An organoid-based evaluation of Bacillus amyloliquefaciens SC06 in alleviating oxidative damage via Wnt signaling
Li Tang, Hao Wang, Qi Wang, Yang Wang, Xiang Li, Fei Wang, Qian Jin, Zihan Zeng, Aikun Fu, Xiaoliang Li, Weifen Li
TL;DR
This study shows how a probiotic, Bacillus amyloliquefaciens SC06, protects gut cells from oxidative damage by activating the Wnt signaling pathway.
Contribution
The study identifies a novel probiotic-Wnt signaling mechanism that protects against oxidative stress in intestinal organoids.
Findings
BaSC06 reduces oxidative stress and apoptosis in intestinal cells.
BaSC06 promotes Paneth cell differentiation and activates the Wnt signaling pathway.
Wnt pathway activation is essential for BaSC06's protective effects.
Abstract
Bacillus amyloliquefaciens SC06 (BaSC06) has emerged as a promising probiotic for improving animal gut health and immuno-protection. However, the underlying molecular mechanisms remain incompletely understood. In this study, we employed porcine intestinal organoids as an ex vivo model and induced oxidative stress using diquat to systematically evaluate the protective effects of BaSC06. We evaluated antioxidant capacity, apoptosis-related markers, intestinal stem cells differentiation markers, and associated signaling pathways. Pretreatment with BaSC06 significantly alleviated oxidative damage by reducing intracellular reactive oxygen species levels and resultant apoptosis. Cellularly, BaSC06 promoted intestinal stem cells proliferation and favored differentiation toward Paneth cells while suppressing differentiation into other epithelial lineages. Mechanistically, these effects were…
Genes, proteins, chemicals, diseases, species, mutations and cell lines named across the full text — each resolved to its canonical identifier and authoritative record.
Click any figure to enlarge with its caption.
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5- —Shandong Provincial Natural Science Foundation
- —the National Natural Science Foundation of China
- —the Natural Science Foundation of Zhejiang province
- —the “Pioneer” and “Leading” key R&D Program of Zhejiang Province
Peer Reviews
No public reviews on file for this paper yet. If you reviewed it on a platform where reviews are public (OpenReview, ICLR, NeurIPS, ICML), you can paste yours below so the community can read it here.
Videos
No videos yet. Explain this paper in a talk, walkthrough, or lecture? Add one.
Taxonomy
TopicsCancer Cells and Metastasis · Polysaccharides and Plant Cell Walls · Wnt/β-catenin signaling in development and cancer
Introduction
Oxidative stress represents a primary and constant threat to the intestinal mucosal barrier. It is a well-recognized disruptor of intestinal barrier function, through multiple mechanisms such as the degradation of tight junction proteins, the induction of pro-inflammatory cytokines, and the reduction of microbial diversity [1]. In recent years, a growing body of evidence suggests that probiotics can mitigate oxidative stress-induced intestinal injury by modulating oxidative stress-related signaling cascades, regulating immune responses, restoring the activity of antioxidant enzymes, improving intestinal architecture, and remodeling gut microbiota composition [2–4].
Central to the development of mucosal injury is the damage to both intestinal stem cells (ISCs) and intestinal epithelial cells (IECs). The intestinal mucosa, composed of the muscularis mucosae, lamina propria, and a single layer of epithelial cells, is essential for nutrient absorption, digestion, and immune defense. These functions depend on the continuous self-renewal of IECs, which are derived from ISCs located at the base of intestinal crypts [5, 6]. ISCs first give rise to transit-amplifying (TA) progenitor cells, which proliferate and migrate along the crypt–villus axis, subsequently differentiating into various specialized epithelial lineages. Secretory progenitors develop into Paneth cells, goblet cells, and enteroendocrine cells, whereas absorptive progenitors differentiate into enterocytes [7]. Differentiated IECs ultimately reach the villus tip, undergo apoptosis, and are replaced by new cells, underscoring the importance of a tightly regulated balance between ISCs proliferation, differentiation, and epithelial turnover [8].
The ISCs niche is critical for maintaining this balance, comprising a dynamic microenvironment formed by adjacent epithelial, stromal, and microbial elements within the intestinal crypts [9]. Previous studies have highlighted the ability of probiotics to regulate ISCs behavior, particularly by modulating their proliferation and differentiation [10, 11] to maintain epithelial integrity and barrier function. However, the traditional two-dimensional (2D) in vitro systems fail to replicate the complex architecture and multicellular interactions of the intestinal epithelium. The development of three-dimensional (3D) intestinal organoids by Sato et al. in 2009 revolutionized the field, providing a physiologically relevant ex vivo model that faithfully recapitulates the cellular composition and spatial organization of the native intestine [12]. This system supports the long-term maintenance of all intestinal epithelial cell types, including stem cells, enterocytes, goblet cells, enteroendocrine cells, Paneth cells, and progenitor cells. Homeostasis within intestinal organoids mirrors that of the native epithelium, characterized by balanced self-renewal, lineage-specific differentiation, and sustained regenerative capacity [13]. As such, intestinal organoids serve as a robust in vitro model for studying epithelial architecture, cell-cell interactions, and stem cell dynamics under physiological and pathological conditions [14].
