Assessment of the Incidence of Vibrio spp. in Shrimp Farms Relative to Water Parameters and Their Molecular Detection in the Southwest Coastal Region of Bangladesh

TL;DR

This study examines the presence of Vibrio bacteria in shrimp farms in Bangladesh and their relation to water conditions, finding high levels in shrimp during the rainy season.

Contribution

The study provides new insights into the seasonal and environmental factors influencing Vibrio spp. in shrimp farms using molecular detection methods.

Findings

Shrimp had the highest Vibrio spp. count during the rainy season.

48.02% of isolates were Vibrio cholerae and 51.97% were Vibrio parahaemolyticus.

Ammonium was the only water parameter significantly related to Vibrio spp. in the winter season.

Abstract

In aquatic ecosystems, the incidence of Vibrio spp. is rising continually due to changes in water parameters. The study was undertaken to assess the incidence of Vibrio spp. in shrimp farms relative to water parameters and to perform their molecular detection. Maintaining three replications of each sample, overall, 360 shrimp, 360 water, and 360 sediments were randomly collected from the experimental units of 30 ponds in Khulna and Satkhira districts in each of the rainy and winter seasons. Temperature, ammonium, nitrite, pH, iron, and salinity were measured from water samples. The groEL gene of Vibrio cholerae, and toxR, trh, and tdh genes of Vibrio parahaemolyticus were identified through real‐time polymerase chain reaction assay. Shrimp showed the highest mean total Vibrio spp. count (9.39 ± 0.34 log CFU/mL) in the rainy season. In the rainy season, shrimp represented 42.5%, water 17.5%, and sediment 19.16% Vibrio spp., whereas in the winter season, these were 38.33%, 14.16%, and 15.83%, respectively. Temperature and pH were at the highest average levels in the rainy and winter seasons, respectively. There was no significant relation between the incidence of Vibrio spp. and water parameters, except ammonium in the winter season. Here, 48.02% (85/177) isolates were positive for V. cholerae, 51.97% (92/177) for V. parahaemolyticus, 15.21% (14/92) for the trh gene, and 6.52% (6/92) for the tdh gene. None of the relations between water parameters and trh‐positive V. parahaemolyticus was significant, except pH in the rainy season. The occurrence of Vibrio spp. in shrimp farms should be a burning issue for sustainable production.

There was no significant relation between the incidence of Vibrio spp. and water parameters, except ammonium in the winter season. In this study, 48.02% (85/177) isolates were positive for Vibrio cholerae, 51.97% (92/177) for Vibrio parahaemolyticus, 15.21% (14/92) for trh gene, and 6.52% (6/92) for tdh gene.

Figures

Sampling areas, developed by ArcMap 10.5 (ArcGIS Enterprise, ESRI, Redlands, CA, USA).

Scatter plot representing the linear relationships of total number of Vibrio spp. with water parameters temperature (A), pH (B), ammonium (C), nitrite (D), iron (E), and salinity (F) in the rainy season.

Scatter plot representing the linear relationships of the total number of Vibrio spp. with water parameters, temperature (A), pH (B), ammonium (C), nitrite (D), iron (E), and salinity (F) in the winter season.

Tables

Table 1. Primers used for the characterization of Vibrio spp.

Sl. No.	Isolate	Target genes	Primer sequence (5′ → 3′)	Reference
1.	Vibrio parahaemolyticus	toxR	F: GAACCAGAAGCGCCAGTAGT R: GCATGGTGCTTAACGTAGCG	Kim et al. (1999) and D. Wang et al. (2013)
2.	V. parahaemolyticus	tdh	F: GTARAGGTCTCTGACTTTTGGAC R: CTACAGAATYATAGGAATGTTGAAG	Bej et al. (1999) and Ward and Bej (2006)
3.	V. parahaemolyticus	trh	F: CCATCMATACCTTTTCCTTCTCC R: ACYGTCATATAGGCGCTTAAC	Bej et al. (1999) and Ward and Bej (2006)
4.	Vibrio cholerae	groEL	F: GATCTTGACTGGCGGTGTTGTG R: GTCACCCACCAGAGAAGAGAGT	M. T. Hossain et al. (2013)

Table 2. Total load of Vibrio spp. (log CFU/mL) with respect to shrimp, water, and sediment samples.

Isolate	Season	Shrimp (n = 360) (Mean ± SD)	Water (n = 360) (Mean ± SD)	Sediment (n = 360) (Mean ± SD)
Vibrio spp.	Rainy	9.39 ± 0.34	9.32 ± 0.36	9.35 ± 0.42
	Winter	9.36 ± 0.66	9.28 ± 0.34	9.34 ± 0.43

Table 3. Percentages of samples (shrimp, water, and sediment) positive for Vibrio spp.

Isolate	Season	Shrimp (n = 360) N (%) (CI)	Water (n = 360) N (%) (CI)	Sediment (n = 360) N (%) (CI)	p value	Total (n = 1080) N (%) (CI)
Vibrio spp.	Rainy	153 (42.5) (37.3–47.8)	63 (17.5) (13.7–21.8)	69 (19.16) (15.2–23.6)	0.000a	285 (26.38) (23.8–29.1)
	Winter	138 (38.33) (33.3–43.6)	51 (14.16) (10.7–18.2)	57 (15.83) (12.2–20.0)	0.000a	246 (22.77) (20.3–25.4)

Table 4. Percentages of samples (shrimp, water, and sediment) from different sampling sites positive for Vibrio spp.

