Diagnosis of Betanodavirus Infection in the Gonad of Greater Amberjack Broodstocks Shows a Sex-Biased Infection and Immune Responses
L. Cervera, D. Álvarez-Torres, M. Barreto-Bailet, J. Béjar, A. Cuesta, M. V. Martín, S. Jerez, E. Chaves-Pozo
TL;DR
This study shows that a fish virus infects both male and female fish, but their immune responses differ, with males showing stronger reactions in their testes.
Contribution
A non-lethal method for diagnosing NNV in fish gonads and revealing sex-biased immune responses in infected greater amberjack.
Findings
NNV is present in similar proportions in the blood and gonads of both male and female greater amberjack.
Infected males showed up-regulated immune genes in the testes, while infected females showed no immune changes in the ovaries.
High estradiol levels in infected females may help combat the virus.
Abstract
Knowledge about fish-pathogen interaction is essential for optimizing technical and biological aspect of culture techniques to guarantee the economic viability of the aquaculture production. Nodavirus (NNV) is one of the most prevalent viruses worldwide causing disease in more than 170 species. In this study, we aimed to develop a non-lethal method to diagnose NNV in the gonad of asymptomatic broodstock specimens of greater amberjack (Seriola dumerili) using a RTG cell line expressing the luciferase reporter gene under the control of the Mx promoter (RTG-pmx-luciferase system) and real-time PCR. We also characterize the immune response and reproductive health of both sexes by means of gene expression and functional parameters analysis. Our data showed that NNV is present in both male and female blood and gonads in similar proportions demonstrating that both sexes might develop…
Genes, proteins, chemicals, diseases, species, mutations and cell lines named across the full text — each resolved to its canonical identifier and authoritative record.
Click any figure to enlarge with its caption.
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5- —Consejo Superior de Investigaciones Cientificas (CSIC)
Peer Reviews
No public reviews on file for this paper yet. If you reviewed it on a platform where reviews are public (OpenReview, ICLR, NeurIPS, ICML), you can paste yours below so the community can read it here.
Videos
No videos yet. Explain this paper in a talk, walkthrough, or lecture? Add one.
Taxonomy
TopicsVirology and Viral Diseases · Aquaculture disease management and microbiota · Amphibian and Reptile Biology
Introduction
The rapid development of aquaculture is bringing about severe difficulties such as the outbreak of viral infections that produce high mortalities rates and economic losses for producers [1]. Betanodavirus, or nervous necrosis virus (NNV), is a non-enveloped RNA virus composed by two molecules of single-stranded positive-sense RNA, RNA1 and RNA2, which codifies for RNA-dependent RNA-polymerase (RdRp or protein A) and capsid protein (Cp) [2]. NNV causes the viral encephalopathy and retinopathy (VER) disease which has been described to affect to 177 fish species, a number that is continuously increasing [2]. Amongst the species infected by NNV, differences in susceptibility have been described pointing to susceptible and resistant species to the infection [3]. NNV is widely distributed worldwide but the different genotypes described show geographic distribution according to water temperature [2].
Thus, the prevalence of NNV threaten the viability of the emerging fish reared worldwide because of the lack of knowledge about NNV-host interaction, which is crucial to prevent or combat harmful natural outbreaks in fish farms. In addition, NNV can be transmitted both horizontally and vertically [2], colonizing the gonad and being transmitted to their brood inducing high mortality rates during larval development [4]. Therefore, proper diagnostics of the presence of NNV during the broodstock selection is essential to start an industrial culture, as for the greater amberjack (Seriola dumerili), an incipient culture in Spain with positive prospects [5]. Although the susceptibility of this species to parasites has been widely described [6], as far as we are concerned, the literature relating greater amberjack and NNV is very limited. Red-spotted-grouper nervous necrosis virus (RGNNV) has only been detected in wild asymptomatic greater amberjack specimens in Greek and Japanese coasts [7–10]. In addition, the available information about the anti-viral immune response of the greater amberjack is restricted to one study in which the modulation of piscidins upon poly I: C stimulation, which imitate a viral infection, has been described [11]. This finding points to a role of antimicrobial peptides (AMPs) upon viral infection in amberjack as demonstrated in other fish species [12]. Unfortunately, up to date, no studies have inquired in the immune response triggered by NNV in greater amberjack.