While Bacillus amyloliquefaciens SC06 (BaSC06) has been well recognized as a promising probiotic strain for enhancing intestinal morphology, preserving barrier integrity, and ameliorate mucosal injury [15–18], the precise molecular mechanisms remain incompletely understood. This study employed a reliable porcine intestinal organoid (PIO) model to evaluate the protective capacity of BaSC06 against oxidative stress mimicked by diquat. We systematically assessed the impact of BaSC06 on reactive oxygen species (ROS) level, epithelial barrier integrity, ISCs proliferation, and lineage specification to further elucidate the underlying cellular signaling pathways involved.
Materials and methods
Culture of BaSC06 strain and Porcine intestinal organoids
The BaSC06 strain was cultured as previously described by Tang et al. [19]. Porcine intestinal organoids were generated from the ileum of piglets according to the method previously reported by Sato et al. [12]. Briefly, to isolate intestinal crypts, the dissected small intestines were cut into small pieces and washed repeatedly with ice-cold DPBS until the supernatant was clear. The tissue fragments were then incubated in DPBS containing 2.5 mM EDTA for 30 min on ice. Following vigorous vortexing, the suspension was passed through a 70 μm cell strainer, and the crypt-enriched fraction was collected by centrifugation at 290 × g for 5 min. The isolated crypts were embedded in Matrigel (Corning, USA), plated into a 24-well plate, and cultured in IntestiCult™ Organoid Growth Medium (Stemcell Technologies, Canada) following Matrigel polymerization. To establish an oxidative stress model, organoids were treated with 950 µM Diquat (DQ) for 6 h, based on a previously established protocol [19]. For the experiment, organoids were divided into four treatment groups: Control, cultured in basic medium; DQ, treated with 950 µM DQ for 6 h; Ba + DQ: Pretreated with BaSC06 (1 × 10⁸ CFU/mL) for 6 h, followed by co-incubation with 950 µM DQ for an additional 6 h; Ba, treated with BaSC06 (1 × 10⁸ CFU/mL) for 6 h. In the Ba + DQ group, organoids were pretreated with BaSC06 for 6 h, followed by a thorough washing procedure to remove the bacteria and replacement with fresh, bacteria-free medium before DQ was introduced.
Western blotting
To obtain protein samples, the matrix gel was first stripped using ice-cold PBS and the intestinal organoids were collected after being washed twice with ice-cold PBS. After five minutes of centrifugation at 200 × g, the supernatant was discarded. The cell pellet was mixed with RIPA lysate, and the next procedure was carried out in accordance with Tang et al. [19]. Protein concentrations were determined using a BCA assay kit (Biotime Biotechnology, Xiamen, China). Equal amounts of protein (10 µg) were separated by SDS - PAGE, transferred to PVDF membranes (Merck Millipore, Burlington, MA, USA), and blocked with 5% non-fat milk for 1 h at room temperature. Membranes were incubated with primary antibodies overnight at 4 ℃, followed by goat anti-mouse / goat anti-rabbit HRP-conjugated secondary antibodies (1:5,000) for 1 h at room temperature.
Primary antibodies against GAPDH were acquired from Huabio (Hangzhou, China). Antibodies against Bax, Caspase 3 and Caspase 9 were acquired from CST (Danvers, USA). Anti-Claudin-1, anti-Occludin, anti-β-catenin and anti-BMI-1 antibodies were obtained from Abcam (Cambridge, UK). All primary antibodies were used at the dilutions recommended by the manufacturers. Protein bands were detected using an enhanced chemiluminescence (ECL) system and quantified with ImageJ, with GAPDH as the loading control.
Detection of caspase-3 activity
Caspase-3 activity in porcine intestinal organoids (PIOs) was measured using a Caspase-3 Activity Assay Kit (Beyotime, Shanghai, China) according to the manufacturer’s instructions. After the indicated treatments, organoids were released from Matrigel, washed with ice-cold PBS, and collected by centrifugation. The pellets were lysed using the lysis buffer provided in the kit, and the supernatants were used for activity measurement. Caspase-3 activity was normalized to total protein content and expressed as the percentage relative to the control group.
