Sex chromosome–dependent epigenetic regulation underlies sex-specific H4 acetylation at the aromatase promoter in the developing mouse amygdala
C. Sosa, L. E. Cabrera-Zapata, C. D Cisternas, M. A. Arevalo, M. J. Cambiasso
TL;DR
This study shows that sex chromosomes influence epigenetic regulation in the mouse brain, leading to sex-specific differences in aromatase expression during early development.
Contribution
The study identifies sex chromosome-dependent epigenetic regulation of aromatase in the developing mouse amygdala.
Findings
XX embryos show higher expression of DNA methyltransferases and histone deacetylases in a region-specific manner.
Acetyl-H4 enrichment at the Cyp19a1 promoter was observed only in male amygdala neuronal cultures.
Zebularine did not significantly affect aromatase expression in amygdala neurons.
Abstract
Sexual differentiation of the brain is a complex ontogenetic process orchestrated by genetic and hormonal influences, leading to sex‑specific physiological and behavioral traits in adulthood. In mammals, the sex chromosome complement (SCC) contributes to this process by encoding unequal genetic information in XX and XY cells. Furthermore, SCC upregulates aromatase and estrogen receptor β (ERβ) expression in amygdala neurons of XY compared to XX embryos at embryonic day (E) 14. These molecules are critically implicated in the steroid-dependent programming of neural circuits during the subsequent critical window of sexual differentiation (E17-PN10). Since epigenetic mechanisms play a key role in specific target gene expression forming a layer of gene regulation, we aimed to contribute to a better understanding of their impact on the sexual differentiation of the brain. Four Core…
Genes, proteins, chemicals, diseases, species, mutations and cell lines named across the full text — each resolved to its canonical identifier and authoritative record.
Click any figure to enlarge with its caption.
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7- —The Company of Biology
- —https://doi.org/10.13039/501100002923Consejo Nacional de Investigaciones Científicas y Técnicas
- —https://doi.org/10.13039/501100003074Agencia Nacional de Promoción Científica y Tecnológica
- —International Brain Research Organization (IBRO)
- —International Society for Neurochemistry (ISN)
- —https://doi.org/10.13039/501100011033Agencia Estatal de Investigación
- —Centro de Investigación Biomédica en Red de Fragilidad y Envejecimiento Saludable (CIBERFES), Instituto de Salud Carlos III, Madrid, Spain
- —Secretaría de Ciencia y Tecnología de la Universidad Nacional de Córdoba, Argentina
Peer Reviews
No public reviews on file for this paper yet. If you reviewed it on a platform where reviews are public (OpenReview, ICLR, NeurIPS, ICML), you can paste yours below so the community can read it here.
Videos
No videos yet. Explain this paper in a talk, walkthrough, or lecture? Add one.
Taxonomy
TopicsEpigenetics and DNA Methylation · Genetic and Clinical Aspects of Sex Determination and Chromosomal Abnormalities · Hypothalamic control of reproductive hormones
Background
Efforts to uncover the biological basis of sex differences in non-gonadal tissues, including the brain, suggest that sex-intrinsic factors influence both physiological processes [1, 2] and neurological disorders outcomes and susceptibilities [3, 4]. A major goal in developmental biology is to identify the molecular mechanisms underlying these differences. In mammals, the evolution of heteromorphic sex chromosomes has led to an inherent difference between XX and XY complements, referred to as the Sex Chromosome Complement (SCC). XX individuals carry two X chromosomes, one inherited from each parent, and typically develop ovaries (female). In contrast, XY individuals inherit the maternal X chromosome and the paternal Y chromosome, with male differentiation driven by the testis‑determining Sry gene located on the Y chromosome. Currently, it is widely accepted that the contribution of the X and Y chromosomes to the sexual differentiation of the brain (and other non‑gonadal tissues) begins in the zygote and continues throughout life, mediated by the differential expression of sex chromosome‑linked genes and/or their regulatory influence on autosomal gene expression [5]. It is also well established that the hormonal environment determined by gonadal secretions contributes to the generation of sexual dimorphisms in the mammalian brain. In this context, androgen actions that organize neural circuits during a perinatal critical period (CP) [from embryonic day (E) 17 to postnatal (PN) day 10 in the rodent brain] depend on their aromatization to estradiol (E2) [6, 7], a conversion catalyzed by the aromatase enzyme. E2 is essential for building and organizing sex‑differentiated brain circuits that later affect behavior, memory, and protection against injury [8, 9].
Aromatase is encoded by the Cyp19a1 gene and its expression in the rodent brain is sex- as well as region-specific [10], reaching its highest levels during the CP in the preoptic area and hypothalamus [11, 12]. The neuronal regulation of aromatase expression within the central nervous system (CNS) is critical in modulating a range of non-reproductive functions. Also, the local synthesis of E2 in the CNS plays a significant role in establishing sex differences in synaptic plasticity, behavior and the neuroprotective response to neural injuries [13, 14]. Previous studies from our laboratory have shown higher aromatase and ERβ expression in amygdala neurons of XY compared to XX mouse embryos at E15, before the CP of brain masculinization. Additionally, aromatase regulation by E2 and dihydrotestosterone (DHT), assessed in vitro, was dependent on the SCC. Indeed, treatment with E2 or DHT increased aromatase expression levels only in XX amygdala neurons via an ERβ mediated mechanism [15, 16].