In our facilities, annual record analyses showed sporadic mortalities in amberjack larvae batches due to presumptive viral disease, sometimes with symptoms and behavior compatible with NNV infection. Since NNV is known to be transferred vertically [13], the objective of this work was to determine whether mature greater amberjack specimens were infected by NNV using non-lethal methodologies as well as the local immune response. Data will be discussed in the line of the differential vertical transmission potential of the virus and the immune response orchestrated in male and female specimens.
Results
NNV is Detected in Greater Amberjack Testis and Ovary
We evaluated the NNV in up to 14 male and 13 female amberjack broodstock specimens using different techniques. By qPCR analysis, we detected the NNV cp gene (NNV-cp-qPCR) in 4/14 testes and in 4/13 ovaries while the rdrp gene (NNV-rdrp-qPCR) was in 7/14 testes and 2/13 ovaries. In both cases the efficiency was calculated and NNV-cp-qPCR showed a lower efficiency than NNV-rdrp-qPCR (88.87% and 108.40%, respectively). Otherwise, nPCR was less efficient and revealed the expression of the T4 region of the NNV cp gene (T4-PCR) in 1/14 testis and 1/13 ovaries (Table 1, Supplementary Table 1). In contrast, using a method based on the luciferase activity, in which the induction of Mx was assayed, all gonadal samples were negative, probably due to the high dilution used to avoid cytotoxicity on cells. Regarding blood sample, no detection of NNV was observed by means of the NNV-cp-qPCR, NNV-rdrp-qPCR and T4-PCR approaches; however, the luciferase reporter assay revealed viral presence in 6/14 males and 5/13 females. All specimens positive by means of luciferase reporter assay were also positive by at least one NNV gene using qPCR in gonads (Supplementary Table 1). Interestingly, the expression levels of both NNV genes (cp and rdrp) varied among infected specimens and in some cases only one of the two genes was detected (Supplementary Table 1). Overall, comparison of NNV prevalence by sex revealed that specimens positive by one or more techniques (molecular or luciferase assays) represented 78.57% of the males, compared with 38.46% of the females analyzed (Table 1). Tissue comparisons showed that all blood samples positive for luciferase activity were also positive for NNV detection by qPCR in the gonads, whereas qPCR-positive gonadal samples were not necessarily positive for luciferase activity in blood (Supplementary Table 1). Interestingly, both methods (qPCR and luciferase) coincided in 100% of the NNV-positive female specimens but only in 64.29% of the NNV-positive males suggesting that the proper NNV detection in males is more inefficient or difficult.
Table 1. Table showing the number of greater amberjack specimens in which the NNV have been detected in gonad or blood using different methods. The total number of infected fish was calculated by the number of specimens that were positive in one or more diagnostic techniquesNested PCR in gonadcp. expression in gonad (qPCR)rdrp expression in gonad (qPCR)Luciferase activity in bloodTotal positive in 1 or more techniquesMales1/144/147/146/1411/14Females1/134/132/135/135/13Total2/278/279/2711/2716/27
Alteration of the Gonadal Immunity by NNV is Restricted to Testis
Once NNV-positive males and females were defined as specimens in which the virus was detected using at least one of the applied methods (any PCR or luciferase assay), and the NNV-negative specimens as those negative for all the tests performed, we evaluated several immune-related markers in the gonad. First, the antiviral response induced by interferon pathway was evaluated by the analysis of mx transcription, which was greatly up-regulated in infected males but not in females (Fig. 1A). Regarding the transcription of inflammatory-related genes, il1b, il6 and tnfa mRNA resulted in no statistical differences (Fig. 1B-D). Following with lymphocyte markers, the markers for cytotoxic T-cells, the cd8a gene, and T helper cells, the cd4 gene, were significantly increased in the testis from NNV-infected specimens whilst were not altered in females (Fig. 2A-B). On the other hand, the expression of the ighm gene, a B cell marker, was not altered by the infection neither in testis nor ovary (Fig. 2C). Regarding gonadal AMP genes (Fig. 3), transcription of h1, h2b, hamp, lyz and c3 were greatly up-regulated in the testis from NNV-infected specimens when compared with uninfected ones (Fig. 3B-F) but not in the case of nkl and defb2 (Fig. 3A, G). Again, the transcription in the ovaries was not affected by the viral presence.
