overall survival (p = 0.0069) (Figure 4A,B). ROC analysis demonstrated good predictive performance of RPS6KA1 for patient survival (AUC = 0.626, Figure 4C), with AUC values of 0.617, 0.634, and 0.657 for 1-, 3-, and 5-year survival, respectively (Figure 4D). RPS6KA1 exhibited superior prognostic performance compared to clinicopathological features such as age, gender, T stage, N stage, M stage, and tumor subdivision, particularly for predicting 3- and 5-year survival (Figure 4E–G). RPS6KA1 expression was correlated with the T stage and M stage (Figure 4H). Multivariate Cox regression confirmed that low RPS6KA1 expression was an independent risk factor for poor prognosis (HR = 1.87, 95% CI: 1.01–3.46, p = 0.045), along with age (HR = 1.04, 95% CI: 1.01–1.07, p = 0.003) and M stage (HR = 4.09, 95% CI: 1.99–8.40, p < 0.001) (Figure 4I).
3.4. Genetic and Causal Analyses Supporting RPS6KA1′S Role in CRC
Chromosomal localization placed RPS6KA1 on chromosome 1 (Figure 5A). Although correlated, it is not clear whether there is a causative association between RPS6KA1 and CRC. SMR and colocalization analyses were used to investigate the causal relationship between RPS6KA1 cis-eQTL and CRC. The SMR plot revealed a significant negative correlation between RPS6KA1 cis-eQTL and CRC GWAS signals (Figure 5B). Locus-specific SMR and colocalization results further supported RPS6KA1 as a potential causal factor suppressing CRC development (Figure 5C,D).
3.5. Single-Cell Expression and Distribution of RPS6KA1 in CRC
After quality control, batch effect correction, doublet removal, cell cycle regression, and PCA, 35 distinct clusters were identified (Figure 6A,B). The distribution of clusters across samples is shown in Figure 6F. Using canonical markers (EPCAM, CD68, CD79A, etc.), seven major cell types were annotated: T cells, B cells, endothelial cells, myeloid cells, plasma cells, fibroblasts, and epithelial cells (Figure 6C,D). RPS6KA1 was predominantly expressed in T cells, B cells, and epithelial cells (Figure 6E). Compared to tumor tissues, normal colon samples (GSM7290762, GSM7290768, GSM7290771) had lower proportions of T cells and higher proportions of endothelial cells (Figure 6F). These findings suggest that RPS6KA1 may participate in immune regulation during CRC pathogenesis.
3.6. Association Between RPS6KA1 and Immune Infiltration in CRC
CIBERSORT analysis revealed differences in tumor immune cell (TIC) composition between high- and low-RPS6KA1-expression groups (Figure 7A). Correlation analysis showed a positive association between CD8^+^ T cells and follicular helper T cells (r = 0.38), and a negative correlation between CD8^+^ T cells and resting CD4^+^ memory T cells (r = –0.48) (Figure 7B). Among 22 immune cell types, CD8^+^ T cells, follicular helper T cells, Tregs, activated NK cells, monocytes, and eosinophils differed significantly between high- and low-RPS6KA1 groups (Figure 7C). RPS6KA1 expression positively correlated with CD8^+^ T cells and follicular helper T cells and negatively with eosinophils and neutrophils (Figure 7D).
3.7. In Vitro and In Vivo Functional Validation of RPS6KA1 in CRC
Stable RPS6KA1-overexpressing cell lines were established and validated by Western blot and qPCR (Figure 8A,B). CCK-8 assays showed that RPS6KA1 overexpression significantly inhibited cell proliferation (Figure 8C). Colony formation assays confirmed reduced clonogenic ability (Figure 8D). Wound healing assays demonstrated impaired migration (Figure 8F,G), and Transwell assays showed decreased migration and invasion (Figure 8H,I). In vivo, xenograft tumors derived from RPS6KA1-overexpressing cells exhibited reduced volume and weight (Figure 8K,L). IHC staining revealed lower Ki-67 expression in RPS6KA1-overexpressing tumors (Figure 8M). Collectively, these results indicate that RPS6KA1 suppresses proliferation and invasion in CRC.
