# Inhibition of NPC1L1 disrupts adaptive responses of drug‐tolerant persister cells to chemotherapy

**Authors:** Zhe Zhang, Siyuan Qin, Yan Chen, Li Zhou, Mei Yang, Yongquan Tang, Jing Zuo, Jian Zhang, Atsushi Mizokami, Edouard C Nice, Hai‐Ning Chen, Canhua Huang, Xiawei Wei

PMC · DOI: 10.15252/emmm.202114903 · EMBO Molecular Medicine · 2022-01-13

## TL;DR

This study shows that blocking NPC1L1 weakens cancer cells' survival during chemotherapy by disrupting their redox balance.

## Contribution

The study reveals NPC1L1's role in drug-tolerant cancer cells and proposes a triple-combination therapy to prevent tumor recurrence.

## Key findings

- NPC1L1 promotes vitamin E uptake to reduce chemotherapy-induced oxidative stress in drug-tolerant persister cells.
- Inhibiting NPC1L1 with ezetimibe enhances chemotherapy by inducing methuosis and disrupting redox homeostasis.
- A triple-combination therapy including ezetimibe significantly reduced tumor recurrence in mice.

## Abstract

Entering a drug‐tolerant persister (DTP) state of cancer cells is a transient self‐adaptive mechanism by which a residual cell subpopulation accelerates tumor progression. Here, we identified the acquisition of a DTP phenotype in multidrug‐resistant (MDR) cancer cells as a tolerance response to routine combination treatment. Characterization of MDR cancer cells with a DTP state by RNA‐seq revealed that these cells partially prevented chemotherapy‐triggered oxidative stress by promoting NPC1L1‐regulated uptake of vitamin E. Treatment with the NPC1L1 inhibitor ezetimibe further enhanced the therapeutic effect of combinatorial therapy by inducing methuosis. Mechanistically, we demonstrated that NRF2 was involved in transcriptional regulation of NPC1L1 by binding to the −205 to −215 bp site on its promoter. Decreased DNA methylation was also related partially to this process. Furthermore, we confirmed that a triple‐combination of chemotherapeutic agents, verapamil, and ezetimibe, had a significant anti‐tumor effect and prevented tumor recurrence in mice. Together, our study provides a novel insight into the role of DTP state and emphasizes the importance of disrupting redox homeostasis during cancer therapy.

Drug‐tolerant persister (DTP) state is a driver of therapy failure and cancer relapse. This study identified a key role for NPC1L1 in multidrug‐resistant (MDR) cancer cells with the DTP state, where NPC1L1 orchestrated a redox signaling against the harsh environment caused by cancer therapy.

## Linked entities

- **Genes:** NPC1L1 (NPC1 like intracellular cholesterol transporter 1) [NCBI Gene 29881], GABPA (GA binding protein transcription factor subunit alpha) [NCBI Gene 2551]
- **Chemicals:** ezetimibe (PubChem CID 150311), verapamil (PubChem CID 2520)