Isolate	Season	Satkhira Sadar (n = 432) N (%) (CI)	Dumuria (n = 324) N (%) (CI)	Debhata (n = 180) N (%) (CI)	Kaliganj (n = 144) N (%) (CI)	p value	Total (n = 1080) N (%) (CI)
Vibrio spp.	Rainy	126 (29.16) (24.9–33.7)	87 (26.85) (22.1–32.0)	39 (21.66) (15.9–28.4)	33 (22.91) (16.3–30.7)	0.194	285 (26.38) (23.8–29.1)
	Winter	111 (25.69) (21.6–30.1)	78 (24.07) (19.5–29.1)	33 (18.33) (13.0–24.8)	24 (16.66) (11.6–24.6)	0.170	246 (22.77) (20.3–25.4)

Table 5. Pearson correlation analysis between the incidence of Vibrio spp. (n = 285 in the rainy season and n = 246 in the winter season) and water parameters.

Water parameters	Season	Correlation coefficient	p value
Temperature	Rainy	−0.040	0.659
	Winter	−0.006	0.939
pH	Rainy	−0.066	0.467
	Winter	−0.077	0.402
Ammonium	Rainy	0.013	0.884
	Winter	0.295	0.001a
Nitrite	Rainy	0.0006	0.994
	Winter	−0.010	0.905
Iron	Rainy	0.005	0.952
	Winter	−0.018	0.845
Salinity	Rainy	−0.0002	0.997
	Winter	−0.079	0.388

Table 6. Logistic regression analysis between trh‐positive Vibrio parahaemolyticus (n = 9 in the rainy season and n = 5 in the winter season) and water parameters.

Independent variable (water parameters)	Season	Dependent variable (trh‐positive V. parahaemolyticus)
		Odds ratio (95% confidence interval)	p value
Temperature	Rainy	0.776 (0.565, 1.068)	0.119
	Winter	0.991 (0.767, 1.281)	0.946
pH	Rainy	2.305 (1.004, 5.292)	0.049a
	Winter	0.595 (0.208, 1.697)	0.331
Ammonium	Rainy	1.167 (0.203, 6.699)	0.862
	Winter	0.316 (0.003, 32.792)	0.627
Nitrite	Rainy	0.579 (0.049, 6.839)	0.664
	Winter	0.119 (0.000, 214.862)	0.578
Iron	Rainy	1.060 (0.318, 3.531)	0.925
	Winter	1.338 (0.325, 5.514)	0.687
Salinity	Rainy	1.068 (0.586, 1.946)	0.831
	Winter	1.736 (0.756, 3.985)	0.193

Full text

Introduction

1

Shrimp is regarded as one of the favorite food items in the world, and Bangladesh is no exception. From very early times, various kinds of shrimps and prawns have certainly been a source of protein for human intake (Patel et al. 2018). By participating in the global economy, shrimp farming has become one of the major aquaculture industries (Naylor et al. 2021; Yu et al. 2023). According to Bangladesh Economic Review (2023a, 2023b), shrimp farming contributes around 2.84 lakh metric tonnes (mt) of shrimp production and fishing contributes to around 2.41% of the agricultural gross domestic product in Bangladesh. However, with the improvement of extremely dense shrimp aquaculture systems, shrimp production is undergoing a potential threat from microbes, such as bacteria, especially from the Vibrio spp. around the world (El‐Saadony et al. 2022; Villarreal and Juarez 2022). The presence of bacteria in shrimp can occur because of inappropriate and unhealthy conditions at the time of cultivation, processing, preservation, and storage (Bedane et al. 2022).

Vibrio spp. are very common aquatic bacteria, and they can act as opportunistic human and fish pathogens (Grimes 2020; Costa et al. 2022). Vibrio spp. are Gram‐negative, halophilic, facultative anaerobic, non‐spore‐forming, curved, or straight rod‐shaped bacteria that are motile with a single flagellum (Baker‐Austin et al. 2020; Abioye et al. 2021; Sampaio et al. 2022). Vibrio cholerae and Vibrio parahaemolyticus are the most commonly reported zoonotic pathogens among pathogenic Vibrio species, where they are responsible for causing septicemia, acute gastroenteritis, and cholera (M. T. Rahman, Sobur, et al. 2020; Dutta et al. 2021; W. Wang et al. 2021).

Different environmental parameters such as water temperature, salinity, pH, turbidity, organic matter (dissolved organic carbon and dissolved organic nitrogen), inorganic nutrients (ammonium [NH_4_ ^+^], nitrite + nitrate [NO_2_ ^−^ + NO_3_ ^−^], and phosphate [PO_4_ ^3−^]), plankton densities, dissolved oxygen, and total dissolved solids are known to influence the incidence and abundance of Vibrio spp. in aquatic ecosystems (Brumfield et al. 2023; Wong et al. 2024). Though, Vibrio spp. are eurythermic, they like warm water (> 18°C) and warmer periods and seasons. In temperate and cold climatic areas, the density of Vibrio spp. is higher in summer than in winter (Möller et al. 2021). Iron is an essential and lifesaving element for the distribution of Vibrio spp. (Payne et al. 2016).