Fig. 1NNV infection induces the Mx coding gene expression in greater amberjack males but not in females. (A-D) Relative gene expression of mx (A) and inflammatory-related molecules (B-D) in males and females from uninfected (NNV-free) or NNV-infected greater amberjack specimens. Data represent the mean relative gene expression corrected by the ef1a expression in each sample ± SEM obtained by real-time PCR. (*) Asterisks indicate a significant difference between uninfected and infected specimens according to Student’s t-test (p ≤ 0.05)
Fig. 2NNV infection induces the infiltration of leucocytes into the testis but not in the ovary. (A-B) T- and (C) B-leucocyte markers in males and females from uninfected (NNV-free) or NNV-infected greater amberjack specimens. Data represent the mean relative gene expression corrected by the ef1a expression in each sample ± SEM obtained by real-time PCR. (*) Asterisks indicate a significant difference between uninfected and infected specimens according to Student’s t-test (p ≤ 0.05)
Fig. 3NNV infection up-regulates the transcription of several AMPs genes in the testis. (A-G) Relative expression of AMPs encoding genes in males and females from uninfected (NNV-free) or NNV-infected greater amberjack specimens. Data represent the mean relative gene expression corrected by the ef1a expression in each sample ± SEM obtained by real-time PCR. (*) Asterisks indicate a significant difference between uninfected and infected specimens according to Student’s t-test (p ≤ 0.05)
Gonadal Functionality is Altered in Infected Males but not in Females
Greater amberjack males during a persistent NNV infection underwent testicular disruption as shown by the up-regulation of vtg expression and the down-regulation of dmrt1 expression levels (Fig. 4A, B). Interestingly, a lower spermatic volume was produced by infected males compared to non-infected ones (Fig. 4C). Opposite to this, gonadal functionality markers remained unaltered in infected females compared to naïve ones (Fig. 4A, B).
Fig. 4. Altered gonad functionality in the NNV infected males but not in females. (A-B) Relative expression of vitellogenin (A), dmrt1 (B) in males and females from uninfected (NNV-free) or NNV-infected greater amberjack specimens. (C) Spermatic parameters from uninfected or NNV infected greater amberjack males. (A-B) Data represent the mean relative gene expression corrected by the ef1a expression in each sample ± SEM obtained by real-time PCR. (C) Data represent the mean of in each sample ± SEM (*) Asterisks indicate a significant difference between uninfected and infected specimens according to Student’s t-test (p ≤ 0.05)
Estradiol Levels in Serum are Increased in Infected Females but not in Males
Sexual hormones E_2_ and 11KT levels in serum were analyzed in both males and females (Fig. 5). E_2_ levels were significantly increased upon infection in females but not in males (Fig. 5A). By contrast, 11KT showed similar levels in both males and females comparing infected and naïve specimens (Fig. 5B). Although not statistically significant, higher levels of expression of steroidogenetic enzyme genes, mainly the cyp11c1a, were observed in infected testis compared with naïve (Fig. 5C, D).
