# Transcriptome Profiling and Molecular Pathway Analysis of Genes in Association with Salinity Adaptation in Nile Tilapia Oreochromis niloticus

**Authors:** Zhixin Xu, Lei Gan, Tongyu Li, Chang Xu, Ke Chen, Xiaodan Wang, Jian G. Qin, Liqiao Chen, Erchao Li

PMC · DOI: 10.1371/journal.pone.0136506 · 2015-08-25

## TL;DR

This study explores how Nile tilapia adapt to different salinity levels by analyzing gene expression and molecular pathways.

## Contribution

The study identifies three categories of gene expression changes and their associated pathways in response to salinity stress in Nile tilapia.

## Key findings

- Steroid biosynthesis and related pathways are significantly affected by salinity stress.
- Ribosomes and oxidative phosphorylation show sensitivity to salinity variation.
- Protein export and thyroid hormone synthesis pathways are less sensitive to salinity changes.

## Abstract

Nile tilapia Oreochromis niloticus is a freshwater fish but can tolerate a wide range of salinities. The mechanism of salinity adaptation at the molecular level was studied using RNA-Seq to explore the molecular pathways in fish exposed to 0, 8, or 16 (practical salinity unit, psu). Based on the change of gene expressions, the differential genes unions from freshwater to saline water were classified into three categories. In the constant change category (1), steroid biosynthesis, steroid hormone biosynthesis, fat digestion and absorption, complement and coagulation cascades were significantly affected by salinity indicating the pivotal roles of sterol-related pathways in response to salinity stress. In the change-then-stable category (2), ribosomes, oxidative phosphorylation, signaling pathways for peroxisome proliferator activated receptors, and fat digestion and absorption changed significantly with increasing salinity, showing sensitivity to salinity variation in the environment and a responding threshold to salinity change. In the stable-then-change category (3), protein export, protein processing in endoplasmic reticulum, tight junction, thyroid hormone synthesis, antigen processing and presentation, glycolysis/gluconeogenesis and glycosaminoglycan biosynthesis—keratan sulfate were the significantly changed pathways, suggesting that these pathways were less sensitive to salinity variation. This study reveals fundamental mechanism of the molecular response to salinity adaptation in O. niloticus, and provides a general guidance to understand saline acclimation in O. niloticus.

## Linked entities

- **Species:** Oreochromis niloticus (taxon 8128)