3.8. RPS6KA1 Inhibits Fatty Acid Oxidation in CRC
Oil Red O staining indicated that RPS6KA1 overexpression suppressed lipolysis and increased neutral lipid storage in Lovo and HCT116 cells (Figure 9A). BODIPY 493/503 staining yielded consistent results (Figure 9B,C). Intracellular free fatty acid levels, the substrate for fatty acid oxidation [21], were elevated in RPS6KA1-overexpressing cells (Figure 9D). Additionally, assays measuring ATP content, a key product of fatty acid oxidation [22], showed reduced ATP production (Figure 9E). JC-1 staining indicated decreased mitochondrial membrane potential (Figure 9F). These findings suggest that RPS6KA1 inhibits fatty acid oxidation in colon cancer.
4. Discussion
As the most common subtype of CRC, COAD is often challenging to detect early due to tumor heterogeneity. In recent years, the age at first diagnosis of COAD has gradually decreased, underscoring the need to identify reliable biomarkers for early detection of at-risk populations, timely diagnosis, and accurate prognosis prediction. The development of predictive biomarkers is a prerequisite for implementing personalized treatment in cancer patients.
Dysregulated lipid metabolism is one of the most prominent metabolic alterations in cancer. Tumor progression is frequently accompanied by disruptions in lipid metabolism, including changes in lipid uptake, synthesis, and hydrolysis [23]. Although aberrant lipid metabolism is a hallmark of CRC, its underlying regulatory mechanisms remain incompletely understood. In this study, we identified RPS6KA1, a lipid metabolism-related gene that is downregulated in colon cancer and associated with poor prognosis. Through SMR, single-cell analysis, and immune infiltration assessment, RPS6KA1 was identified as a potential immune-related tumor suppressor in colon cancer. Functional experiments in vitro and in vivo confirmed that RPS6KA1 increases fatty acid concentration and suppresses malignant behaviors of CRC.
RPS6KA1, also known as RSK1, belongs to the p90 ribosomal S6 kinase (RSK) family, whose members are serine/threonine kinases acting as downstream effectors of the MAPK pathway [24]. It is involved in various biological processes including development, inflammation, and cancer [24]. Previous reports have implicated RPS6KA1 in multiple cancers, though findings remain inconsistent. For instance, it drives a TRIM28/E2F1 feedback loop promoting prostate cancer progression [25] and mediates hyperinflammation via PI3K/AKT/mTOR and NFκB signaling in myeloid malignancies [26]. Conversely, RPS6KA1 may act as a tumor suppressor in certain contexts: it phosphorylates LKB1/STK11 in Peutz-Jeghers syndrome [27] and suppresses metastasis in lung cancer [28]. However, conflicting studies in the same A549 lung cancer cell line suggest that it may promote metastasis [29], and its role varies across melanoma subtypes [30]. In CRC, existing evidence is limited and contradictory: Guoguo Jin et al. reported RPS6KA1 as an oncogene, where its inhibition upregulated Bax, cleaved caspase-3, and PARP to suppress tumor growth [31], whereas Kenneth K. Wu et al. proposed it as a potential anti-tumor target by inhibiting COX-2 transcription [32]. Leveraging multi-dimensional bioinformatics and integrated validation, our study supports a tumor-suppressive role for RPS6KA1 in CRC. We speculate that tumor heterogeneity may account for these discrepant findings.
Mendelian randomization offers a robust approach to inferring causality by using genetic variants as instrumental variables, mitigating confounding and reverse causality in observational studies [33]. SMR integrates GWAS summary statistics with eQTL data to elucidate mechanisms through which genetic variation influences complex traits and identify therapeutic targets [16]. Applying SMR, we provided genetic evidence supporting a causal protective role of RPS6KA1 in CRC.
Single-cell sequencing and immune infiltration analysis revealed that RPS6KA1 was positively correlated with CD8^+^ T cells and T follicular helper (TFH) cells. Enrichment of TFH signatures is associated with prolonged survival in lung adenocarcinoma [34]. TFH cells enhance antitumor immunity by supporting B cells and synergizing with CD8^+^ T cell effector functions [34], suggesting that TFH and CD8^+^ T cells may mediate the tumor-suppressive effects of RPS6KA1.