A variety of epigenetic mechanisms constitute a fundamental regulatory layer during development, modulating transcriptional programs that underlie cell fate specification and differentiation trajectories. By chromatin remodeling, the epigenetic mechanisms enable the activation or repression of genes without altering the DNA sequence, providing cells with the capacity to respond to environmental cues [17]. Among them, histone acetylation and DNA methylation are the most thoroughly investigated epigenetic mechanisms in the field. These mechanisms implicate the action of molecules (epigenetic modifiers) classified by function as writers, erasers or readers. DNA methyltransferases (DNMTs) are modifiers that add methyl marks on cytosine bases of DNA, usually leading to gene repression by recruiting co-repressor complexes to promoter sequences of target genes. On the other hand, histone deacetylases (HDACs) eraser enzymes remove acetyl groups from histone tails leading to chromatin condensation and gene silencing. Both mechanisms have been implicated in generating sex dimorphisms in the brain [18–22]. In recent years, the epigenetic regulations triggered by transient exposure to E2 during the CP have been increasingly recognized as playing a role in the sexual differentiation of the brain, although the early epigenetic landscape defining the onset of this complex process remains unclear. In the present study, we first investigated the epigenetic machinery involved in DNA methylation and histone deacetylation to elucidate the underlying epigenetic landscape in specific brain areas of XX and XY mice at two developmental time points: before (E14) and during (PN0) the CP. We focused our work on the amygdala, hypothalamus, and cerebral cortex, brain regions differentially shaped by SCC and steroid hormone signaling. The amygdala and hypothalamus exhibit high sensitivity to sex steroids and marked sex‑specific gene expression patterns, whereas the cerebral cortex shows comparatively subtler sex-related differences in connectivity and transcriptional regulation [23]. Studying the epigenetic profiles in these areas provides insight into how sex-dependent regulatory mechanisms shape neuronal differentiation and functional specialization. Moreover, it allows us to identify molecular signatures that may contribute to sex‑specific trajectories and differential susceptibility to neurodevelopmental disorders. Subsequently, we evaluated the role of DNA methylation and histone acetylation in the sex-specific regulation of Cyp19a1 and Esr2 expression in amygdala neurons of male and female wild-type mice at E14, two key genes involved in hormone-driven sexual differentiation of the brain.
Methods
Model organism
Experiments were performed in Mus musculus. MF1 wild-type mice and the Four Core Genotypes (FCG) transgenic model, generated in the MF1 strain and kindly donated by Dr. Paul Burgoyne (National Institute for Medical Research, London, UK), were bred and maintained at the Instituto de Investigación Médica Mercedes y Martín Ferreyra (INIMEC-CONICET-UNC). The FCG mice exhibit a unique genetic background, wherein males (XY male) possess a Y chromosome that has been modified to lack the testis-determining gene, introduced as an autosomal Sex-determining Region Y (Sry) transgene [24]. XY male mice were bred to MF1 wild-type females (Harlan Laboratory) to produce FCG mice of four genotypes: XY/XX males (with Sry) and XY/XX females (lacking Sry). CD1 wild-type mice, used for selected experiments, were maintained at the Instituto Cajal (CSIC, Madrid, Spain). Animals were housed under specific pathogen-free (SPF) conditions in individually ventilated or open-top cages, with a 12 h light/dark cycle, constant temperature (23 ± 1 °C), and ad libitum access to food and water. Genotyping of FCG mice was performed by polymerase chain reaction (PCR) as described in Cisternas et al. [15].
Amygdala neuronal cultures and cell treatments
Primary amygdala neuronal cultures were established from CD1 wild-type embryos at E14, with the day of vaginal plug detection designated as E0, to avoid neuronal exposure to the peak of testosterone that occurs around E17.5. Embryos were collected from the uterine cavity, and sex was determined based on the presence or absence of the spermatic artery in the developing gonads. The brain was dissected out, meninges were removed and the amygdala region was isolated. Sex-grouped amygdala tissue was chemically dissociated in 0.25% trypsin (Gibco, USA) for 15 min at 37 ºC, washed three times with Ca^2+/^Mg^2+−^free Hank’s Buffered Salt Solution and then mechanically dissociated in culture medium at 37 ºC. Cells were plated on poly-L-lysine–pre-coated surfaces (1 μg/μl; Sigma-Aldrich, USA) and maintained under phenol red-free conditions to prevent estrogen-like effects [25]. Culture medium was phenol red-free Neurobasal (Gibco, USA) supplemented with B-27, 0.043% L-alanyl-L-glutamine (GlutaMAX-I) and 1% antibiotic–antimycotic containing 10,000 U/ml penicillin, 10,000 μg/ml streptomycin, and 25 μg/ ml amphotericin B (Gibco, USA). To study the effect of pharmacological inhibition of DNA methylation on gene expression, after 24 h in vitro male and female amygdala neuronal cultures were treated with 200 µM zebularine (Sigma-Aldrich, USA) or vehicle for 48 h, as previously reported [26].