Fig. 5NNV modified the sex steroid production in females but not in males. (A-B) Levels of (A) 17β-estradiol (E_2_) and (B) 11-Ketotestosterone (11KT) in serum of males and females from uninfected (NNV-free) or NNV-infected greater amberjack specimens. (C-D) Relative expression of steroidogenetic enzymes in males and females from uninfected (NNV-free) or NNV-infected greater amberjack specimens. (A-B) Data are presented as the mean of the hormonal levels in serum expressed in ng/mL. (C-D) Data represent the mean relative gene expression corrected by the ef1a expression in each sample ± SEM obtained by real-time PCR. (*) Asterisks indicate a significant difference between uninfected and infected specimens according to Student’s t test (p ≤ 0.05)
Discussion
During the management protocols in our facilities, sudden mortalities with some clinical signs of viral disease have been reported in some batches of greater amberjack larvae from apparently healthy broodstock. This led us to the objective of searching for a non-lethal procedure that allows the early detection in gonads of NNV in greater amberjack broodstocks of both sexes and ascertain whether there is a local immune response triggered in ovary or testis that might be stimulated to prevent possible outbreaks in their offspring. In several fish species, nodavirus has been shown to colonize the gonads of specimens that are maintained without showing any clinical signs of VER disease [14]. Accordingly, some authors have emphasized that the development of non-lethal methods for detecting NNV in broodstock is essential for effective management strategies for this disease [15]. In this study, we applied several approaches routinely used in our laboratories to detect NNV in greater amberjack broodstock gonads. Our aim was not to evaluate and compare the sensitivity and sensibility of the methods, but rather to test a combination of techniques to detect NNV in gonads using non-lethal methodologies.
Our analysis revealed that detection of NNV in greater amberjack ovary and testis tissues by qPCR is preferred to the nPCR approach, as previously reported [15]. Accordingly, our qPCR method appears be efficient for gonadal detection of NNV and suitable for screening NNV presence in broodstock, as also shown in European sea bass [16]. Analysis of the qPCR primers showed that the rdrp primers perfectly annealed with a greater number of NNV isolates than the cp primers (Supplementary Tables 2 and 3). This together with the higher efficiency of the NNV-rdrp-qPCR, suggests that targeting the rdrp gene increases the likelihood of detecting a broader range of NNV isolates. This issue may be related to the different sensitivity observed between both methods and sexes. Thus, the NNV-rdrp-qPCR detected more infected males than the NNV-cp-qPCR (7/4), whereas in females the opposite trend was observed (2/4). These differences could reflect that distinct NNV strains may vary in their ability to established latent or persistent infections. Because our specimens were naturally infected, they may harbor different NNV strains. In addition, sex-specific differences in the immune responses, paracrine factors and cell types between testis and ovary could influence the expression ratios of cp and rdrp genes and consequently their detection. In light of these data, further experimental infection of males and females with different NNV strains will be necesary to determine the causes of the observed differences in NNV detection between testes and ovaries. Anyway, our data also support that qPCR is a proper method for screening NNV presence in gonads, pointing to a non-lethal method of NNV diagnosis. Other authors had proposed other tissues to develop non-lethal NNV-diagnosis methods, such as blood, but with lower levels of sensitivity than lethal ones involving the main target for NNV, the brain [15, 16]. Confirming this, we have described that qPCR could not detect NNV transcription in blood. Nevertheless, we succeeded in detecting viral presence in blood using a newly developed method based on luciferase activity [17], that increases the time of detection of NNV in blood. This luciferase-based method is able to detect the presence of viral particles without requiring viral replication, since activation of any receptor sensing viral proteins or nucleic acids in RTG cells triggers the interferon pathway and, in turn, the mx gene promoter, producing a positive signal. Moreover, the promoter contains immune-effector response elements, such as IL6 response element [18], which, when induced in NNV-stimulated RTG cells, could further amplify the observed signal. Until now previous studies using qPCR or ELISA techniques only detected NNV in blood within the first 5 or 30 days from infection, that is, when the infection is active [16, 19], but not in persistent infections as our data show. Comparing between gonadal qPCR and luciferase detection methods in blood, our data demonstrated that in asymptomatic mature greater amberjack specimens, viral particles may be present in the blood during persistent or latent infections in the gonads, but not in all the cases, as our data also demonstrated. Despite that viral detection in blood by luciferase assay is quite sensitive, its detection in gonadal biopsies by qPCR is a more accurate technique for diagnosing the virus in asymptomatic greater amberjack.