Interestingly, these effects of RPS6KA1 are mediated not through direct participation in fatty acid metabolism but via the regulation of key biological processes such as autophagy-related molecules and mitotic clonal expansion [18,19]. Although RPS6KA1 phosphorylation is dispensable for terminal adipocyte differentiation, it contributes to embryonic stem cell commitment toward adipocyte progenitors and modulates de novo lipogenesis [35,36]. Reprogrammed lipid metabolism not only promotes tumor progression but also shapes immune cell functionality, particularly that of CD8^+^ T cells [9,37]. Targeting fatty acid metabolism has been demonstrated to enhance CD8^+^ T cell memory [38]. Obesity has been shown to reprogram the tumor microenvironment and suppress antitumor immunity [39]. We speculate that RPS6KA1 may enhance antitumor immunity by promoting lipogenesis to support CD8^+^ T cell function.
Despite these insights, our study has limitations. First, the regulatory relationship between RPS6KA1, fatty acid biosynthesis, and CD8^+^ T cells in CRC requires further experimental validation. Second, potential selection bias in database sources, such as ethnicity, geography, molecular differences, and tumor heterogeneity, may introduce systematic deviations. Third, prospective studies and external validation datasets are needed to enhance the reliability of our findings. We aim to address these limitations in future research.
5. Conclusions
This comprehensive study demonstrates the prognostic value of RPS6KA1 in CRC. We found that RPS6KA1 is downregulated in CRC and negatively correlated with poor prognosis and serves as an independent protective factor. Genetic evidence and functional experiments support its tumor-suppressive role. Moreover, RPS6KA1 is closely associated with lipid metabolism and the immune microenvironment in CRC. Collectively, our findings suggest that RPS6KA1 may suppress malignant progression and remodel the immune microenvironment through lipid metabolic reprogramming, offering new insights for the diagnosis and treatment of CRC.
The reference list from the paper itself. Each links out to its DOI / PubMed record.
- 1Dekker E. Tanis P.J. Vleugels J.L.A. Kasi P.M. Wallace M.B. Colorectal cancer Lancet 20193941467148010.1016/S 0140-6736(19)32319-031631858 · doi ↗ · pubmed ↗
- 2Bray F. Laversanne M. Sung H. Ferlay J. Siegel R.L. Soerjomataram I. Jemal A. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries CA Cancer J. Clin.20247422926310.3322/caac.2183438572751 · doi ↗ · pubmed ↗
- 3Siegel R.L. Torre L.A. Soerjomataram I. Hayes R.B. Bray F. Weber T.K. Jemal A. Global patterns and trends in colorectal cancer incidence in young adults Gut 2019682179218510.1136/gutjnl-2019-31951131488504 · doi ↗ · pubmed ↗
- 4Li C. Wang Z. Ding P. Zhou Z. Chen R. Hu Y. Zhao K. Peng W. Yang X. Sun N. A Digital Score Based on Circulating-Tumor-Cells-Derived m RNA Quantification and Machine Learning for Early Colorectal Cancer Detection ACS Nano 202519181171812810.1021/acsnano.4c 1505640335073 · doi ↗ · pubmed ↗
- 5Karthika C. Sureshkumar R. Zehravi M. Akter R. Ali F. Ramproshad S. Mondal B. Kundu M.K. Dey A. Rahman M.H. Multidrug Resistance in Cancer Cells: Focus on a Possible Strategy Plan to Address Colon Carcinoma Cells Life 20221281110.3390/life 1206081135743842 PMC 9224881 · doi ↗ · pubmed ↗
- 6Yang L. Yang H. Chu Y. Song Y. Ding L. Zhu B. Zhai W. Wang X. Kuang Y. Ren F. CREPT is required for murine stem cell maintenance during intestinal regeneration Nat. Commun.20211227010.1038/s 41467-020-20636-933431892 PMC 7801528 · doi ↗ · pubmed ↗
- 7Solanki S. Sanchez K. Ponnusamy V. Kota V. Bell H.N. Cho C.-S. Kowalsky A.H. Green M. Lee J.H. Shah Y.M. Dysregulated Amino Acid Sensing Drives Colorectal Cancer Growth and Metabolic Reprogramming Leading to Chemoresistance Gastroenterology 2022164376391.e 1310.1053/j.gastro.2022.11.01436410445 PMC 10448739 · doi ↗ · pubmed ↗
- 8Carracedo A. Cantley L.C. Pandolfi P.P. Cancer metabolism: Fatty acid oxidation in the limelight Nat. Rev. Cancer 20131322723210.1038/nrc 348323446547 PMC 3766957 · doi ↗ · pubmed ↗