Reverse transcription and quantitative real time PCR (RT-qPCR)
qPCR assays were performed using purified RNA from both cell cultures and tissue samples of amygdala, hypothalamus, or parahippocampal cortex. Total RNA was isolated with TRIzol reagent (Invitrogen, USA) and subsequently purified and quantified on a NanoDrop 2000 (Thermo Fisher Scientific, USA) following established protocols [16]. 1 µg of RNA from each sample was reverse transcribed to cDNA in a 20 µl reaction using M-MLV reverse transcriptase (Promega, USA) and random primers (Invitrogen, USA), according to the manufacturer instructions. Step One™ Real Time or 7500 Real Time PCR systems (Applied Biosystems, USA) were used to perform qPCR assays with Power SYBR Green Master Mix (Applied Biosystems, USA). Primers (Table 1) were designed using Primer-Basic Local Alignment Search Tool (BLAST) (https://www.ncbi.nlm.nih.gov/tools/primer-blast/) for mRNA-specific amplification by targeting exon–exon junctions. Primers were validated for 90–110% efficiency by generating the calibration curve with efficiencies E = 2 ± 0.1 (E = 10^[1/slope]^) and amplified by a single product determined by melting curve analysis. Relative mRNA expression was quantified using the ΔΔCt method, except for Cyp19a1 which was determined according to Pfaffl model [27] as previously reported [15, 16]. Ct values of Gapdh and Rn18s (18S rRNA) were used as housekeeping controls. XY male (for FCG mice) or male (for wild-type mice) samples served as reference group, using one calibrator sample per litter.Table 1. Primer sequences for qPCR assaysGeneForward sequence 5´‒3´Reverse sequence 5´‒3´Dnmt1F: CCATCTTCTTGTCTCCCTGTATGR: GGTGCTTTGTCCTTCTCCTTDnmt3aF: GTCTCAACAGCACCATTCCTR: TGTGGTAGGCACCTGAAATACDnmt3bF: GTGCCAGACCTTGGAAACCTR: CATTGTTTCCTGAAAGAAGGCCCHdac1F: GTGAGGACTGTCCGGTGTTTR: CTTCACAGCACTTGCGACAGHdac2F: GATCGCGTGATGACCGTCTR: TCCAGCACCAATATCCCTCAAGHdac4F: ACAGAAACTGGACAGCTCGCR: CCACTACACAGCCTACAGCCHdac6F: AAGGTGGGTGATTTTTCTGGGR: GCTCCTGGAAAGGCTCTCTAATHdac8F: TTTTCCCAGGAACAGGTGACAR: AGGGAGTTCTGGTGAAACAGGCyp19a1F: CGGGCTACGTGGATGTGTTR: GAGCTTGCCAGGCGTTAAAGGapdhF: AGTGCCAGCCTCGTCCCGTAGR: GTGCCGTTGAATTTGCCGTGAGTGRn18sF: CGCCGCTAGAGGTGAAATTCTR: CATTCTTGGCAAATGCTTTCGCyp19a1 PromoterF: GGCTTCTCTTGGTACGCTGAR: TTGTTGCTAAGAGATCAGTTGCTTEsr2 PromoterF: TCACGTGGGCTTCTCAGCTAR: AGACTGCCCACGACTAACGA
DNA purification and dot blot
Genomic DNA was purified from amygdala tissue of E14 mice separated by sex, and quantified by spectrophotometry using NanoDrop 2000 (Thermo Fisher Scientific, USA). 5mC dot blots were performed using a Bio-Dot SF Microfiltration Apparatus (Bio-Rad, USA). DNA was spotted on an Amersham Hybond-N + membrane (GE Healthcare, USA) at two amounts (1000 and 1500 ng) and subsequently fixed by incubation at 85 ºC for 30 min. The membrane was incubated under constant agitation in blocking solution (TBS-T containing 5% non-fat dry milk) for 30 min at room temperature (RT), followed by an overnight (ON) incubation at 4 °C with a rabbit anti-5mC antibody (Cat. #28,692, Cell Signaling, USA). After three washes, the membrane was incubated with an anti-rabbit secondary antibody conjugated to an infrared fluorophore (LI-COR, USA) for 1 h at RT. Signal detection was performed with the Odyssey infrared imaging system (LI-COR, USA), and the intensity of each dot was quantified using ImageJ (NIH, USA). To verify equal DNA loading among samples, a membrane was stained with methylene blue.
Chromatin immunoprecipitation (ChIP)
The ChIP-IT High Sensitivity Kit (Active Motif, USA) was used to perform ChIP assays, following the protocol supplied by the manufacturer. A total of 9 million amygdala neurons separated by sex from CD1 mouse embryos at E14 were cultured for 3 days in vitro (DIV). Then, cross-linking was performed using a fixation buffer containing 1.1% formaldehyde (Sigma-Aldrich, USA) for 15 min. Cells were scraped, centrifuged, and washed with cold Phosphate Buffered Saline (PBS 1X) before resuspension in ChIP buffer supplemented with PIC (Protease Inhibitor Cocktail; Active Motif) and PMSF (phenylmethylsulfonyl fluoride; Active Motif). Cells were subsequently homogenized with a Dounce homogenizer and chromatin was sonicated to 200–1000 bp fragments using a Fisher Scientific Model 705 Sonic Dismembrator with microtip (30 cycles, 30 s on/off, 4 ºC). A fraction corresponding to 1% of the sonicated chromatin was set aside as input DNA with concentration measured at 260 nm on a NanoDrop One (Thermo Fisher Scientific, USA). For ChIP, 2.6 µg of fragmented chromatin was incubated ON at 4 ºC with 5 µg of anti–acetyl-H3 (Cat. #06–599, Millipore, USA), anti–acetyl-H4 (Cat. #06–866, Millipore, USA), or mouse IgG control (Cat. #115–001-003, Jackson ImmunoResearch) in ChIP buffer supplemented with PIC. Reactions were subsequently incubated for 3 h at 4º C with pre-cleared protein G agarose beads on an end-to-end rotator, washed with AM1 buffer, and the bound DNA was eluted in AM4 elution buffer at 37 ºC. Cross- links were reversed by proteinase K incubation (55 ºC, 30 min; 80 ºC, 2 h) and DNA was subsequently purified using the spin column kit according to the manufacturer’s instructions. Immunoprecipitated DNA was quantified by qPCR with primers targeting the Cyp19a1 and Esr2 promoter regions (Table 1) and using Power SYBR Green Master Mix (Applied Biosystems, USA). For the aromatase promoter I.f, primers were designed to target the − 190 to − 40 region upstream of the transcription start site (TSS) as previously reported by Yilmaz et al. [28]. Esr2 primers targeting a region containing the promoter -73 to + 17 bp relative to TSS were designed using Primer-BLAST (NCBI) based on the sequence for the promoter reported on the Eukaryotic Promoter Database (EPD, Swiss Institute of Bioinformatics). ChIP-qPCR data were expressed as % input relative to input DNA.