ROS generation analysis
To prepare single-cell suspensions, intestinal organoids were dissociated using a cell dissociation reagent (e.g., TrypLE™, Millipore) by incubating them at 37 °C for 25 min. Intracellular ROS levels in the resulting single cells were then measured using a Reactive Oxygen Species Assay Kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer’s instructions. The assay quantifies ROS generation based on the 2’,7’-dichlorofluorescin diacetate (DCFH-DA) method.
Detection of antioxidant capacities
To assess the antioxidant capacity, intestinal organoids were harvested and lysed. The resulting lysates were used to quantify key oxidative stress markers. Specifically, the concentration of malondialdehyde (MDA), an indicator of lipid peroxidation, and the enzymatic activities of superoxide dismutase (SOD) and catalase (CAT) were measured. All assays were performed using commercial kits from the Nanjing Jiancheng Bioengineering Institute (Nanjing, China) according to the manufacturer’s protocols.
Flow cytometry analysis
After the single-cell suspensions of intestinal organoids were prepared, the resulting cell pellet was resuspended in 1× Annexin Binding Buffer. To quantify apoptosis, cells were then stained with 5 µL of Annexin V-FITC and 5 µL of Propidium Iodide (PI) for 15 min at room temperature in the dark, according to the kit manufacturer’s protocol. Stained cells were immediately analyzed using an FC500 flow cytometer (Beckman Coulter, Brea, CA, USA).
Organoid growth and morphological analysis
To evaluate the effects of the treatments on organoid development, organoids were cultured for up to 7 days. At specified time points (days 3, 5, and 7), bright-field images were captured using an Olympus inverted microscope. The following morphological parameters were quantified using ImageJ software: (1) the number of viable organoids, and (2) the number of buds per organoid. The organoid formation rate was calculated as the percentage of initially seeded crypts that successfully developed into organoids by day 7.
Quantitative real-time PCR analysis and RNA extraction
To obtain RNA samples, the matrix gel was first stripped using ice-cold PBS and the intestinal organoids were collected after ice-cold PBS washed twice in a 15 mL centrifuge tube. To extract total RNA, the cell pellet was treated with RNAiso plus. The test methods used were consistent to those described by Tang et al. [19]. In this study, the mRNA abundance was determined by applying the 2^−ΔΔCt^ method. A detailed list of primers is provided in Table 1.
Table 1. The primers used in the studyGeneAccess No.Primers SequenceLength GAPDH NM_001206359.1F: CGGAGTGAACGGATTTGGC248R: CACCCCATTTGATGTTGGCG Caspase-3 NM_214131F: CGAGGCACAGAATTGGACTG129R: CCAGGAATAGTAACCAGGTGCTG Caspase-9 NM_001031779F: ACCAGGTCGGAATTGAAGGAC82R: GCAAGGTCATGTCATCATCCAG Bax XM_003127290F: CTACCAAGAAGTTGAGCGAGTGTCTC91R: GTGTCCACGGCTGCGATCATC ASCL2 NM_001122991.1F: CTGACCAAGGGCTAGTGTGG131R: CTCGTCAAGCCTCCAAGTGT OLFM4 XM_003482903.4F: CCCTGAAAGAAACCTGGGCT97R: CATCGTTCCAGGTGCCAGTA Lgr5 NM_001315762F: CCTTTGTAGGCAACCCTTCT161R: GCTCGCTGTTCCAGTCAAAT MKI67 NM_001101827.1F: TTGTCCCTGAATCCGCAAGA83R: TTCTCTGGTTGCTTGGTTGC PCNA NM_001291925.1F: GCCACTCCACTCTCTCCTAC193R: GCATCACCGAAGCAGTTCTC Lyz1 NM_214392.2F: CTCGCAGTACATTCGGGGTT158R: ACCTTATGCTCTTGCTTCGGT MMP7 NM_001348795.1F: ACAGGCTCAGGGCTATCTCA208R: TGGCTGGCTTGGGAATAGTG MUC2 XM_021082584.1F: CGGTCAAGGACGACACCATC156R: TGTTCCACACGAGAGCAAGG TFF3 NM_001243483.1F: AGTCATGCTCGCTCCCTTTT175R: TTGCTTCTCAAGGGTCACGG Clca1 NM_214148.3F: GGCTCCTGGGGATGATTACG139R: GTTGGCCTCCTTTGGGATGA CHGA NM_001164005.2F: CGAGGTCATCTCTGACACGC89R: GGATCCGTTCATCTCCTCGG CHGB NM_214081.2F: TCATCTTGCCTTCCGTCCAC229R: AGCATTGGACTTCGACAGGG TAC1 XM_005667633.3F: GATGTTATGCGCACGGACG159R: GCCGGCGCGCTATTTATTC FABP-1 NM_001004046F: CGGAAATCGTGCAGAATGGG93R: CACACTCCTCTCCCAAGGTG EPCAM NM_214419F: CCATGTGCTGGTGTGTGAAC83R: GGTCCTCACTCGCTCCAAAC KRT20 XM_003131462F: CACAGTGAGCACGGAAGAGT69R: CTCTGGTAGGTGCGTCTGTG Claudin-1 NM_001244539.1F: TGCCCCCGAAAAACAACATC295R: CACATGAAAATGGCTTCCCTC ZO-1 XM_021098896F: CTCTTGGCTTGCTATTCG197R: AGTCTTCCCTGCTCTTGC β-catenin NM_214367.1F: GAGCTGAGAGCGAGGGGAG242R: ACAGCCGCTTTTCTGTCTGG Cyclin D1 XM_021082686.1F: TTGAAGGCGAGGTTCCAGTC163R: GCTGGTTCTCTAGGTCAGCC SOX9 NM_213843.2F: CGAGCAAGAATAAGCCGCAC263R: GCCGTTCTTCACCGACTTTC Wnt3a XM_021066826.1F: CTGGAGACATCCGAGAACCA251R: AACTTCACACCTTCAGCCACA c-Myc NM_001005154.1F: TCCACGCACCAGCACAATTA174R: ATTGTGTGTCCGCCTCTTGT BMI-1 NM_001285971.1F: TCTGCAGCTCGCTTCAAGATG84R: CGGGCGGAAAAGACAATGAAA