Strikingly, we observed a major prevalence of the infection in males than in females. The differential sex viral colonization might be due to differences in physiology and/or immune responses between ovary and testis. Despite these differences, both tissues are considered to be an immunologically privileged sites because the immune response is specially regulated in a way that prevent harmful responses to germ cells [14]. With that in mind, we aimed to analyze the rdrp gene since it is the responsible for viral replication, so it can be used as an indicator of active viral infection in the gonad [2]. Our data revealed a higher proportion of testes expressing rdrp than ovaries (7/14 in males vs. 2/13 in females) but similar rates for the expression of cp (4/14 in males vs. 4/13 in females) whose major functions are structural. However, to our knowledge, scarce data are available regarding persistence or latent infection in fish gonads, and few studies have compared these processes between sexes. It is possible that differences in the tissue environment of testes and ovaries influence viral persistence, which could explaining the different infected rates observed in this study. Further experimental infections comparing males and females will be necessary to clarify this issue.
Similar to what happened with the viral rdrp gene expression, males recorded the highest levels of mx expression when compared with non-infected males and both infected and non-infected females. The high expression of mx indicates an active viral proliferation detected by the immune response, as was also described in the rainbow trout ovary, in which treatment that block viral proliferation also decreases mx expression [20]. Accordingly, with the lack of viral proliferation in the greater amberjack ovary, we were unable to observe the activation of any immune genes tested. In the testes, however, we observed a heavy up-regulation of lymphocytes T markers (cd8 and cd4) and several AMPs (h1, h2b, hamp, lyz and c3) but not inflammatory cytokines. As previously described in testis from NNV infected gilthead seabream and European seabass specimens, the inflammatory response is normally blocked in the testis of asymptomatic species to avoid germ cell damage and only when infection is out of control in susceptible species, the inflammatory response is up-regulated [14]. Interestingly, the non-induction of proinflammatory genes could be a consequence of the up-regulation of mx gene as Mx has been reported to bind essential components of viruses blocking its action and controlling the disease [21]. So, this heavy up-regulation of mx might be the responsible of the lack of symptomatology in the studied specimens as also suggested in gilthead seabream [22].
It is well known that AMPs are key in controlling infections without triggering inflammatory responses [23]. In addition, AMPs treatment against infections resulted in higher survival rates due to the promotion of an anti-inflammatory status related to the prevention of cell damage [24, 25]. Thus, we evaluated the expression levels of several AMPs. Our data showed that, in general, the transcriptional levels of AMPs in male-infected were highly up-regulated in agreement with what has been previously described in other fish species [14]. Considering the antiviral properties of those AMPs [26–28], we can conclude that the AMPs based response observed in greater amberjack males is key to keep under control the NNV replication also observed.
Other anti-viral key responses are mediated by T cytotoxic (CD8+) and T helper (CD4+) lymphocytes [29]. Our data showed a heavy up-regulation of both T cells markers, suggesting an active recruitment of these cell types in the NNV-infected testis of greater amberjack asymptomatic specimens. Interestingly, the expression levels of cd4 in the testis of infected males were higher than those of cd8. In fish, T helper (CD4+) lymphocytes recognize exogenous pathogens through interactions with antigen-presenting cells and promote the activation of B cells and T cytotoxic lymphocytes [30]. Increased proliferation of CD4 + cells has been reported in olive flounder (Paralichthys olivaceus) following NNV infection [31]. In addition, up-regulation of both genes, cd8 and cd4, has been observed in gilthead seabream infected with RGNNV that successfully resolved the infection, with cd8 expression exceeding cd4 levels [22]. Taken together, these data suggest that not only cytotoxic T cells but also T helper lymphocytes are essential for resolving the infection, although the cd8/cd4 expression ratio might depend on the fish species. Anyway, their infiltration might be a mechanism for viral resolution as observed in other immunoprivileged organs such as retina in European sea bass or brain in Atlantic halibut (Hippoglossus hippoglossus) [32, 33]. Taking all this information together, we can affirm that both innate and adaptive cellular and humoral immune responses are triggered in the greater amberjack testis, which suffer a persistent infection with NNV. On the other hand, the presence of NNV in the ovary and the lack of immune responses suggest a latent infection. As far as we are concerned, this is the first time that it is demonstrated that NNV can establish a latent or persistent infection in the gonad depending on the sex of the host.