Statistical analysis
Data were analyzed by two or three-way analyses of variance (ANOVA) with Tukey´s post hoc test and presented as mean ± standard error of the mean (SEM) assuming normality and equal variance. When assumptions were not met, log10 transformation or Kruskal–Wallis test were applied. Statistical significance was set at p < 0.05. In addition to p-values, effect sizes were estimated for selected experiments using partial eta squared (partial η^2^) to quantify the magnitude of main effects and interactions, independent of sample size. Effect sizes were calculated from ANOVA F statistics and degrees of freedom. All analyses were performed using GraphPad Prism version 8.0.2 (GraphPad Software, Inc.).
Results
Sex chromosome complement differentially regulates dnmt gene expression across brain regions at E14
We first analyzed the Dnmt gene expression patterns in the amygdala, hypothalamus, and cortex of FCG tissue at E14 using RT-qPCR. In amygdala, two-way ANOVA revealed no effect of gonadal sex but a significant main effect of SCC for de novo methyltransferases Dnmt3a and Dnmt3b expression, with higher levels in XX compared to XY embryos [ANOVA_Dnmt3a_: F (1,14) = 7.67; p = 0.015; ANOVA_Dnmt3b_: F (1,18) = 4.88; p = 0.040]. In contrast, no differences among genotypes were detected for Dnmt1 expression in this region (Fig. 1A).Fig. 1. Relative mRNA levels of Dnmt3a, Dnmt3b and Dnmt1 in E14 FCG brain regions. (A) In the amygdala, Dnmt3a and Dnmt3b expression was significantly higher in XX embryos compared to XY, independent of gonadal sex; while Dnmt1 expression showed no significant differences. (B) In the hypothalamus, Dnmt3b mRNA levels were significantly elevated in XX embryos relative to XY; whereas Dnmt3a and Dnmt1 did not differ by genotype or gonadal sex. (C) In the cortex, Dnmt3b and Dnmt1 mRNA levels were significantly higher in XY embryos compared to XX, with no significant differences observed for Dnmt3a. Bars represent mean ± SEM; n = 3–8 embryos per genotype; *p < 0.05; **p < 0.01
In the hypothalamus, Dnmt3b expression was significantly higher in embryos carrying the XX SCC compared to those with XY, regardless of gonadal sex [ANOVA_Dnmt3b_ (1,18) = 7.42; p = 0.013], whereas Dnmt3a and Dnmt1 showed no significant differences in this brain area (Fig. 1B). Finally, in the cerebral cortex, both Dnmt3b and Dnmt1 exhibited significantly higher expression levels in XY compared to XX individuals, independently of gonadal sex [ANOVA_Dnmt3b_ (1,19) = 8.88; p = 0.007; ANOVA_Dnmt1_(1,18) = 4.50; p = 0.048)], whereas the Dnmt3a expression did not vary between genotypes (Fig. 1C).
Region-specific regulation of hdac gene expression by sex chromosome complement in embryonic brain
The mRNA expression levels of Hdac1, Hdac2, Hdac8, Hdac4, and Hdac6 were analyzed by RT-qPCR in amygdala, hypothalamus, and cortex of FCG embryos at E14. In both amygdala and hypothalamus, Hdac2 expression was significantly higher in embryos carrying the XX SCC compared to XY, independently of gonadal sex [ANOVA_Hdac2_, amygdala: F (1,20) = 5.23; p = 0.033; ANOVA_Hdac2_, hypothalamus: F (1,18) = 4.72; p = 0.043]; while Hdac1, Hdac4, and Hdac6 showed no significant differences between the four genotypes.
Likewise, Hdac8 showed a significant SCC effect in the amygdala, with higher expression in XX compared to XY embryos [ANOVA_Hdac8_, amygdala (1,21) = 5.13; p = 0.034], while no significant differences were observed in the hypothalamus (Fig. 2A and B, respectively).Fig. 2. Relative mRNA levels of Hdac1, Hdac2, Hdac8, Hdac4 and Hdac6 in E14 FCG brain regions. (A) In the amygdala, Hdac2 and Hdac8 mRNA levels were significantly higher in XX embryos compared to XY, regardless of gonadal sex. No significant differences were observed in Hdac1, Hdac4 or Hdac6. (B) In the hypothalamus, Hdac2 expression was significantly higher in XX embryos than XY, independently of gonadal sex. Hdac1, Hdac8, Hdac4 and Hdac6 levels did not vary across genotypes or gonadal sex. (C) In the cortex, Hdac6 mRNA levels showed significant differences associated with both SCC and gonadal sex. No significant differences were observed in Hdac1, Hdac8, and Hdac4. Data are mean ± SEM; n = 3–8 embryos per genotype; *p < 0.05; **p < 0.01
In the cerebral cortex, no significant genotype differences were detected in the expression levels of Hdac1, Hdac2, Hdac8 or Hdac4. As observed, Hdac6 displayed significant effects of both SCC and gonadal sex [ANOVA_Hdac6_, SCC: F (1,18) = 8.46; p = 0.010; Sex: F (1,18) = 10.48; p = 0.005].