Though, in Bangladesh, numerous studies have been carried out regarding shrimp and shrimp products, most of them were focused on the identification of the genus Vibrio quantification of their numbers, and performing their antibiogram study (Chakma et al. 2018; Talukder et al. 2019; Al‐Amin et al. 2020; M. S. Rahman, Eshik, et al. 2020). However, a few studies on the detection of Vibrio spp. from shrimp and shrimp environments, and the assessment of different water parameters influencing their distribution in shrimp farms have been performed in Bangladesh (Jahan et al. 2017; Alam and Rahman 2018; Sarker et al. 2019; Siddique et al. 2021) and other countries (Bauer et al. 2021; Fleischmann et al. 2022; Brumfield et al. 2023; Sacheli et al. 2023; Dayang Najwa et al. 2024). In addition, in our previous study (Sohidullah et al. 2025), we have detected antibiotic resistance genes in V. parahaemolyticus and performed spectrophotometry for the assessment of heavy metals in shrimp muscles. To the best of our knowledge, none of the previous studies in Bangladesh has been performed targeting the assessment of the incidence of Vibrio spp. in shrimp farms in relation to water parameters in each of the rainy and winter seasons, along with their molecular detection in the Southwest Coastal Region of Bangladesh.

Concerning the previous facts, the present study was conducted both in the rainy and winter seasons at four different areas of Khulna and Satkhira districts in Bangladesh: (1) To assess the incidence of Vibrio spp. in shrimp farms in relation to different water parameters, such as temperature, ammonium, nitrite, pH, iron, and salinity. (2) To detect Vibrio spp. from shrimp and shrimp environments using real‐time polymerase chain reaction (PCR) assay.

This study will certainly help shrimp farmers to be informed about the incidence of Vibrio spp. in relation to water parameters, and eventually inspired to execute a constructive management plan to hinder the incidence of Vibrio spp. in shrimp and shrimp environments.

Materials and Methods

2

Experimental Location

2.1

For sampling, shrimp culture ponds (n = 30), which are locally known as gher, were selected from four different areas, namely, Dumuria (n = 9), Debhata (n = 5), Kaliganj (n = 4), and Satkhira Sadar (n = 12) at Khulna and Satkhira districts (Figure 1). These areas were selected because of their reputation for having lots of shrimp farms and a great desire for shrimp and shrimp farming (Karim et al. 2019). Here, the average pond area was approximately 1012 m^2^ in Dumuria, 1619 m^2^ in Debhata, 1690 m^2^ in Kaliganj, and 1740 m^2^ in Satkhira Sadar. In addition, the average distance between the ponds was 200 m in each area, 45 km between the ponds of Dumuria and Satkhira Sadar, 35 km between the ponds of Kaliganj and Satkhira Sadar, and 22 km between the ponds of Satkhira Sadar and Debhata. For this study, a stocking density of 12 shrimp per square meter in each of the 30 ponds was maintained.

Sampling areas, developed by ArcMap 10.5 (ArcGIS Enterprise, ESRI, Redlands, CA, USA).

Sampling

2.2

Maintaining 7 days interval in each sampling, four samplings were carried out from each of the 30 ponds both in the rainy and winter seasons in 2024. In Bangladesh, during June to October, the average temperature remains 25°C–35°C, which is more or less similar to the optimum temperature (28°C–32°C) for shrimp cultivation. As a consequence, the majority of the shrimp farmers remain busy with shrimp cultivation at this time, and the time from August to December is considered the peak harvesting time of shrimp in Bangladesh. In addition, farmers who stock their ponds early usually begin harvesting in August, which corresponds to the late rainy season, but those who stock later because of constraints such as pond preparation, postlarvae availability, and fluctuating prices typically harvest in December, representing the early winter season. Hence, sample collection was done from July 30 to August 30 in the rainy season and from November 30 to December 30 in the winter season. Three types of samples, such as shrimp, water, and sediment, were collected from the experimental unit of each of the 30 ponds. A total of 360 shrimp, 360 water, and 360 sediment samples were randomly collected in each of the rainy and winter seasons from the experimental units of 30 shrimp culture ponds, where three replications of each sample were maintained. Maintaining three replications of each sample, a total of 3 shrimp, 3 water, and 3 sediment samples were randomly collected from the experimental unit of each pond in each sampling. Per sampling per week, a total of 90 shrimp, 90 water, and 90 sediment samples were randomly collected from 30 shrimp culture ponds, where three replications of each sample were maintained. In this way, a total of 324 samples (108 shrimp, 108 water, and 108 sediment) from Dumuria, 180 samples (60 shrimp, 60 water, and 60 sediment) from Debhata, 144 samples (48 shrimp, 48 water, and 48 sediment) from Kaliganj, and 432 samples (144 shrimp, 144 water, and 144 sediment) from Satkhira Sadar were collected. In our country, sometimes fish farmers mix both healthy and unhealthy shrimps for selling purposes. Due to this reason, both healthy and unhealthy shrimps were randomly collected in this study. A cast net was used to collect shrimp samples, like our previous study (Sohidullah et al. 2025). To avoid cross contamination of shrimp samples, separate sterile plastic zipper bags like our previous study (Sohidullah et al. 2025) were used for each sample. Water and sediment samples were collected from three different locations of each pond at each sampling time to cover the maximum areas of the pond according to the American Public Health Association (APHA) (Federation and American Public Health Association 2005). In the case of a water sample, at first, sterile hand gloves were worn. Then, each water sample (50 mL) was collected from a depth of 0.5 m below the surface using a 50‐mL sterile falcon tube (Huang et al. 2021). For the sediment sample, a sterile, thin‐walled plastic pipe was marked at 5 cm and forced into the sediment at the middle of each pond to the 5‐cm mark and removed. Each 1‐g sediment sample was taken into a 15‐mL sterile falcon tube (Huang et al. 2021). Every time, labeling was done on all the sample collection equipment like our previous study (Sohidullah et al. 2025). After collection, samples were taken as soon as possible in an ice box where the internal temperature was 2°C–4°C, and brought to the Microbiology and Public Health Laboratory at Khulna Agricultural University, Khulna, right away for further processing and analysis. All the samples collected from 30 shrimp culture ponds were analyzed for microbiological investigations at each sampling interval in each of the rainy and winter seasons. Every time after sampling, the pond was indicated as positive for bacterial contamination if one of three samples tested positive for Vibrio spp.