Once demonstrated that NNV can stablish a persistent infection in the testis of greater amberjack, we tried to ascertain whether this situation might affect to reproductive parameters. Thus, we observed that the transcriptional levels of dmrt1, a marker for testicular functionality [34], were down-regulated in infected greater amberjack males which also recorded low spermatic volume. As also suggested in zebrafish [31], a possible consequence of dmrt1 down-regulation might be the low spermatic volume and in turn difficulties in breeding [31]. On the other hand, it is well known that vtg expression increase in response to estrogenic stimulus or pollutants in most fish species concomitantly with sex change processes or testicular dysfunction [35]. However, vitellogenin has also been described as an antimicrobial molecule [36]. The observed increase of vtg expression in infected-males without any modification of E_2_ plasmatic levels or in steroidogenic enzymes gene expression was observed on those specimens suggest that Vtg is acting as an AMPs as consequence of the NNV infection. It is noticeable that vtg is expressed in the males of some fish species at very low levels and it has been related to infection-resistant responses in fish [37]. Strikingly, serum E_2_ levels were increased in NNV+ females. Although E_2_ has been reported to modulate immune responses in fish, its effects remain controversial, as both immunostimulatory and immunosuppressive roles have been described in several fish species [38, 39]. However, in the present study, no changes were detected in the expression of the immune-related genes analyzed in the NNV-positive females. While we cannot rule out that elevated serum E_2_ levels are unrelated to the lack of immune activation, our results also suggest a potential association between E_2_ levels and NNV behavior during infection. Sex-based comparisons in greater amberjack revealed that NNV-positive females exhibited a latent infection without immune response activation and higher serum E_2_ levels, whereas NNV-positive males showed a persistent infection with immune activation and unchanged serum E_2_ levels. Thus, our results suggest that E_2_ may influence NNV behavior during infection. Consistent with this hypothesis, increased plasma E_2_ levels and estrogen receptor expression in the target tissue (brain) have also been observed in asymptomatic gilthead seabream males shortly after NNV infection, whereas in a highly susceptible specie, the European sea bass, both serum E_2_ levels and estrogen receptor transcription in the brain were down-regulated [14]. Taken together, these observations support the hypothesis that high E_2_ levels may be associated with the establishment of latent NNV infection in the gonads of the greater amberjack females.
In conclusion, our study proposes a new non-lethal technique for NNV diagnosis of latent or persistent infections in greater amberjack gonadal tissues obtained by biopsy or in blood samples. Besides, this paper supposes the first approach to understand the interaction between NNV and greater amberjack gonads, describing clear sex biased behavior. Thus, males suffer a persistent infection in the testis, inducing a great immune response mainly mediated by AMPs, T-cells infiltration and the activation of the type-I IFN pathway, which might lead to testicular dysfunction and fertility problems. Females, however, do not undergo any change in their naïve immune levels in the ovary, although the plasmatic levels of E_2_ increased, probably favoring the establishment of a latent infection.
Materials and methods
Broodstock Maintenance
Greater amberjack rearing was undertaken in the facilities of the Centro Oceanográfico de Canarias, belonging to the Instituto Español de Oceanografía (COC-IEO), CSIC, Tenerife, Spain. The broodstock consisted of 5 fish captured in December 2015 in the north of Tenerife (9.4 ± 1.5 Kg), 13 fish captured in the south of Tenerife between 2013 and 2014, with weights ranging between 0.5 and 3.2 Kg, and 9 fish were obtained from FUTUNA, Cádiz, Spain and translated to COC-IEO facilities in 2019 (8.8 ± 1.4 Kg). Fish were individually identified with Passive Integrated Transponder tags (PIT) and maintained in tanks (volumes from 4 to 500 m^3^) covered with shading mesh, and supplied with sea water (6 renewals per day) under natural photoperiod and water temperature. Fish were fed three times per week to apparent satiation with raw fish (mackerel, Scomber colias). Measurements of water temperature and quality (Dissolved Oxygen, NH_3_–N and NO_2_–N) were conducted once per week throughout all the years that the fish were in the facilities (from 2013 to 2023) and were always kept between optimal standard levels. Ethical management protocols and authorization by local authorities, “Gobierno de Canarias”, were obtained for all the experiments and fish managements (Permit Number 1429/2023).