Together, these results indicate that Hdac2 in hypothalamus as well as Hdac2 and Hdac8 in amygdala were upregulated in XX compared to XY embryos, and Hdac6 expression in the cortex was influenced by both SCC and gonadal sex (Fig. 2C).
Epigenetic machinery differences observed in embryos are attenuated at PN0 in the amygdala
To determine whether SCC-dependent differences observed during embryonic development persist after birth, we analyzed the expression of epigenetic machinery genes that showed SCC-dependent regulation at E14 in the amygdala of PN0 FCG mice. Given that this early postnatal period coincides with a surge in sex steroid levels, this analysis allowed us to assess whether postnatal hormonal exposure modifies the SCC-dependent pattern in embryos. ANOVA revealed no statistically significant main effects or interactions for Hdac2, Hdac8, Dnmt3a, or Dnmt3b at PN0 (Fig. 3). However, recognizing that the absence of statistical significance does not equate to the absence of an effect, particularly given the limited sample size in some groups at PN0, we further evaluated the magnitude of SCC-associated effects using effect size analyses. Partial η^2^ values indicated that sex chromosome-associated effects were markedly reduced at PN0 compared to E14 across most genes (Hdac8, Dnmt3a, and Dnmt3b), while Hdac2 showed a moderate effect size despite the lack of statistical significance (Supplementary Table S1). Together, these findings indicate that SCC-dependent differences in epigenetic machinery gene expression observed during embryonic development are less prominent at PN0, consistent with a developmental reduction in the magnitude of sex chromosome–associated effects during early postnatal life.Fig. 3. Relative mRNA levels of Dnmt3a, Dnmt3b, Hdac2 and Hdac8 in PN0 FCG mouse amygdala. No statistically significant main effects or interactions were observed among the four genotypes for any of the genes analyzed. Data are mean ± SEM; n = 3–6 individuals for each genotype
Global DNA methylation in the embryonic amygdala is not sexually dimorphic before the CP
In the amygdala, Dnmt3a and Dnmt3b expression was significantly higher in XX embryos compared to XY, suggesting a shift toward increased DNA methylation in the female amygdala prior to hormone-driven sexual differentiation of the brain. To further explore this, global DNA methylation levels were assessed by Dot Blot using an anti-5mC antibody in sex-separated amygdala tissue from E14 wild-type mice. The results revealed no significant differences in global DNA methylation between male and female embryos before the CP of hormonal secretion (Fig. 4).Fig. 4. Global 5-methylcytosine (5mC) levels in the E14 wild-type amygdala. Representative dot blot and quantitative analysis revealed no significant sex differences in global 5mC levels in the E14 amygdala. Data are mean ± SEM; n = 8 embryos per sex from 4 independent litters
Zebularine does not affect cyp19a1 expression in E14 amygdala neurons
Although no differences were detected in global DNA methylation between male and female embryos, the higher Cyp19a1 mRNA levels observed in male neuronal cultures raise the possibility that gene‑specific methylation patterns, rather than global changes, underlie sex‑dependent regulation. To explore this possibility, amygdala neuronal cultures from E14 wild-type embryos were treated with zebularine, a DNA methyltransferase inhibitor, or vehicle. Consistent with previous findings [15, 16], male neuronal cultures exhibited higher levels of aromatase expression compared to female cultures (Fig. 5; ANOVA, sex x zebularine interaction: F(1,8) = 6.82; p = 0.03). Although zebularine treatment tended to reduce Cyp19a1 expression in males and increase it in females, these changes did not reach statistical significance.Fig. 5. Effect of zebularine on Cyp19a1 mRNA expression in sexually segregated E14 wild-type amygdala neurons. Male amygdala cultures had higher expression of aromatase mRNA than females. Zebularine treatment did not produce statistically significant changes in Cyp19a1 expression. Data are mean ± SEM; n = 3 independent cultures per treatment; *p < 0.05
H4 acetylation drives male-specific cyp19a1 expression in developing amygdala
To study the epigenetic regulation of genes critical for brain sexual differentiation, ChIP-qPCR assays were performed on E14 wild-type amygdala-derived neuronal cultures segregated by sex. Data normalized to input revealed a significant interaction between sex and enrichment of acetylated Histone 4 (AcH4) at the Cyp19a1 promoter region [Fig. 6A; ANOVA: F (1,8) = 7.19; p = 0.02]. ChIP assays normalized to input showed a marked enrichment of AcH4 in male neurons (p < 0.01). Furthermore, a significant sex difference was detected, with male neurons exhibiting higher levels of AcH4-bound promoter DNA compared to female neurons (p = 0.05), suggesting enhanced promoter activity of the aromatase gene in males. In contrast, acetylated Histone 3 (AcH3) levels did not differ from IgG controls in either sex, and no sex-dependent differences were observed (Fig. 6B).Fig. 6. Relative levels of Cyp19a1 promoter DNA bound by AcH4 and AcH3 in E14 wild-type amygdala neurons. ChIP-qPCR analysis revealed (A) significant AcH4 enrichment at the Cyp19a1 promoter in males, but not in females; (B) no detectable AcH3 enrichment at the same promoter in either sex. IgG antibody was used as a negative control. Data are mean ± SEM; n = 3 independent cultures *p < 0.05; **p < 0.01