## Full-text entities

- **Genes:** GADD45B [NCBI Gene 100705173], COX5A (cytochrome c oxidase subunit 5A) [NCBI Gene 9377] {aka COX, COX-VA, MC4DN20, VA}, PCYT1B [NCBI Gene 100707004], SGCG [NCBI Gene 100690446], LCT (lactase) [NCBI Gene 3938] {aka LAC, LPH, LPH1}, Pik3r1 (phosphoinositide-3-kinase regulatory subunit 1) [NCBI Gene 18708] {aka PI3K, p50alpha, p55alpha, p85alpha}, COX6B1 (cytochrome c oxidase subunit 6B1) [NCBI Gene 1340] {aka COX6B, COXG, COXVIb1, MC4DN7}, FABP6 (fatty acid binding protein 6) [NCBI Gene 2172] {aka I-15P, I-BABP, I-BALB, I-BAP, ILBP, ILBP3}, NDUFS1 (NADH:ubiquinone oxidoreductase core subunit S1) [NCBI Gene 4719] {aka CI-75Kd, CI-75k, MC1DN5, PRO1304}, FSCN1 (fascin actin-bundling protein 1) [NCBI Gene 6624] {aka HSN, SNL, p55}, NDUFA11 (NADH:ubiquinone oxidoreductase subunit A11) [NCBI Gene 126328] {aka B14.7, CI-B14.7, MC1DN14}, NDUFS4 (NADH:ubiquinone oxidoreductase subunit S4) [NCBI Gene 4724] {aka AQDQ, CI-18, CI-18 kDa, CI-AQDQ, MC1DN1}, ITGB4 (integrin subunit beta 4) [NCBI Gene 3691] {aka CD104, GP150, JEB5A, JEB5B}, Sult2b1 (sulfotransferase family, cytosolic, 2B, member 1) [NCBI Gene 54200] {aka ST2B1, SULT2B}, CDKN1B (cyclin dependent kinase inhibitor 1B) [NCBI Gene 1027] {aka CDKN4, KIP1, MEN1B, MEN4, P27KIP1}, NDUFB2 (NADH:ubiquinone oxidoreductase subunit B2) [NCBI Gene 4708] {aka AGGG, CI-AGGG}, APOA1 (apolipoprotein A1) [NCBI Gene 335] {aka AMYLD3, HPALP2, apo(a)}, PNPLA2 (patatin like domain 2, triacylglycerol lipase) [NCBI Gene 57104] {aka 1110001C14Rik, ATGL, FP17548, PEDF-R, TTS-2.2, TTS2}, IGF1R [NCBI Gene 100707581], CERS2 (ceramide synthase 2) [NCBI Gene 29956] {aka L3, LASS2, SP260, TMSG1}, PCK1 [NCBI Gene 100696099], LAMC3 (laminin subunit gamma 3) [NCBI Gene 10319] {aka OCCM}, RXRG (retinoid X receptor gamma) [NCBI Gene 6258] {aka NR2B3, RXR-gamma, RXRC, RXRgamma}, GOT1 (glutamic-oxaloacetic transaminase 1) [NCBI Gene 2805] {aka AST, AST1, ASTQTL1, GIG18, SGOT, cAspAT}, MYH6 (myosin heavy chain 6) [NCBI Gene 4624] {aka ASD3, CMD1EE, CMH14, MYHC, MYHCA, SSS3}, PGP (phosphoglycolate phosphatase) [NCBI Gene 283871] {aka AUM, G3PP, PGPase}, ACSL5 (acyl-CoA synthetase long chain family member 5) [NCBI Gene 51703] {aka ACS2, ACS5, DIAR13, FACL5}, PLB1 (phospholipase B1) [NCBI Gene 151056] {aka PLB, PLB/LIP}, RBP2 [NCBI Gene 100700053], COX6A1 (cytochrome c oxidase subunit 6A1) [NCBI Gene 1337] {aka CMTRID, COX6A, COX6AL}, GCG (glucagon) [NCBI Gene 403571] {aka GLP-1}, MYC (MYC proto-oncogene, bHLH transcription factor) [NCBI Gene 4609] {aka MRTL, MYCC, bHLHe39, c-Myc}, PRKAG3 (protein kinase AMP-activated non-catalytic subunit gamma 3) [NCBI Gene 53632] {aka AMPKG3, SMGMQTL}, ALPI (alkaline phosphatase, intestinal) [NCBI Gene 248] {aka IAP}, CYP2R1 (cytochrome P450 family 2 subfamily R member 1) [NCBI Gene 120227], P53 [NCBI Gene 100136737], ASAH2 (N-acylsphingosine amidohydrolase 2) [NCBI Gene 56624] {aka BCDase, HNAC1, LCDase, N-CDase, NCDase}, BMF (Bcl2 modifying factor) [NCBI Gene 90427], COX7A2 (cytochrome c oxidase subunit 7A2) [NCBI Gene 1347] {aka COX7AL, COX7AL1, COXVIIAL, COXVIIa-L, VIIAL}, PSMB4 (proteasome 20S subunit beta 4) [NCBI Gene 5692] {aka HN3, HsN3, PRAAS3, PROS-26, PROS26}, EF1A [NCBI Gene 100534431], ATP6V1H (ATPase H+ transporting V1 subunit H) [NCBI Gene 51606] {aka CGI-11, MSTP042, NBP1, SFD, SFDalpha, SFDbeta}, MYLPF [NCBI Gene 100702521], ALPL (alkaline phosphatase, biomineralization associated) [NCBI Gene 249] {aka AP-TNAP, APTNAP, HOPS, HPPA, HPPC, HPPI}, DTYMK (deoxythymidylate kinase) [NCBI Gene 1841] {aka CDC8, CONPM, PP3731, TMPK, TYMK}, PLD1 (phospholipase D1) [NCBI Gene 5337] {aka CVDD, CVDP1}, NT5C2 (5'-nucleotidase, cytosolic II) [NCBI Gene 22978] {aka GMP, NT5B, PNT5, SPG45, SPG65, cN-II}, VDAC3 [NCBI Gene 100698339], SQLE [NCBI Gene 100703372], B3GNT7 [NCBI Gene 100699669], FZR1 (fizzy and cell division cycle 20 related 1) [NCBI Gene 51343] {aka