## Full-text entities

- **Genes:** MIR3713 (microRNA 3713) [NCBI Gene 100500855], Foxn1 (forkhead box N1) [NCBI Gene 15218] {aka D11Bhm185e, Fkh19, HFH-11, Hfh11, Whn, nu}, MYC (MYC proto-oncogene, bHLH transcription factor) [NCBI Gene 4609] {aka MRTL, MYCC, bHLHe39, c-Myc}, BRAF (B-Raf proto-oncogene, serine/threonine kinase) [NCBI Gene 673] {aka B-RAF1, B-raf, BRAF-1, BRAF1, NS7, RAFB1}, MAP2K7 (mitogen-activated protein kinase kinase 7) [NCBI Gene 5609] {aka JNKK2, MAPKK7, MEK, MEK 7, MKK7, PRKMK7}, MAP1LC3B (microtubule associated protein 1 light chain 3 beta) [NCBI Gene 81631] {aka ATG8F, LC3B, MAP1A/1BLC3, MAP1LC3B-a}, DNER (delta/notch like EGF repeat containing) [NCBI Gene 92737] {aka UNQ26, bet}, CDH1 (cadherin 1) [NCBI Gene 999] {aka Arc-1, BCDS1, CD324, CDHE, ECAD, LCAM}, ATG5 (autophagy related 5) [NCBI Gene 9474] {aka APG5, APG5-LIKE, APG5L, ASP, SCAR25, hAPG5}, SOX2 (SRY-box transcription factor 2) [NCBI Gene 6657] {aka ANOP3, MCOPS3}, KLF4 (KLF transcription factor 4) [NCBI Gene 9314] {aka EZF, GKLF}, Casp3 (caspase 3) [NCBI Gene 12367] {aka A830040C14Rik, AC-3, CASP-3, CC3, CPP-32, CPP32}, VIM (vimentin) [NCBI Gene 7431], ABCB11 (ATP binding cassette subfamily B member 11) [NCBI Gene 8647] {aka ABC16, BRIC2, BSEP, PFIC-2, PFIC2, PGY4}, ABCB1 (ATP binding cassette subfamily B member 1) [NCBI Gene 5243] {aka ABC20, CD243, CLCS, ENPAT, GP170, MDR1}, TRPA1 (transient receptor potential cation channel subfamily A member 1) [NCBI Gene 8989] {aka ANKTM1, FEPS, FEPS1, p120}, POTEF (POTE ankyrin domain family member F) [NCBI Gene 728378] {aka A26C1B, POTE2alpha, POTEACTIN}, ERBB2 (erb-b2 receptor tyrosine kinase 2) [NCBI Gene 2064] {aka CD340, HER-2, HER-2/neu, HER2, MLN 19, MLN-19}, NFE2L2 (NFE2 like bZIP transcription factor 2) [NCBI Gene 4780] {aka IMDDHH, NRF2, Nrf-2}, H3P16 (H3 histone pseudogene 16) [NCBI Gene 644914] {aka H3.6, H3F3AP6, p21}, DNMT1 (DNA methyltransferase 1) [NCBI Gene 1786] {aka ADCADN, AIM, CXXC9, DNMT, HSN1E, MCMT}, GLS (glutaminase) [NCBI Gene 2744] {aka AAD20, CASGID, DEE71, EIEE71, GAC, GAM}, Npc1l1 (NPC1 like intracellular cholesterol transporter 1) [NCBI Gene 237636] {aka 9130221N23Rik, Gm243}, ALDH1A1 (aldehyde dehydrogenase 1 family member A1) [NCBI Gene 216] {aka ALDC, ALDH-E1, ALDH1, ALDH11, HEL-9, HEL-S-53e}, GPX4 (glutathione peroxidase 4) [NCBI Gene 2879] {aka GPx-4, GSHPx-4, MCSP, PHGPx, SMDS, snGPx}, ATG7 (autophagy related 7) [NCBI Gene 10533] {aka APG7-LIKE, APG7L, GSA7, SCAR31}, DNMT3B (DNA methyltransferase 3 beta) [NCBI Gene 1789] {aka FSHD4, ICF, ICF1, M.HsaIIIB}, KEAP1 (kelch like ECH associated protein 1) [NCBI Gene 9817] {aka INrf2, KLHL19}, PRDX6 (peroxiredoxin 6) [NCBI Gene 9588] {aka 1-Cys, AOP2, HEL-S-128m, LPCAT-5, NSGPx, PRX}, Abcb1b (ATP-binding cassette, sub-family B member 1B) [NCBI Gene 18669] {aka Abcb1, Mdr1, Mdr1b, Pgy-1, Pgy1, mdr}, DNMT3A (DNA methyltransferase 3 alpha) [NCBI Gene 1788] {aka DNMT3A2, HESJAS, M.HsaIIIA, TBRS}, NPC1L1 (NPC1 like intracellular cholesterol transporter 1) [NCBI Gene 29881] {aka LDLCQ7, NPC11L1, SLC65A2}, CD44 (CD44 molecule (IN blood group)) [NCBI Gene 960] {aka CDW44, CSPG8, ECM-III, ECMR-III, H-CAM, HCELL}, DCTN6 (dynactin subunit 6) [NCBI Gene 10671] {aka WS-3, WS3, p27}, Nfe2l2 (nuclear factor, erythroid derived 2, like 2) [NCBI Gene 18024] {aka Nrf2}