We also examined acetylation marks at the Esr2 promoter and found that neither AcH4 nor AcH3 displayed significant enrichment relative to IgG control in either males or females (Fig. 7A and B, respectively). These findings indicate a selective enhancement of H4 acetylation at the Cyp19a1 promoter in male amygdala neurons, pointing to a gene-specific, sex-dependent mechanism of epigenetic regulation.Fig. 7. Relative levels of Esr2 promoter DNA bound by AcH4 and AcH3 in E14 wild-type amygdala neurons. ChIP-qPCR analysis demonstrated no enrichment of (A) AcH4 or (B) AcH3 at the Esr2 promoter in either males or females. IgG antibody was used as a negative control. Data are mean ± SEM; n = 3 independent cultures
Discussion
In the field of brain sexual differentiation, the role of the epigenetic mechanisms triggered by a transient E2 exposure during the CP is increasingly being recognized. However, the contribution of the epigenetic landscape to sex differences in the brain prior to this window remains largely unexplored. In the present study, we provide novel evidence implicating SCC in shaping epigenetic mechanisms underlying brain sexual differentiation. These findings provide new insights into early neurodevelopment and challenge the long-standing notion that the female brain develops by default in absence of masculinizing hormones.
We found that SCC regulates the expression of epigenetic repressive modifiers in sexually-differentiated brain regions, such as the amygdala and hypothalamus, prior to the critical perinatal window for hormonal effects. Furthermore, we reveal a SCC-specific pattern of the DNA methylation and histone deacetylation machinery that contributes to the early epigenetic landscape in selected regions of the XX and XY mouse brain at E14. DNA methylation has been postulated as a mediator of hormonal-dependent brain sexual differentiation [18, 29]. Consistent with this notion, previous evidence suggests that ERα binding to DNA in response to perinatal E2 initiates a persistent epigenetic program that influences gene regulation [21]. In addition, E2 reduces DNA methylation, allowing critical neurodevelopmental genes to escape transcriptional repression in males, whereas these genes remain silenced in females through DNMT activity [18].
During the CP, the female rat amygdala shows elevated levels of Dnmt3a at PN1, as reported by Auger and colleagues [30], and more recent work has further revealed sex-specific differences in DNMT mRNA expression at this stage, with female offspring displaying reduced cortical Dnmt1 and Dnmt3a but increased cerebellar Dnmt1 expression compared with males [31]. Our results provide new evidence showing that even before the CP, at E14, Dnmt expression in the brain differs between XX and XY embryos. Specifically, Dnmt3a and Dnmt3b levels are higher in the XX than in the XY amygdala, while in the hypothalamus, Dnmt3b expression is also higher in XX compared to XY embryos. These are regions in which SCC-dependent regulation of autosomal genes critical for brain sexual differentiation has been reported [15, 32]. In contrast, in the cortex, Dnmt3a and Dnmt1 levels are higher in XY compared to XX individuals, revealing a region–specific regulation.
Moreover, we analyzed Hdacs expression levels, the enzymes that remove acetyl groups from histone lysine residues and enhances histone-DNA affinity leading to chromatin condensation and transcriptional repression. HDACs are widely expressed throughout the brain, where they contribute to intracellular regulation, neuronal differentiation, and cell viability [20]. Furthermore, HDACs have been linked to hormone-mediated gene regulation, as estrogen receptors (ERs) can recruit HDACs to silence gene expression, while HDACs themselves can modulate ER transcriptional activity [20]. Our data reveal that, even before the CP, some Hdacs exhibit a sex-specific expression in a region-specific manner. We found a significantly higher Hdac2 and Hdac8 expression in the amygdala, and increased Hdac2 expression in the hypothalamus of XX compared to XY embryos, regardless of gonadal sex. No differences were observed for the other Hdacs analyzed. In contrast, in the cortex, Hdac6 expression displayed a differential pattern influenced by both SCC and gonadal sex.
A particularly intriguing finding is the differential expression of Hdac8 in the amygdala, given that this enzyme is encoded by the mouse X chromosome. Previous studies have demonstrated that certain X-linked genes can escape the process of X-chromosome inactivation in a tissue-specific manner [33]. In this context, the elevated Hdac8 expression levels observed in XX compared to XY individuals may reflect a potential escape of Hdac8 from X–chromosome inactivation within the amygdala. Such a mechanism would be consistent with the notion that sex–specific regulation of epigenetic enzymes contributes to differences in neural development and function. However, this interpretation remains speculative, and additional studies will be required to determine whether Hdac8 indeed escapes X–chromosome inactivation and to clarify the implications of this process for sex–biased neurodevelopmental trajectories.