Sample Processing

2.3

Shrimp samples were first washed with sterile 3% NaCl solution to remove surface microorganisms, debris, sand, and slime according to Siddique et al. (2021). Sterile scissors and forceps were used for dissecting shrimp samples (Sohidullah et al. 2025). Gill, muscle, hepatopancreas, and intestine were separated from the shrimp samples. Then, 5 g of each separated part was blended using mortar and pestle, and 45 mL of 0.1% peptone water was added to prepare the stock solution (M. J. Hossain et al. 2025). All the collected sediments were separated from the water samples through centrifugation at 3000 rpm for 1 min. Then, 25 mL of each water sample was kept in a test tube as a stock solution. In addition, the stock solution of 1 g of each sediment sample was prepared by adding 9 mL of 0.1% peptone water.

Isolation of Vibrio spp.

2.4

Cultural Characterization

2.4.1

The stock solution of each shrimp, water, and sediment sample was diluted by 10‐fold serial dilution using 0.1% peptone water up to 10^−9^ folds according to the APHA (Federation and American Public Health Association 2005). After that, thiosulfate‐citrate‐bile salts‐sucrose (TCBS) agar plate (HiMedia, India) was used to calculate colony‐forming unit (CFU) per mL of microbial suspension, where 0.1 mL of each serially diluted sample from 10^−4^–10^−7^ dilutions was spread by a sterile glass rod (Wong et al. 2024; M. J. Hossain et al. 2025). After overnight incubation, a TCBS plate containing 30–300 colonies was selected for the calculation of CFU (M. J. Hossain et al. 2025). For purification, a single colony of each sample was picked by a sterile inoculating loop, and streaking was done on a fresh TCBS agar plate, and the plates were incubated overnight at 37°C, as previously outlined (Sohidullah et al. 2025). Then, for further purification and obtaining well‐isolated, uniform colonies, 4–6 presumptive yellow and green colored colonies of 2–3 mm in diameter from each sample were subcultured onto a freshly prepared TCBS agar plate (Muthukrishnan et al. 2019; Siddique et al. 2021).

Morphological and Biochemical Characterization

2.4.2

The isolates of Vibrio spp. were morphologically and biochemically characterized by Gram staining, sugar fermentation test, indole test, methyl red test, catalase test, oxidase test, urease test, and nitrate reduction test (Bergey et al. 1974; Huang et al. 2022).

Analysis of Water Parameters

2.5

In each of the rainy and winter seasons, every water sample collected from 30 shrimp culture ponds was analyzed at each sampling interval. In this case, temperature was measured in situ at the sampling location, but the other water parameters, such as ammonium, nitrite, pH, iron, and salinity, were measured later in the laboratory.

Temperature

2.5.1

A mercury‐filled Celsius thermometer ranging 0°C–50°C was dipped into the water for 1 min, and the stable temperature final reading was recorded in a paper (Venkateswarlu et al. 2019).

Ammonium and Nitrite Test

2.5.2

The test was done according to the manufacturer's (AQUA‐VBC Test Kit) protocol. In the water sample, five drops of Solution A, one spoon of Powder B, and five drops of Solution C were added consecutively. It was then compared with the standard color chart to reach the level of ammonium ion (in ppm NH_4_ ^+^) and nitrite (NO_2_) (Sitthi et al. 2024).

pH Test

2.5.3

The test was done according to the manufacturer's (AQUA‐VBC Test Kit) protocol. Four drops of Solution A were mixed with the water sample, and the test vial was set on the color chart for matching with the pH value (Chaitanawisuti and Kritsanapuntu 1997).

Iron Test

2.5.4

The test was accomplished according to the manufacturer's (Hanna Test Kit) protocol. Mixing of one packet of reagent HI 3834‐0 with the water sample was done, and the solution was shifted into the color comparator cube for color matching (Jiménez‐Bambague et al. 2023).

Salinity Test

2.5.5

Salinity test was done by a refractometer (ATAGO, Japan). A few drops of water were placed onto the prism, and the eyepiece observation was done with the refractometer directed towards a light source (Sitthi et al. 2024).

Molecular Detection of Vibrio spp.