Fish Sampling
Fish were starved for two days prior to sampling and were tranquilized initially with the use of chlorobutanol (0.1 mL/L) diluted in the tank and then transferred to an anesthetic bath for complete sedation with a higher concentration of chlorobutanol (0.3 mL/L). Ovarian biopsies for the evaluation of oocyte development were obtained by inserting a plastic cannula (Pipelle de Cornier) through the ovary efferent duct. Maturation of the males was examined by the release of sperm upon application of gentle abdominal pressure. If this was not possible, a sperm sample was obtained by inserting a plastic catheter at the opening of the genital pore. Evaluation of sperm quality parameters was done immediately after the completion of the sampling. In all cases, two gonadal samples from each fish were collected: One was homogenized in sterile phosphate buffer (PBS; 1 g/mL), centrifugated at 10,000 g during 5 min and stored at −80 °C; and the other was stored in DNA/RNA shield and also stored at −80 °C. Samples of blood from each fish were also collected from the caudal vein using heparinized syringes. Of each fish, two blood subsamples were stored at −80 °C. The remaining blood was centrifuged at 1,400 xg for 20 min and plasma was collected, frozen in liquid nitrogen and stored at −80 °C until analysis.
Evaluation of Sperm Quality
Sperm quality parameters that were evaluated included (a) initial percentage of spermatozoa showing forward motility immediately after activation (sperm motility, %), and (b) duration of forward sperm motility of 5% of the spermatozoa in the field of view (motility duration, min). Sperm motility and duration were evaluated on a microscope slide at 400x magnification after mixing 1 µL of sperm with a drop of seawater (~ 50 µL) in duplicate. Activated sperm samples were observed under a compound light microscope for the first time 10 s after activation. Sperm motility was determined subjectively using increments of 10% and sperm was considered immotile when < 5% of the spermatozoa were exhibiting forward motility. All samples were analyzed in duplicate.
Viral Detection and Quantification using an RTG-pmx-Luciferase System
In order to detect and quantify the viral presence in amberjack samples we used the RTG cell line expressing a luciferase reporter under the control of the Mx promoter (RTG psaumx2-luc cells) [40]. Cells were cultured in 25 cm² flasks (Nunc, ThermoFisher) at 20 °C using RTG-growth medium which consisted on Leibovitz (L-15) medium (Gibco) supplemented with 10% foetal bovine serum (FBS, Lonza), 4 mM L-glutamine (Gibco), and 100 units/mL penicillin, 10 mg/mL streptomycin (Sigma). E-11 cells [41] were maintained in 25 cm² flasks at 25 °C, in L-15 medium supplemented with 5% FBS, 100 units/mL penicillin, and 10 mg/mL streptomycin and used for NNV (SpDl_IAusc965.09 isolate, RGNNV genotype, isolated from European seabass [42]) production and titration using the 50% tissue culture infective dose (TCID_50_) method [43] as elsewhere.
Gonadal homogenates and blood samples were independently diluted in L-15 medium containing penicillin-streptomycin (100 units/mL penicillin, 10 mg/mL streptomycin). Serial dilutions of both tissues were tested on RTG psaumx2-luc cells in order to select the lowest dilution producing no cytopathic effects. Thus, the optimal dilution of gonadal and blood samples was 1:10,000 and 1:20, respectively. In addition, RGNNV at 10³, 10⁴, 10⁵, and 10⁶ TCID₅₀/mL was added to cell cultures as positive controls and used for quantification.
To detect and quantify RGNNV in these samples, RTG psaumx2-luc cells were seeded (100,000 initial cells per well) in 24-well culture plates with RTG-growth medium, and 24 h later inoculated with 250 µL of each diluted sample. After 1-h of adsorption, 750 µL of maintenance medium (2% FBS) were added to each well, and cells were incubated at 25 °C for 24 h. At this time point, luciferase activity was measured, and inducibility values were calculated as previously described by [17] In addition, RGNNV at 10³, 10⁴, 10⁵, and 10⁶ TCID₅₀/mL (final concentration) was added to virus free control samples (gonadal and blood) and luciferase activity was measured as described above. A regression analysis between inducibility of control samples (y-axis) and TCID50/mL (x-axis) was conducted using the GraphPad Prism 9 software (GraphPad Software, Inc. La Jolla, USA). Viral titres of samples were estimated using the regression equations obtained (Supplementary Fig. 1).