- **Diseases:** melanoma (MESH:D008545), cytotoxicity (MESH:D064420), hyperlipidemia (MESH:D006949), metastasis (MESH:D009362), MCs (MESH:D002292), MDR (MESH:D018088), DTP (MESH:D056486), breast cancer (MESH:D001943), MDR cancer (MESH:D009369)
- **Chemicals:** dextran (MESH:D003911), Ezetimibe (MESH:D000069438), penicillin (MESH:D010406), eosin (MESH:D004801), CM10 (MESH:C101022), GSK-J4 (MESH:C000593030), streptomycin (MESH:D013307), Lipid (MESH:D008055), m6A (MESH:C005955), CQ (MESH:C048021), VER (MESH:D008874), peroxyl radicals (MESH:C049375), CO2 (MESH:D002245), hematoxylin (MESH:D006416), ROS (MESH:D017382), Verapamil HCl (MESH:D014700), FITC-dextran (MESH:C015219), Taxol (MESH:D017239), phospholipid (MESH:D010743), ADM (MESH:D004317), Triton X-100 (MESH:D017830), Decitabine (MESH:D000077209), formaldehyde (MESH:D005557), 3-Methyladenine HY-19312 (-), TRIzol (MESH:C411644), water (MESH:D014867), PBS (MESH:D007854), NaCl (MESH:D012965), superoxide (MESH:D013481), H&amp;E (MESH:D006371), rhodamine123 (MESH:D020112), GSH (MESH:D005978), agar (MESH:D000362), Zn(NO3)2 (MESH:C042103), malondialdehyde (MESH:D008315), Cholesterol (MESH:D002784), chloroquine (MESH:D002738), hyaluronic acid (MESH:D006820), Bafilomycin A1 (MESH:C040929), metal organic framework (MESH:D000073396), lipid peroxides (MESH:D008054), 3-Methyladenine (MESH:C025946), MOF (MESH:C037042), DCFH-DA (MESH:C029569), Vitamin E (MESH:D014810), N6-methyladenosine (MESH:C010223), 8-OHdG (MESH:D000080242), paraformaldehyde (MESH:C003043), GSSG (MESH:D019803), NP-40 (MESH:C010615), SDS (MESH:D012967), DCF (MESH:D015649), bisulfite (MESH:C042345), PVDF (MESH:C024865), 2-methylimidazole (MESH:C032655), MDA (MESH:D015104), N-Acetyl-L-cysteine (MESH:D000111),  (MESH:D000970)
- **Species:** Mus musculus (house mouse, species) [taxon 10090], Homo sapiens (human, species) [taxon 9606]
- **Mutations:** GGCTCAGCCTCAGACCCCAGCTCTG   3 CCAGGGGCTTAGCCTAGACAGCCCC, GGCACCTTCAGTGTCAAAGGGCCTT   4 CAGGAGGGAGCAGAAAGTGTGTACC, GCCCCCGCTTTAGATGAGCCTCATC   2 GTCACTGCGTCACTCCACCCTGCCT, S0131S
- **Cell lines:** MCF-7ADR — Homo sapiens (Human), High grade ovarian serous adenocarcinoma, Cancer cell line (CVCL_1452), EV2A — Homo sapiens (Human), Human papillomavirus-related endocervical adenocarcinoma, Cancer cell line (CVCL_JA21), Cg — Mus musculus (Mouse), Spontaneously immortalized cell line (CVCL_C6EU), MCF-7 — Homo sapiens (Human), Invasive breast carcinoma of no special type, Cancer cell line (CVCL_0031), Du145 — Homo sapiens (Human), Prostate carcinoma, Cancer cell line (CVCL_0105), BALB/c — Mus musculus (Mouse), Spontaneously immortalized cell line (CVCL_0184)

## Full text

_Full body text omitted from this summary view._ Fetch the complete paper as Markdown: https://tomesphere.com/paper/PMC8819355/full.md

## Figures

11 figures with captions in the complete paper: https://tomesphere.com/paper/PMC8819355/full.md

## References

49 references — full list in the complete paper: https://tomesphere.com/paper/PMC8819355/full.md

---
Source: https://tomesphere.com/paper/PMC8819355