Except for Hdac8, the other HDACs and DNMTs analyzed are not X/Y-linked; however, growing evidence indicates that their regulation can nonetheless be influenced by sex chromosomes through indirect mechanisms. For instance, SCC (XX vs. XY) has been shown to affect chromatin accessibility and transcriptional networks, thereby modulating the activity of autosomal epigenetic regulators [34]. In particular, sex chromosome-encoded factors such as Xist RNA, genes that escape X-inactivation, and Y-linked transcriptional modulators can reshape the nuclear environment and impact the recruitment or activity of HDACs and DNMTs [35]. Moreover, differences in dosage compensation and sex-specific transcriptional programs establish distinct epigenetic contexts in male and female cells, leading to differential regulation of these enzymes despite their autosomal location [36]. While our study did not directly interrogate these broader pathways, the literature strongly supports the idea that sex chromosomes exert trans-acting effects on autosomal epigenetic machinery, consistent with the sex-specific differences observed in our data. Supporting this concept, our laboratory has provided direct evidence that the X-linked gene Kdm6a, which encodes a histone demethylase, regulates the autosomal gene Ngn3 through histone methylation-dependent mechanisms. These findings highlight how sex chromosome-encoded epigenetic regulators can exert trans-acting control over autosomal targets, reinforcing the broader paradigm of sex chromosome influence on epigenetic regulation [37, 38].
Together, our present findings indicate that the SCC contributes to the early and region-specific regulation of Hdac and Dnmt expression in the developing brain. Previous work has shown that epigenetic marks such as DNA methylation and histone acetylation are dynamically regulated in a sex- and region-specific manner during development [39–41]. These region-specific epigenetic contexts provide a plausible explanation for why SCC-dependent effects on epigenetic machinery are evident in some regions during embryonic development but absent or attenuated in others. This early epigenetic dimorphism may establish a molecular framework that precedes, and potentially interacts with, later hormone-dependent mechanisms driving the sexual differentiation of neural circuits. We further examined whether these SCC-dependent differences persist into the perinatal critical period by analyzing Dnmt and Hdac expression in the amygdala at PN0. In contrast to the robust SCC effects observed at E14, no significant main effects or interactions were detected at PN0. Importantly, effect size analyses revealed markedly reduced effect sizes at PN0 compared to E14, indicating that SCC-related differences in epigenetic gene expression are attenuated during this developmental window. Together, these results suggest that SCC exerts a transient, developmentally restricted influence on Dnmt and Hdac expression that is prominent during embryonic stages and diminishes around birth, coinciding with the perinatal hormonal surge. This developmental shift may reflect a reorganization of epigenetic regulatory mechanisms, whereby early SCC-dependent patterns are subsequently modulated by the changing hormonal environment, collectively shaping the epigenetic landscape underlying brain sexual differentiation.
Consistent with our findings at PN0, Matsuda et al. [40] reported that overall HDAC expression levels do not differ between males and females in the rat preoptic area (POA) during the perinatal critical period. Importantly, however, that study demonstrated sex differences at the level of chromatin regulation at specific gene promoters: males exhibited increased binding of HDAC2 and HDAC4 to the Esr1 and Cyp19a1 promoters, accompanied by higher local acetylation of histones H3 and H4, indicative of promoter-specific regulation in the developing male POA. In contrast, in our study, chromatin immunoprecipitation analyses performed in E14 amygdala neuronal cultures revealed no sex differences in H3 or H4 acetylation at the Esr2 promoter. Similarly, studies in the rat hippocampus and cortex have reported higher AcH3 levels in males than females, in a hormone-dependent manner, as testosterone elevated H3 acetylation in these brain regions in females [42]. To date, limited evidence is available regarding the epigenetic regulation of Esr2, particularly in the developing brain. In pathological contexts such as glioblastoma, inhibition of histone deacetylases increases ERβ expression and alters histone acetylation at the ESR2 promoter [43]. Although we did not detect enrichment of H3 or H4 acetylation at the Esr2 promoter, this does not exclude the involvement of other epigenetic mechanisms and highlights the need for further investigation into the sex-specific regulation of Esr2 expression early in development. Our results indicate that sex differences in histone acetylation during early brain development are strongly influenced by developmental stage, brain region, and gene locus. Moreover, the SCC-dependent differences in Hdac expression observed at E14 appear attenuated by PN0. Taken together, these findings support a model in which chromatin-regulatory mechanisms operate in a dynamic and context-specific manner during the process of brain sexual differentiation.
Both in the amygdala and the hypothalamus, sexual dimorphisms occurring prior to the CP have been characterized at the level of gene and protein expression for key neurosteroidogenic enzymes, hormone receptors, and transcription factors [16, 32]. Our findings in these brain regions demonstrate higher expression levels of genes encoding molecules associated with transcriptional repressive mechanisms in XX compared to XY individuals. In contrast, in the cerebral cortex, XY individuals exhibited higher expression levels of Dnmt3b and Dnmt1. Among the four major cellular developmental processes known to be involved in the sexual differentiation, evidence of sex-specific, hormone-mediated regulation of both cell differentiation and cell death has been found [1], whereas neurogenesis/gliogenesis and cell migration normally occur during early development, prior to the organizational action of hormones [2]. In line with this, it has been shown that the development of the cerebral cortex and amygdala in rats involves neurogenesis evident at E16-E18 and E14-E16, respectively, with sex differences reported in the neurogenesis of vasopressin-expressing cells in the amygdala and BNST prior to the critical period [44]. Beyond neurogenesis, early cortical development (E10-E16) is characterized by neuronal migration, in which newly generated neurons migrate to the cortical plate [45]. Likewise, hypothalamic neurogenesis has been described specifically at E13 and E15, when primitive hypothalamic nuclei begin to be distinguished in the rat brain [46]. In addition, results from our laboratory in the hypothalamus of mice at E15 have demonstrated sexually dimorphic SCC-dependent expression of genes involved in the regulation of neuronal differentiation and subtype specification [32, 37, 38]. Although a contribution of sex hormones through neurosteroidogenesis cannot be excluded, previous studies from our laboratory on key enzymes of the neurosteroidogenic pathway found no sex differences in the expression levels of StAR, P450scc, and 5α-reductases I and II, whereas aromatase was the only enzyme showing sexually dimorphic expression levels, which were SCC-dependent in the mouse amygdala at E15 [15]. Taken together, these observations raise the possibility that SCC, through regionally specific epigenetic mechanisms, may be implicated in the programming of these processes prior to the organizational action of sex hormones.