Statistical analysis
All data are presented as the mean ± standard deviation (SD) from at least three independent experiments. Statistical differences between groups were determined using a one-way analysis of variance (ANOVA) followed by Tukey’s post hoc test for multiple comparisons. All statistical analyses were performed using SPSS Statistics version 23.0 (IBM Corp., Armonk, NY, USA). Figures were generated using GraphPad Prism 9.0 (GraphPad Software, San Diego, CA, USA. Image analysis was performed with ImageJ software. A P-value < 0.05 was considered statistically significant. Significance levels are denoted as follows: *P < 0.05, **P < 0.01, ***P < 0.001, and ns (not significant, P > 0.05).
Results
BaSC06 attenuates DQ-Induced apoptosis and tight junction disruption
To investigate whether BaSC06 confers protective effects against oxidative stress-induced epithelial injury, we first evaluated its impact on the morphological development and barrier function of PIOs exposed to diquat (DQ), a known oxidative stress inducer. The results demonstrated that DQ exposure markedly impaired PIO development, significantly reducing the organoid formation rate (P < 0.001) (Fig. 1A and B), and budding number (P < 0.001) (Fig. 1A and C) compared to the control group (Ctr). Notably, the statistical comparison revealed that BaSC06 pretreatment (Ba + DQ group) significantly increased both the organoid formation rate (P < 0.01) and the budding number (P < 0.05) relative to the DQ group (Fig. 1B and C).
Fig. 1. BaSC06 displayed significant protective effects against Diquat-induced damage in porcine intestinal organoids. A Time-course morphological analysis of intestinal organoids cultured for 7 days in Control (Ctr), Diquat (DQ), BaSC06 (Ba), or BaSC06 + DQ (Ba + DQ) groups. Scale bars = 200 μm. Quantification of organoid development on day 7, showing the organoid survival rate B and the average number of buds per organoid C. D, E Western blot analysis and corresponding quantification of apoptosis (Caspase-3, Caspase-9, and Bax) and tight junction (Claudin-1) protein levels, normalized to GAPDH. F, G qRT-PCR analysis of the relative mRNA expression of tight junction genes (Claudin-1,* Occludin*, and ZO-1) and apoptosis genes (Caspase-3,* Caspase-9*, and BAX). H Caspase-3 enzymatic activity measured and expressed as fold change relative to the control group. Data are presented as mean ± SD from three independent experiments. Statistical analysis was performed using one-way ANOVA with Tukey’s test. ns, not significant; *P < 0.05; **P < 0.01; ***P < 0.001
Western blot analysis (Fig. 1D, E) revealed that exposure to DQ significantly upregulated the protein levels of the pro-apoptotic markers Caspase-3, Caspase-9, and Bax, while concurrently downregulating the tight junction protein Claudin-1, relative to the control group. Notably, pretreatment with BaSC06 (Ba + DQ group) significantly attenuated the DQ-induced upregulation of these apoptotic proteins and markedly rescued the expression of Claudin-1. These protein-level findings were corroborated by gene expression analysis by RT-qPCR, which demonstrated that DQ treatment caused a significant transcriptional downregulation of the tight junction genes Claudin-1, Occludin, and ZO-1 (Fig. 1F), and the mRNA levels of pro-apoptotic genes Caspase-3, Caspase-9, and Bax were significantly elevated (Fig. 1G). Meanwhile, these DQ-induced gene expression changes at protein- and mRNA- levels were significantly mitigated by the protreatment with BaSC06 (Ba + DQ group). Importantly, functional assessment of apoptotic execution using a Caspase-3 activity assay demonstrated that DQ treatment significantly increased Caspase-3 enzymatic activity, whereas BaSC06 pretreatment markedly reduced this increase, restoring activity levels toward those of the control group (Fig. 1H). Taken together, these results indicate that BaSC06 pretreatment attenuated apoptosis-related signaling and barrier disruption induced by DQ.