2.6

Presumably identified Vibrio spp. were detected at the species level by real‐time PCR assay. Here, two different Vibrio spp., namely, V. cholerae and V. parahaemolyticus, were targeted, since these are known as the most potential and emerging food‐borne pathogens responsible for having a negative impact on humans, marine animals, and aquaculture (Chen et al. 2022; Jantapaso et al. 2024; Liu et al. 2025). In addition, isolates of Vibrio spp. were selected for the PCR assay based on their DNA concentration (≥ 20 ng/µL) and purity level (1.7–1.9). For V. cholerae, the species‐specific groEL gene, which has been recommended as a competent marker for the detection of many bacteria, including Vibrio spp., was targeted (M. T. Hossain et al. 2012, 2013; Ren and Hill 2023) (Table 1). V. parahaemolyticus was detected by targeting the toxR gene, which is a reliable species‐specific molecular target (Kim et al. 1999; Croci et al. 2007) (Table 1). Virulence genes of V. parahaemolyticus, such as tdh and trh, responsible for causing hemolysis and cytotoxic activity in the host cell were also targeted (Meparambu Prabhakaran et al. 2020; Pazhani et al. 2021; El‐Zamkan et al. 2023; Stratev et al. 2023; Vandeputte et al. 2024) (Table 1).

DNA Extraction

2.6.1

Extraction of genomic DNA from the isolates of Vibrio spp. was done by TIANamp Bacteria DNA Kit (Tiangen Biotech, China) following the manufacturer's protocol and stored at −20°C until use. To measure the concentration and purity level of DNA, a spectrophotometer (NanoDrop1000, Thermo Scientific, USA) was used. Absorbance readings were performed at a wavelength of 260 nm for the concentration and 260 nm and 280 nm for the purity of DNA (Olson and Morrow 2012).

Real‐Time PCR Assay

2.6.2

A 25‐µL PCR mixture containing 2X TB Green master mix (Takara Bio, Japan), 20 ng of genomic DNA, 10 pmol of each of the designated forward and reverse primers (Macrogen Inc., South Korea), and 5.5 µL of nuclease‐free water was employed for amplification. CFX96 Touch Real‐Time PCR Detection System (Bio‐Rad, Hercules, CA, USA) was used for amplification of the target sequence of DNA. For the groEL gene of V. cholerae, the PCR cycling conditions included a primary denaturation at 95°C for 10 min, followed by secondary denaturation at 95°C for 15 s, annealing and extension at 69°C for 1 min (Costa et al. 2022). For the species‐specific toxR gene, and for tdh and trh virulence genes of V. parahaemolyticus, the PCR cycling conditions included primary denaturation at 94°C for 5 min, followed by secondary denaturation at 94°C for 30 s, annealing and extension at 60°C for 1 min (D. Wang et al. 2013; Federici et al. 2018). The real‐time PCR assays of these genes of V. cholerae and V. parahaemolyticus were run separately, and increases in fluorescence after 40 cycles were regarded as negative. As a no‐template control, a DNA‐free PCR mixture was utilized.

Statistical Analysis

2.7

The binomial 95% confidence interval (CI) calculation was carried out by the statistical package for social sciences (IBM SPSS 26.0, Chicago, IL, USA) to become 95% confident that the incidence of Vibrio spp. in each of the rainy and winter seasons would lie within the lower and upper limits of the interval. To interpret the seasonal and locationwise variations in the existence of Vibrio spp. among various types of collected samples, Chi‐square (χ ^2^) test was performed by SPSS. Pearson correlation analysis was carried out, and a heat map was created by RStudio‐2023.03.0‐386 (Inc., Boston, MA, USA) and R version 4.2.2 (R Core Team 2023) to find out whether there are any significant influences of water quality parameters on the number of total Vibrio spp. both in the rainy and winter seasons. On the other hand, binary logistic regression analysis was performed by SPSS to observe the relationship between trh‐positive V. parahaemolyticus and different water parameters. The statistically significant p value was fixed at < 0.05.

Results

3

Total Load of Vibrio spp. in Shrimp, Water, and Sediment Samples

3.1

Table 2 shows the total load of Vibrio spp. (log CFU/mL) in the shrimp, water, and sediment samples. Among the collected samples, shrimps had the highest mean total Vibrio spp. count (9.39 ± 0.34 log CFU/mL) in the rainy season, whereas water samples collected in the winter season showed the lowest mean total Vibrio spp. count (9.28 ± 0.34 log CFU/mL). In the winter season, shrimps exhibited the second‐highest mean total Vibrio spp. count (9.36 ± 0.66 log CFU/mL) that was slightly lower than the count in shrimps in the rainy season. In the rainy season, water samples demonstrated a mean total Vibrio spp. count of 9.32 ± 0.36 log CFU/mL, which was slightly higher than the count in water samples in the winter season. The sediment samples collected in the rainy season showed the third‐highest mean total Vibrio spp. count (9.35 ± 0.42 log CFU/mL) that was slightly higher than the count of 9.34 ± 0.43 log CFU/mL in sediment samples in the winter season.

Percentages of Samples Positive for Vibrio spp.

3.2

Vibrio spp. were presumably identified based on their cultural, morphological, and biochemical characteristics both in the rainy and winter seasons.