Overall, our findings allow us to propose that before the CP, reduced expression on the gene-silencing machinery may transiently relieve repression at specific loci in the XY brain, thereby facilitating its responsiveness to the testicular testosterone surge. These results support the concept of a mosaic brain organization, in which regional sex differences emerge from the combined action of chromosomal and hormonal factors.
Regarding the methylation analysis performed in this study, the elevated expression of canonical DNA methyltransferases in female amygdala did not result in differences in global 5mC levels between male and female amygdala at E14. This observation aligns with previous findings indicating that the dynamic modulation of DNA methylation depends on the coordinated action of 5mC “writers” (DNMTs) and “erasers” (TETs), which notably exhibit region- and sex-specific expression during the CP [31, 39]. Since gene‑specific regulation may occur even in the absence of global methylation differences, we used a pharmacological approach to investigate whether the sex‑specific expression of Cyp19a1 is controlled by DNA methylation. In agreement with our previous results [15, 16], we showed that male amygdala neuronal cultures exhibit higher Cyp19a1 mRNA levels compared to females. Although zebularine treatment did not produce statistically significant effects on Cyp19a1 expression, a trend was observed toward decreased expression in males and increased expression in females. This directional pattern suggests a potential modulatory role of DNA methylation in the sex-specific regulation of CYP19A1, which could be confirmed through studies with larger sample sizes or direct methylation analyses. In contrast, ChIP analysis revealed a male-specific enrichment of H4 acetylation at the Cyp19a1 promoter in the E14 amygdala, consistent with enhanced transcriptional activity.
This enrichment is consistent with increased transcriptional activity of Cyp19a1 in the male amygdala at E14 and supports the notion that chromatin-level regulation of aromatase is established prior to the perinatal hormonal surge. In contrast, histone H3 acetylation (AcH3) levels do not differ significantly between sexes, indicating a selective involvement of specific histone marks. At the Esr2 promoter, no statistically significant sex differences were detected. Together, these findings support the hypothesis that key genes involved in estrogen signaling are epigenetically programmed during embryonic development, independent of postnatal hormonal influences. The specificity of histone marks and their sex-dependent distribution raise important questions about the upstream factors guiding this regulation—such as differential HDAC expression, sex-linked transcriptional regulators, or extrinsic developmental cues yet to be characterized. While we did not extend histone mark analyses to later postnatal stages, this represents an important direction for future studies aimed at determining the persistence or remodeling of these epigenetic signatures across development.
These chromatin-level analyses were performed in wild-type neuronal cultures, previous work from our laboratory [16] has demonstrated that this model faithfully recapitulates sex differences originally identified in the FCG model. Our findings support a model in which the elevated expression of Hdac2 and Hdac8 in XX amygdala may contribute to promote deacetylation and transcriptional repression of Cyp19a1 promoter, although further studies are needed to confirm this regulatory mechanism.
In summary, our findings demonstrate that SCC actively primes the brain for subsequent developmental events by regulating Hdac and Dnmts expression. This regulation may result in sex-specific histone acetylation at the Cyp19a1 promoter, thereby enhancing aromatase expression in males prior to the onset of the perinatal hormonal surge.
Perspectives and significance
Our results highlight an epigenetic framework through which SCC contributes to the early establishment of sex differences relevant to hormone-dependent brain sexual differentiation. Using the Four Core Genotypes model, we demonstrate that SCC regulates the expression of key epigenetic modifiers during embryonic development, shaping region-specific transcriptional environments prior to the perinatal critical period.
In parallel, we show that male amygdala neurons exhibit increased histone H4 acetylation at the Cyp19a1 promoter and higher aromatase expression before the perinatal critical period. Together, these findings suggest that early SCC-dependent transcriptional programs may converge with sex-dependent chromatin mechanisms to prime the developing brain for subsequent hormonal influences, potentially contributing to sex-biased neurodevelopmental trajectories.
Conclusions
In summary, our findings demonstrate that SCC actively primes region-specific epigenetic landscapes in the developing mouse brain. SCC regulates DNA methylation machinery and histone deacetylases in a region- and sex-specific manner, with XX embryos showing higher expression of repressive modifiers such as Dnmt3a, Dnmt3b, Hdac2, and Hdac8 in the amygdala and hypothalamus. Notably, H4 acetylation at the Cyp19a1 promoter is enriched in male amygdala neurons, facilitating increased aromatase expression in males prior to the perinatal hormonal surge. Together, these results support a model in which sex chromosome-dependent epigenetic mechanisms dynamically may shape gene regulation, establishing early sex differences in transcriptional programs and laying the foundation for subsequent hormone-mediated brain sexual differentiation.
Supplementary Information
Additional file1