BaSC06 pretreatment significantly alleviated DQ-induced oxidative stress and apoptosis in PIOs
Flow cytometry analysis (Fig. 2A) demonstrated that DQ treatment substantially increased apoptosis, as indicated by higher Annexin V-FITC/PI staining, while BaSC06 pretreatment significantly reduced the apoptosis rate (P < 0.01) (Fig. 2B). Additionally, DQ treatment led to a marked increase in ROS production, as evidenced by DCFH-DA staining (Fig. 2C), which was significantly reversed by BaSC06 pretreatment (P < 0.001) (Fig. 2D). In addition, BaSC06 pretreatment also significantly reduced the level of malondialdehyde (MDA), a major product of oxidative damage, compared to the DQ group (P < 0.05) (Fig. 2E). Critically, BaSC06 did not increase superoxide dismutase level (SOD) (Fig. 2F), and significantly enhanced catalase (CAT) activity (P < 0.01) (Fig. 2G). These results indicate that BaSC06 mitigates DQ-induced oxidative stress and apoptosis in PIOs, potentially through enhancement of the cellular antioxidant defense system.
Fig. 2. BaSC06 mitigates Diquat-induced oxidative stress via enhancement of intracellular catalase activity A Representative flow cytometry dot plots of organoids stained with Annexin V-FITC and Propidium Iodide (PI) to assess apoptosis. Q1: Necrotic cells (PI+/Annexin V-); Q2: Late apoptotic/necrotic cells (PI+/Annexin V+); Q3: Early apoptotic cells (PI-/Annexin V+); Q4: Live cells (PI-/Annexin V-). B Quantification of the total percentage of apoptotic cells (early + late; Q2 + Q3) from the flow cytometry analysis in A. C Representative flow cytometry histograms showing intracellular ROS levels, as detected by the fluorescent probe DCFH-DA. D Quantification of ROS production, specifically superoxide anions, measured by the DHE probe and expressed as a percentage of the control. E Concentration of malondialdehyde (MDA), a marker of oxidative damage. Assessment of antioxidant capacity in organoid lysates: F Enzymatic activity of Superoxide Dismutase (SOD); G Enzymatic activity of Catalase (CAT). All experimental groups are labeled: Control (Ctr), Diquat (DQ), BaSC06 (Ba), and BaSC06 pretreatment with DQ challenge (Ba + DQ). Data are presented as the mean ± SD (n = 3). Statistical significance was determined by one-way ANOVA with Tukey’s post hoc test. ns, not significant; *P < 0.05; **P < 0.01; ***P < 0.001
BaSC06 regulated differentiation and proliferation of ISCs
To investigate the effects of BaSC06 on DQ-induced impairments in cellular homeostasis, we evaluated key markers of proliferation and differentiation at the transcriptional and protein levels. First, we assessed the expression of genes associated with proliferation. RT-qPCR analysis revealed that DQ treatment significantly downregulated the mRNA levels of proliferation-associated markers, including Ascl2,* Olfm4*,* Lgr5*,* MKI67*, and PCNA, compared to the control group (Fig. 3A; P < 0.01 or P < 0.001). Pretreatment with BaSC06 (Ba + DQ group) significantly ameliorated this inhibitory effect, restoring the expression of these genes. Meanwhile, DQ exposure induced a significant upregulation of a broad panel of differentiation-related genes (Fig. 3B; P < 0.01 or P < 0.001), suggesting it promoted ISCs differentiation into different cell types. This effect was effectively suppressed by pre-administration of BaSC06 (Ba + DQ), which normalized the expression of these marker genes towards control levels.