In total, 285 (26.38%; 95% CI, 23.8%–29.1%) isolates of Vibrio spp. were identified from 1080 samples in the rainy season, and the associations of samples with the isolation of Vibrio spp. were highly significant (Table 3). The highest prevalence was observed in shrimp (42.5%; 95% CI, 37.3%–47.8%), followed by sediment (19.16%; 95% CI, 15.2%–23.6%) and water (17.5%; 95% CI, 13.7%–21.8%) (Table 3). In contrast, in the winter season, a total of 246 (22.77%; 95% CI, 20.3%–25.4%) isolates of Vibrio spp. were identified from 1080 samples, where the associations of the samples with the isolation of Vibrio spp. were also highly significant (Table 3). In this season, the highest prevalence was recorded in shrimp (38.33%; 95% CI, 33.3%–43.6%), followed by sediment (15.83%; 95% CI, 12.2%–20.0%) and water (14.16%; 95% CI, 10.7%–18.2%) (Table 3).

Percentages of Samples from Different Sampling Sites Positive for Vibrio spp.

3.3

In the rainy season, samples from Satkhira Sadar reported 29.16% (126/432; 95% CI, 24.9%–33.7%) isolates as Vibrio spp., whereas from the samples of Dumuria, Debhata, and Kaliganj, Vibrio spp. were recorded as 26.85% (87/324; 95% CI, 22.1%–32.0%), 21.66% (39/180; 95% CI, 15.9%–28.4%), and 22.91% (33/144; 95% CI, 16.3%–30.7%), respectively (Table 4). On the other hand, in the winter season, samples of Satkhira Sadar, Dumuria, Debhata, and Kaliganj reported 25.69% (111/432; 95% CI, 21.6%–30.1%), 24.07% (78/324; 95% CI, 19.5%–29.1%), 18.33% (33/180; 95% CI, 13.0%–24.8%), and 16.66% (24/144; 95% CI, 11.6%–24.6%) isolates as Vibrio spp., respectively (Table 4). In both seasons, samples from different sampling sites were not significantly associated with the isolation of Vibrio spp. (Table 4).

In addition, all the 30 ponds were marked as contaminated with bacteria in the rainy season, whereas in the winter season, 90% (27/30, 95% CI, 73.5%–97.9%) ponds were positive for bacteria.

Levels of Different Water Parameters

3.4

In the rainy season, the average levels of temperature, pH, ammonium, nitrite, iron, and salinity of water were recorded as 28.98°C ± 2.52°C, 7.56 ± 1.01, 0.17 ± 0.39 mg/L, 0.15 ± 0.32 mg/L, 2.08 ± 0.66 mg/L, and 7.49 ± 1.39 ppt, respectively (Table S1), whereas in the winter season, these were observed as 22.6°C ± 3.61°C, 7.60 ± 1.009, 0.13 ± 0.32 mg/L, 0.20 ± 0.40 mg/L, 2.08 ± 0.64 mg/L, and 7.58 ± 1.25 ppt, respectively (Table S1).

Correlation Between the Incidence of Vibrio spp. and Water Parameters

3.5

Pearson correlation analysis between the incidence of Vibrio spp. and different water parameters demonstrated that none of the linear relationships was significant at a 0.05 probability level, both in the rainy and winter seasons, except the relation between ammonium and the incidence of Vibrio spp. in the winter season (Table 5). In the rainy season, the incidence of Vibrio spp. showed extremely weak positive linear relationships with ammonium, nitrite, and iron but extremely weak negative linear relationships with temperature, pH, and salinity (Table 5). In contrast, the incidence of Vibrio spp. revealed a weak positive linear relationship with ammonium but extremely weak negative linear relationships with temperature, pH, nitrite, iron, and salinity in the winter season (Table 5). Two scatter plots for the rainy season (Figure 2) and the winter season (Figure 3) were developed to represent the linear relationships of the total number of Vibrio spp. with different water parameters.

Scatter plot representing the linear relationships of total number of Vibrio spp. with water parameters temperature (A), pH (B), ammonium (C), nitrite (D), iron (E), and salinity (F) in the rainy season.

Scatter plot representing the linear relationships of the total number of Vibrio spp. with water parameters, temperature (A), pH (B), ammonium (C), nitrite (D), iron (E), and salinity (F) in the winter season.

Molecular Detection of V. cholerae and V. parahaemolyticus

3.6

From presumably identified isolates of Vibrio spp. (n = 531) in the rainy season (n = 285) and winter season (n = 246), 177 isolates (92 isolates from shrimp, 39 isolates from water, and 46 isolates from sediment) were selected for molecular detection at the species level.

In this study, 48.02% (85/177) isolates were positive for V. cholerae and 51.97% (92/177) isolates for V. parahaemolyticus. Among 92 isolates of V. parahaemolyticus, 14 (15.21%) isolates (9 from the rainy season and 5 from the winter season) showed positive results for the trh gene, and 6 (6.52%) isolates (5 from the rainy season and 1 from the winter season) were positive for the tdh gene.

Logistic Regression Analysis Between the Incidence of trh‐Positive V. parahaemolyticus and Water Parameters

3.7

A significant positive relation between pH and the incidence of trh‐positive V. parahaemolyticus was observed in the rainy season (Table 6). While the incidence of trh‐positive V. parahaemolyticus showed a positive relation with iron, ammonium, and salinity, it had a negative relation with temperature and nitrite in the rainy season (Table 6). In contrast, the incidence of trh‐positive V. parahaemolyticus exhibited a positive relation with iron and salinity but a negative relation with temperature, pH, ammonium, and nitrite in the winter season (Table 6).