CDC20C, CDH1, DEE109, FZR, FZR2, HCDH}, ITGA6 (integrin subunit alpha 6) [NCBI Gene 3655] {aka CD49f, ITGA6A, ITGA6B, JEB6, VLA-6}, ITGB3 (integrin subunit beta 3) [NCBI Gene 3690] {aka BDPLT16, BDPLT2, BDPLT24, CD61, FMAIT1, GP3A}, GCDH (glutaryl-CoA dehydrogenase) [NCBI Gene 2639] {aka ACAD5, GCD}, DCTD (dCMP deaminase) [NCBI Gene 1635], ADCY8 [NCBI Gene 100708106], plasminogen [NCBI Gene 100702940], GAPDHS (glyceraldehyde-3-phosphate dehydrogenase, spermatogenic) [NCBI Gene 26330] {aka GAPD2, GAPDH-2, GAPDS, HEL-S-278, HSD-35}, ANGPT1 (angiopoietin 1) [NCBI Gene 284] {aka AGP1, AGPT, AGPT-1, ANG1, HAE5}, CD44 (CD44 molecule (IN blood group)) [NCBI Gene 960] {aka CDW44, CSPG8, ECM-III, ECMR-III, H-CAM, HCELL}
- **Diseases:** Hypertrophic (MESH:D002312), Alzheimer's disease (MESH:D000544), Ether lipid (MESH:D011017), Small cell lung cancer (MESH:D055752), Rheumatoid arthritis (MESH:D001172), cardiomyopathy (MESH:D009202), Parkinson's disease (MESH:D010300), hemolysis (MESH:D006461), cancer (MESH:D009369), congenital diabetes (MESH:D003920), HCM (MESH:D000092183), inflammatory (MESH:D007249), homeostasis disorder (MESH:D009358), carcinogenesis (MESH:D063646)
- **Chemicals:** water (MESH:D014867), carotenoids (MESH:D002338), beta-carotene (MESH:D019207), cortisol (MESH:D006854), ATP (MESH:D000255), acetyl coenzyme A (MESH:D000105), unsaturated fatty acids (MESH:D005231), Arachidonic acid (MESH:D016718), Trizol (MESH:C411644), Ether lipid (-), Retinol (MESH:D014801), DHEA (MESH:D003687), alpha-tocopherol (MESH:D024502), MS-222 (MESH:C003636), oxygen (MESH:D010100), salt (MESH:D012492), Pyrimidine (MESH:C030986), Folate (MESH:D005492), Pyruvate (MESH:D019289), reactive oxygen species (MESH:D017382), Lipid (MESH:D008055), glycogen (MESH:D006003), agarose (MESH:D012685), porphyrin (MESH:D011166), cholesterol sulfate (MESH:C007045), Fat (MESH:D005223), TCA (MESH:D014238), proline (MESH:D011392), Sulfur (MESH:D013455), pregnenolone (MESH:D011284), carbohydrate (MESH:D002241), triglyceride (MESH:D014280), Steroid hormone (MESH:D013256), arginine (MESH:D001120), monoacylglycerols (MESH:D050178), fatty acid (MESH:D005227), vitamin E (MESH:D014810), chlorophyll (MESH:D002734), glucose (MESH:D005947), Glycosaminoglycan (MESH:D006025), sugar (MESH:D000073893), glycan (MESH:D011134), glycerophospholipid (MESH:D020404), cholesterol (MESH:D002784), amino acid (MESH:D000596), bicarbonate (MESH:D001639), lysophosphatidic acid (MESH:C032881), keratan sulfate (MESH:D007632), sterol (MESH:D013261)
- **Species:** Oreochromis mossambicus (Hawaiian perch, species) [taxon 8127], Tilapia (genus) [taxon 8126], Actinopterygii (fishes, superclass) [taxon 7898], Mus musculus (house mouse, species) [taxon 10090], Canis lupus familiaris (dog, subspecies) [taxon 9615], Callinectes sapidus (blue crab, species) [taxon 6763], Oncorhynchus mykiss (rainbow trout, species) [taxon 8022], Homo sapiens (human, species) [taxon 9606], Solea senegalensis (Senegalese sole, species) [taxon 28829], Neohelice granulata (species) [taxon 53323], Rattus norvegicus (brown rat, species) [taxon 10116], Eriocheir sinensis (Chinese hairy crab, species) [taxon 95602], Oreochromis niloticus (Nile tilapia, species) [taxon 8128], Danio rerio (leopard danio, species) [taxon 7955]
- **Mutations:** GGCGAGTCCAACATTCAGATAACCA 107     TACTTCTCCACCTTACCGAGCACAT, C3 GCAGCACCTGGTTGACAGCATAT, CCTTACACCGTACAATGGAGCAGAG 108     GTCCCAAGCCCTGATGTTAAACTGT, C6 GGACTCGCAGCATGGACCTT, GCAACTCGCAGGAGCATCTTCA 112     CTTGGCGGTTATGGACGGTCTT, GGTTGCTTCTTGTTCTGTTGGACTC 101     GTGACAGTGCTCATTAGACCAGGAT, ATGCCTCCGCTCCAGTCAGA 111     CTTGTTGTCATTGCCGCCAGAG, TCGCTCAACCTGTTGGAGGAGAA 94     TCCACCACAGCCACCACATCT, ACTTTGCTGGGACTGACACTACATC 102     GGTCTATCTCCTCCTGGCATTGTTC

## Figures

13 figures with captions in the complete paper: https://tomesphere.com/paper/PMC4548949/full.md

---
Source: https://tomesphere.com/paper/PMC4548949