Fig. 3. BaSC06 preserves intestinal stem cells (ISCs) function by modulating the Wnt/β-catenin signaling pathway against oxidative stress. A qRT-PCR analysis of the relative mRNA expression levels of key ISCs (Ascl2,* Olfm4*, and Lgr5) and proliferation markers (MKI67 and PCNA). B qRT-PCR analysis of the relative mRNA expression levels of genes associated with various differentiated intestinal epithelial cell lineages, including, Paneth cells marker genes (Lyz1 and MMP7), Goblet cell marker genes (MUC2, TFF3 and CLCA1), enteroendocrine cell marker genes (CHGA,* CHGB* and TAC1), and intestinal epithelial cell marker genes (FABP-1,* EPCAM* and KRT20). (C, D) Western blot analysis and corresponding densitometric quantification of the protein levels of the stem cell factor BMI-1 and the key Wnt signaling mediator β-catenin. GAPDH was used as the internal loading control. E qRT-PCR analysis of the relative mRNA expression of core Wnt/β-catenin signaling pathway components and target genes (β-catenin,* Cyclin-D1*,* Sox9*, and Wnt3a). All organoids were treated under four conditions: Control (Ctr), Diquat (DQ), BaSC06 (Ba), and BaSC06 pretreatment with DQ challenge (Ba + DQ). Data are presented as the mean ± SD (n = 3). Statistical significance was determined by one-way ANOVA with Tukey’s post hoc test. ns, not significant; *P < 0.05; **P < 0.01; ***P < 0.001. n = 9 per group
To elucidate the molecular mechanism underlying these observations, we examined the Wnt/β-catenin signaling pathway, a critical regulator of both proliferation and differentiation. Western blot analysis demonstrated that DQ treatment markedly reduced the protein levels of β-catenin and its downstream target BMI-1 (Fig. 3C and D; P < 0.05). This reduction was significantly rescued in the Ba + DQ group. Consistent with these protein-level changes, RT-qPCR results showed that DQ suppressed the transcription of key Wnt pathway components, including β-catenin, Cyclin-D1, Sox-9, and Wnt3a (Fig. 3E; P < 0.001). BaSC06 co-treatment robustly reversed the DQ-induced downregulation of these genes, restoring their expression to levels comparable with or exceeding the control group.
These results suggest that BaSC06 mitigates DQ-induced cellular damage by promoting cell proliferation and inhibiting excessive differentiation. This protective effect is closely linked to the activation of the Wnt/β-catenin signaling pathway.
ICG-001 reverses the protective effects of BaSC06 against DQ-Injured damage
To confirm the pivotal involvement of Wnt/β-catenin signaling, we examined the effects of its inhibitor ICG-001 (ICG) in PIOs. As shown by bright-field microscopy, organoids of Ctr group displayed a healthy, budding morphology, whereas DQ treatment led to severe structural disruption. Pretreatment with BaSC06 partially rescued this damage. However, the addition of ICG completely abrogated the protective effect of BaSC06, resulting in a disrupted morphology similar to that of the DQ-treated group (Fig. 4A). Quantitative analysis confirmed these morphological observations. DQ treatment significantly decreased the percentage of budding organoids and increased the percentage of disrupted organoids compared to the control group (P < 0.001). BaSC06 pretreatment significantly reversed these effects (P < 0.001 and P < 0.01, respectively). Notably, the addition of ICG significantly diminished the percentage of budding organoid compared to the DQ + Ba group (P < 0.05) (Figs. 4B).
Fig. 4ICG abrogates the protective effects of BaSC06 against Diquat-induced damage by inhibiting the Wnt/β-catenin pathway. A Representative bright-field microscopy images of intestinal organoids from four treatment groups: Control (Ctr), Diquat (DQ), DQ + BaSC06 (DQ + Ba), and DQ + BaSC06 + ICG (DQ + Ba+ICG). Scale bars = 200 μm. B Percentage of building organoids with complex, budding structures. C Representative dot plots of Annexin V-FITC/PI flow cytometry comparing apoptotic cell populations between the DQ + Ba and DQ + Ba+ICG groups. D Quantification of the total percentage of apoptotic cells (early + late). Western blot analysis of protein expression in the DQ + Ba and DQ + Ba+ICG groups: E Representative blots for β-catenin and apoptosis-related proteins (Bax, Caspase-3, and Caspase-9). GAPDH served as the internal loading control. F Densitometric quantification of the protein bands, normalized to GAPDH. G Caspase-3 enzymatic activity measured and expressed as fold change relative to the DQ + Ba group. RT-qPCR analysis of relative mRNA expression levels in the DQ + Ba and DQ + Ba+ICG groups: H Expression of apoptosis-related genes (Caspase-3, Caspase-9, Bcl2 and Bax) and the tight junction gene Occludin. I Expression of proliferation markers (MKI67, PCNA), and (J) Expression of Wnt signaling and stemness-related genes (β-catenin, Wnt3a, BMI). Data are presented as the mean ± SD (n = 3). Statistical significance was determined by one-way ANOVA with Tukey’s post hoc test for panels B and C, and by an unpaired t-test for panels E and G-J. ns, not significant; *P < 0.05; **P < 0.01; ***P < 0.001. n = 9 per group
To determine whether apoptosis was involved in the ICG-mediated reversal, we performed Annexin V-FITC/PI flow cytometry. The results indicated that the percentage of total apoptotic cells was significantly higher in the DQ + Ba+ICG group compared to the DQ + Ba group (12.5% vs. 6.19%, P < 0.01) (Fig. 4C and D). This suggests that ICG counteracts the protective effect of BaSC06 by inducing apoptosis.