Discussion

4

This study aimed to assess the incidence of Vibrio spp. in shrimp farms in relation to water parameters in each of the rainy and winter seasons and identify Vibrio spp., namely, V. cholerae and V. parahaemolyticus, in the southwest coastal region of Bangladesh.

Among shrimp, water, and sediment samples collected from all the sampling sites, shrimp demonstrated the highest mean total Vibrio spp. count (9.39 ± 0.34 log CFU/mL) in the rainy season, whereas the lowest mean total Vibrio spp. count (9.28 ± 0.34 log CFU/mL) was recorded from water samples in the winter season (Table 2). Previously, Letchumanan et al. (2015) reported the highest mean total Vibrio spp. count (6.34 log CFU/mL) in the red prawn sample from wetmarket A in Malaysia. M. J. Hossain et al. (2025) reported the highest count of V. cholerae (5.93 ± 0.15 log CFU/mL) from poa fish in Khulna, Bangladesh.

In this study, out of 1080 samples, 26.38% samples in the rainy season were identified as Vibrio spp. based on their cultural, morphological, and biochemical characteristics (Table 3), whereas in the winter season, 22.77% samples were positive for Vibrio spp. (Table 3). In a previous study conducted in Peninsular Malaysia, 225 samples were recorded as positive for Vibrio spp. from 210 shrimp samples based on their cultural and biochemical characteristics (Haifa‐Haryani et al. 2022). Another study on shrimp and shrimp environments recorded 34% (51/150) samples as positive for Vibrio spp. in the southwestern regions of Bangladesh (Haque et al. 2023). In addition, in our previous study on shrimp and shrimp environments, 30% (39/130) samples were recorded as positive for V. parahaemolyticus (Sohidullah et al. 2025).

Temperature and salinity play a vital role in affecting the distribution of Vibrio spp. worldwide (Venkateswarlu et al. 2019). Vibriosis in shrimp generally rises at the time of summer and fall when surface water is relatively warm (Venkateswarlu et al. 2019; Sampaio et al. 2022). The higher prevalence of Vibrio spp. in the rainy season and the lower prevalence in the winter season support the findings of these previous studies (Table 3). A study carried out in Brazil revealed that the incidence of Vibrio spp. in oysters was higher in warm water (Yeung and Thorsen 2016). Brumfield et al. (2023) reported a higher incidence of Vibrio spp. in warm water of the Chesapeake Bay, MD, USA.

Vibrio spp. generally prefer alkaline conditions (pH 6.5–9.0) and the highest MPN values of Vibrio spp. were recorded in samples with high pH (~ 8.2) (Percival and Williams 2014; Siddique et al. 2021; Sampaio et al. 2022). In the present study, we also recorded the average level of pH of pond water as alkaline as 7.56 ± 1.01 in the rainy season and 7.60 ± 1.009 in the winter season (Table S1).

Nearly all Vibrio spp. are halophilic in nature, requiring salt (NaCl) in a concentration that differs (1%–12%) from species to species, except V. cholerae, Vibrio fluvialis, Vibrio furnissii, and Vibrio mimicus (Böer et al. 2013). They usually inhabit brackish and seawaters, where the salinity of brackish water ranges from 0.5 to 30 ppt, and seawater average salinity is 35 ppt (Castillo et al. 2018). We recorded the average level of salinity of pond water as 7.49 ± 1.39 ppt in the rainy season and 7.58 ± 1.25 ppt in the winter season (Table S1). Another study carried out in the southwest coastal areas of Bangladesh recorded salinity as 0.4–16.2 ppt (Siddique et al. 2021). However, it becomes evident that the salinities surpassing 2 ppt were aimed at most of the successful shrimp production (Praveen Joshi and Ramachadra Naik 2023).

Feces of shrimp and dead organisms can supply ammonia (NH_3_) and nitrite (NO_2_) to the pond water, which becomes ill‐suited for shrimp production (Iber et al. 2021). In this study, the average levels of ammonium of pond water were 0.17 ± 0.39 mg/L in the rainy season and 0.13 ± 0.32 mg/L in the winter season (Table S1), while the average levels of nitrite were recorded as 0.15 ± 0.32 mg/L in the rainy season and 0.20 ± 0.40 mg/L in the winter season (Table S1). These levels of ammonium and nitrite are not toxic to shrimp and are suitable for Vibrio spp., according to another study, where the levels of toxicity of nitrite in aquaculture wastewater were recorded at 0.2, 2, and 4 mg/L concentration (Iber et al. 2021). In a previous study, it was exhibited that the fluctuation of ammonia and nitrates can influence the distribution of Vibrio spp. in a shrimp rearing pond (Ulfiani et al. 2022).

A previous study demonstrated the importance of iron in the population growth of Vibrio alginolyticus (Norfolk et al. 2023). Joseph and Bhat (2000) reported that the effect of ferric oxide (Fe_2_O_3_) on survival was significant for V. cholerae O1 only. We recorded average levels of iron as 2.08 ± 0.66 mg/L in the rainy season and 2.08 ± 0.64 mg/L in the winter season (Table S1). Tan et al. (2022) reported the level of iron in shrimp rearing pond water as 74.19 ± 14.78 μmol/g in the low salinity pond and 45.04 ± 8.91 μmol/g in the high salinity pond.