Western blot analysis revealed that protein levels of the pro-apoptotic factors Bax, Caspase-3, and Caspase-9 were significantly upregulated in the DQ + Ba+ICG group relative to the DQ + Ba group. Conversely, the protein level of β-catenin was markedly downregulated (Fig. 4E and F, P < 0.01 or P < 0.001). Consistently, Caspase-3 activity assays showed a significant increase in enzymatic activity in the DQ + Ba+ICG group compared with the DQ + Ba group (Fig. 4G). These findings were corroborated at the transcriptional level by qRT-PCR, which showed significantly increased mRNA expression of Bax,* Caspase-3*, and Caspase-9, and decreased expression of the tight junction gene Occludin, in the presence of ICG. The expression of the anti-apoptotic gene Bcl2 was not significantly altered (Fig. 4H).
Finally, we examined the impact of inhibition of the Wnt/β-catenin pathway on cell proliferation by measuring the expression of relevant markers. qRT-PCR analysis showed that ICG treatment significantly downregulated the mRNA levels of proliferation markers MKI67 and PCNA (P < 0.05) (Fig. 4I). To confirm the inhibition effect of ICG, we detected the expression of key Wnt/β-catenin pathway components, including β-catenin, Wnt3a, and BMI, and their mRNA levels were significantly suppressed in the DQ + Ba+ICG group compared to the DQ + Ba group (Fig. 4J). Collectively, these results demonstrate that the inhibition of Wnt/β-catenin signaling by ICG abolishes the protective effects of BaSC06 by promoting apoptosis and suppressing proliferation in DQ-damaged organoids.
Discussion
BaSC06 has exhibited considerable potential for promoting animal gut health and immune protection [16, 18, 20, 21]. By providing new evidence from porcine intestinal organoid, our study provides systematic evidence for the protective effects of BaSC06 in a DQ-injured organoid model. We demonstrate that BaSC06 employs a multifaceted strategy that includes alleviating oxidative stress, inhibiting apoptosis, and preserving the integrity of the intestinal barrier. Crucially, our data suggest that these protective effects are mediated by the activation of the Wnt/β-catenin signaling pathway, which robustly promotes the proliferation of ISCs and restores intestinal homeostasis.
Diquat, a well-known inducer of oxidative stress, primarily exerts its toxic effects through the generation of ROS. Our study confirmed that DQ treatment significantly elevated intracellular ROS levels and led to the accumulation of the lipid peroxidation product MDA, which are highly consistent with the observed apoptosis and morphological disruption of the organoids (Figs. 1 and 2). Oxidative stress is a key upstream trigger for apoptosis, where excessive ROS can directly damage mitochondria, initiating the intrinsic apoptotic pathway mediated by Caspase-9 and the executioner Caspase-3. Indeed, our results demonstrated a significant upregulation of Bax, Caspase-9, and Caspase-3 expression following DQ treatment, validating this classical pathway. Pretreatment with BaSC06 markedly reversed this cascade, evidenced by reduced ROS and MDA levels and a bolstered intrinsic antioxidant defense system via enhanced CAT activity (Fig. 2). This indicates that the protective effect of BaSC06 primarily originates from its potent antioxidant activity, which blocks the oxidative stress cascade at its source, thereby effectively mitigating downstream apoptosis. While these findings align with previous reports on the protective effects via antioxidant action, our study provides direct evidence for this function of BaSC06 in a more physiologically relevant 3D organoid model.
The integrity of intestinal barrier is a cornerstone of gut health, with tight junction proteins such as Claudin-1 and Occludin serving as its pivotal molecular components. Our study found that DQ-induced oxidative stress severely compromised barrier function, evidenced by the significant downregulation of Claudin-1 and Occludin (Figs. 1 and 4). BaSC06 effectively restored the expression of these tight junction proteins, suggesting it can stabilize intercellular junctions, either directly or indirectly, to maintain barrier integrity. This effect is closely intertwined with the inhibition of apoptosis, as extensive cell death inherently leads to physical breaches in the barrier. Furthermore, this study reveals the regulatory role of BaSC06 on ISCs behavior. The rapid renewal and repair of the intestinal epithelium depend on a delicate balance between the proliferation and differentiation of Lgr5^+^ ISCs residing at the crypt base. Our data show that DQ treatment significantly suppressed the expression of ISCs markers, including Lgr5, Ascl2, and Olfm4, as well as proliferation markers like MKI67 and PCNA, while paradoxically promoting the expression of differentiation-related genes (Fig. 3). This suggests that DQ not only induces cytotoxicity but also compromises the regenerative potential of the epithelium, potentially leading to stem cell exhaustion and premature differentiation. The intervention with BaSC06 strikingly reversed this trend, restoring the expression of ISCs proliferation markers while curbing excessive differentiation. This demonstrates that the action of BaSC06 extends beyond passive cytoprotection to actively promoting the tissue’s potential for regeneration and repair, which is critical for restoring severely damaged intestines.
One of the most significant findings of this study is the identification of the Wnt/β-catenin signaling pathway as a central mediator of the protective effects of BaSC06. The Wnt/β-catenin pathway is a critical regulator of ISCs self-renewal and proliferation. Our results showed that DQ treatment significantly suppressed the expression of the key protein β-catenin and its downstream targets, such as BMI-1 and Cyclin-D1 (Fig. 3), which aligns perfectly with the observed inhibition of proliferation. This indicates that the detrimental effect of DQ on ISCs is, at least in part, mediated through the inhibition of the Wnt pathway. Importantly, pretreatment with BaSC06 effectively restored the activity of this signaling pathway. Interestingly, multiple Lactobacillus strains can also ameliorate intestinal injury and oxidative stress by activating the Wnt signaling pathway, which stimulates the proliferation and differentiation of ISCs [22, 23]. To ascertain that the activation of this pathway was a prerequisite for the protective effects of BaSC06, rather than a mere correlation, we introduced its specific inhibitor, ICG-001. The results were compelling: the addition of ICG-001 almost completely abrogated all of the protective effects of BaSC06, including the restoration of organoid morphology, inhibition of apoptosis, and promotion of proliferation (Fig. 4). The organoids reverted to a state of severe apoptosis and growth arrest, with a phenotype similar to that of the DQ-treated group. These findings indicate that activation of the Wnt/β-catenin pathway is a key mechanism underlying the pro-proliferative effects of BaSC06 in this organoid model. Although we did not directly investigate the link between antioxidant activity and Wnt pathway activation, previous studies have suggested that oxidative stress can suppress Wnt signaling [24–26]. It is therefore plausible that BaSC06, through its antioxidant properties, creates a favorable cellular microenvironment that permits the stabilization and nuclear translocation of β-catenin for Wnt pathway activation. However, a limitation of this study is that it does not elucidate how BaSC06 activates the Wnt pathway in organoids—through direct cellular contact or via its secreted products. Clarifying the precise mechanism will be an important objective for our future investigations.
Conclusion and limitations
In conclusion, this organoids-based study delineates two major protective mechanisms by which BaSC06 alleviates oxidative stress-induced injury. BaSC06 first mitigates cellular damage and apoptosis by scavenging ROS through its intrinsic antioxidant capacity. More importantly, it activates the Wnt/β-catenin signaling pathway, which effectively promotes intestinal stem cell proliferation and inhibits aberrant differentiation, thereby contributing to the preservation of the the regenerative capacity and integrity of the intestinal epithelium (Fig. 5). While this study demonstrated that BaSC06 holds great promise as a functional additive to mitigate oxidative stress-induced intestinal injury, its therapeutic efficacy must be validated in future in vivo models.Future research should be directed towards validating the efficacy and safety of BaSC06 in in vivo animal models and further exploring the specific molecular targets of its interaction with the Wnt/β-catenin pathway to provide a more robust theoretical foundation for its clinical translation.
Fig. 5. Schematic model of the protective mechanism of BaSC06 against ROS. The accumulation of reactive oxygen species (ROS) compromises intestinal epithelial homeostasis by degrading the physical barrier, inducing apoptosis, and depleting critical cell populations such as intestinal stem cells (ISCs). This damaging cascade is mediated by the suppression of the Wnt/β-catenin pathway, a signaling cascade essential for ISC self-renewal and epithelial regeneration. BaSC06 counteracts this pathology through a dual mechanism: firstly, it alleviates oxidative stress by upregulating intracellular catalase, which in turn inhibits apoptosis and ameliorates barrier dysfunction; secondly, BaSC06 reactivates the canonical Wnt/β-catenin pathway, thereby enhancing the survival and proliferation of ISCs and preserving the regenerative potential of the epithelium. Ultimately, ISCs can re-establish the intestinal barrier integrity and homeostasis when ROS level is decreased
Supplementary Information
Supplementary Material 1. The raw data is provided in the supplementary files (S1, S2 and S3).
The reference list from the paper itself. Each links out to its DOI / PubMed record.