None of the linear relationships between water quality parameters and the incidence of Vibrio spp. was significant at a 0.05 probability level, both in the rainy and winter seasons, except the relation of ammonium with the incidence of Vibrio spp. in the winter season (Table 5 and Figures 2 and 3). These findings are somewhat analogous to the findings of another study conducted in shrimp pond culture systems in Sri Lanka, where none of the correlations of total Vibrio counts (TVCs) with water quality parameters was significant at a 0.05 probability level (Heenatigala and Fernando 2016). In the present study, the incidence of Vibrio spp. showed extremely weak positive linear relationships with ammonium, nitrite, and iron in the rainy season, whereas it had a weak positive linear relationship with ammonium in the winter season (Table 5 and Figures 2 and 3). Heenatigala and Fernando (2016) reported ammonia and salinity as having positive influences on TVC. Ulfiani et al. (2022) showed that decreased levels of nitrates in the shrimp culture pond water resulted in an increased number of Vibrio spp. Siddique et al. (2021) showed a significant positive relation of temperature and salinity with the incidence of V. parahaemolyticus but a significant negative association between salinity and the pathogenic V. parahaemolyticus. In this study, temperature, pH, and salinity had extremely weak negative linear relationships with the incidence of Vibrio spp., both in the rainy and winter seasons (Table 5 and Figures 2 and 3). Dayang Najwa et al. (2024) documented a stronger correlation of pH (6.14–7.64) with the growth of Vibrio spp. in a previous study. Böer et al. (2013) reported that there is no significant correlation between Vibrio spp. and salinity, and of all the Vibrio spp., only a few can live in low salinity, such as V. cholerae, V. fluvialis, V. furnissii, and V. mimicus.

Among 177 isolates of Vibrio spp., 48.02% (85/177) isolates showed a positive result for V. cholerae. These findings were relatively analogous to the findings of a previous study, where 24.7% (37/150) samples exhibited a positive result to V. cholerae (Haque et al. 2023). In the case of V. parahaemolyticus, we recorded 51.97% (92/177) isolates as positive and the observation was closely related to another study where 71.42% (5/7) isolates of V. parahaemolyticus from shrimp and prawn samples were recorded as positive (Patel et al. 2018). Among 92 isolates of V. parahaemolyticus, 15.21% isolates showed a positive result for the trh gene, and 6.52% isolates were positive for the tdh gene. A study carried out on marine shrimp samples in South Gujarat of Navsari District recorded 14.28% (1/7; 5 from shrimp and 2 from human samples) isolates as positive for the tdh gene, and none of the V. parahaemolyticus isolates was positive for the trh gene (Patel et al.2018). The findings of the present study were also comparable with the findings of another study where 5.26% (17/323) isolates were positive for the trh gene (Siddique et al. 2021). In a previous study conducted in South China on shrimp (Penaeus vannamei) breeding system, none of the isolates (n = 16) of V. parahaemolyticus was recorded as positive for tdh and trh genes (Yu et al. 2023). The differences between these findings and other findings might be because of changes in the geological distributions, environments, sample types and sizes, research techniques, and seasons.

A significant negative relation was observed between salinity and trh‐positive V. parahaemolyticus in a previous study (Siddique et al. 2021). In this study, though iron and salinity showed a positive relation, temperature and nitrite revealed a negative relation with the incidence of trh‐positive V. parahaemolyticus (Table 6).

Conclusions

5

The findings of this study highlight the assessment of the incidence of Vibrio spp. in shrimp farms in relation to water parameters in two different seasons and their molecular detection from shrimp and shrimp environments. Among the collected samples, shrimps had the highest mean total Vibrio spp. count in the rainy season, whereas water samples exhibited the lowest mean total Vibrio spp. count in the winter season. The isolation of Vibrio spp. was higher in the rainy season comparing to the winter season, and none of the water parameters showed significant relationships with the incidence of Vibrio spp. in both seasons, except ammonium in the winter season. In addition, most of the isolates of Vibrio spp. were positive for V. parahaemolyticus, and none of the water parameters demonstrated significant relationships with the incidence of trh‐positive V. parahaemolyticus, except pH in the rainy season. These findings provide a guideline necessary for future studies, both in the shrimp farming areas in Bangladesh and globally, to assess changes in the populations of Vibrio spp. relative to the changes in water parameters over time. Moreover, the findings of this study highly recommend a periodic surveillance program to be conducted for the confirmation and differentiation of the pathogenic strains of Vibrio spp., which would eventually allow for a constructive management plan to be executed to restrain the risk of the dissemination of vibriosis in shrimp farms.

Author Contributions

M. Sohidullah: conceptualization, investigation, methodology, writing – original draft, funding acquisition. Bidyut Matubber: conceptualization, methodology, writing – original draft. Md. Hamidur Rahman: data curation, formal analysis, writing – review and editing. Abu Sayeed: visualization, investigation. Sadia Rahman: visualization, investigation. Linta Yesmin: visualization, investigation. Md. Jannat Hossain: data curation, formal analysis, writing – review and editing. Md. Imran Hossain: methodology, data curation, formal analysis.

Ethics Statement

The present study followed World Organization for Animal Health (OIE) and institutional welfare standards for humane animal treatment and agreed to relevant legislation from “Ethical Standard of Research Committee, BAURES (BAURES/ESRC/78/FISH/2025/25.02.2025).”

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

Supplementary Table S1: Analysis of water parameters (Mean ± SD) at each sampling interval collected from selected shrimp ponds (n = 30).