Gene Expression Analysis
Total RNA from gonadal samples were obtained as previously described [44]. To detect NNV in greater amberjack gonadal fluids, two PCR variants were employed: Real-time PCR (qPCR) and Nested-PCR (nPCR). Negative controls, consisting of reactions without template, and positive controls, containing cDNA from the brains of experimentally NNV-infected European sea bass specimens [44] were always used. For studies of immune-related genes expression, real-time PCR was employed. Primers used in all reactions are shown in Table 2.
Table 2. Primer sequences used in this studyProtein nameGene or primer nameAccession numberSequence (5’◊ 3’)TechniqueReferenceElongation factor 1 alpha ef1a LC010974F: TTCAACGCCCAGGTCATCR: AACTTGCAGGCAATGTGAGCqPCRBeta actin bact KX570957F: CCCTGTCCTGCTCACAGAGGR: CAAGTCCAGACGCAGGATGGqPCRNKlysin nkl XM_022751065F: CTCCTTGTGTGCATCCTGGTR: CTTCCACCTCCAACTGCTCCqPCRLysozyme lyz XM_022744538F: TGTGCCAAACGTGTTGTCAGR: CAGACCACATCCTGCCAAGTqPCRHistone 1 h1 XM_022770221F: CGTCAGGACTGTCATCAGGGR: TGGCATTGGTTTCAGCGTTCqPCRHistone 2b h2b ENSSDUG00000000066F: ACCTCCAGGGAGATCCAGACR: AGCTGGTGTACTTGGTGACGqPCRC3 complement factor c3 XM_022770134F: TGGAGGCAGAGTTGAGAGGTR: ACCGCAACATCGAAGGACATqPCRHepcidin hamp XM_022764299.1F: GATGATGCCGAATCCCGTCAGGR: CAGAAACCGCAGCCCTTGTTGGCqPCR[49]Defensin beta 2 defb2 ENSSDUG00000008238F: CTTCTCCTGATGCTCGCAGTR: CCTGAGCATAGCAGAACCGTqPCRTumoral necrosis factor alpha tnfa XM_022746377.1F: GAAAACGCTTCATGCCTCTCR: GTTGGTTTCCGTCCACAGTTqPCR[49]Interleukin 1 beta il1b XM_022753745.1F: TGATGGAGAACATGGTGGAAR: GTCGACATGGTCAGATGCACqPCR[49]Interleukin 8 il8 XM_022758559.1F: GAAGCCTGGGAGTAGAGCTGR: GGGGTCTAGGCAGACCTCTTqPCR[49]CD8 alpha cd8a XM_022744928F: TGGCCTTCTTCTTCTGCTCCR: GCATCGTCCGTGGTTTTCTTqPCRImmunoglobulin M heavy chain ighm XM_022756467.1F: GTGGCTCTGGAACTGGAGACR: CGTCAAGGCAGCCCCATTTqPCRCD4 molecule cd4 ENSSDUG00000013468F: CCGACCCAAAGCTCAAAGGAR: CCACATCCACCAACTGAGCTqPCRVitellogenin-like vtg ENSSDUG00000004255F: CGACAGCACTTCAGTCCCTTR: CGTGACAGCTCTCACAGTGTqPCRDoublesex- and mab-3-related transcription factor 1-like dmrt1 ENSSDUT00000028630F: ATGGCAGCCTCTTTCTCACCR: CCTCAGGCTTGACGACAGAGqPCRAromatase cyp19a1a ENSSDUG00000003606F: ATTCTCAACACCGGTCGCATR: CTGGAAGTAACGGCGAGGAGqPCRCytochrome P450 11B cyp11c1 ENSSDUG00000007605F: GTGGCGAGGGATTTCTGTCAR: GCGGAAGAGATCAGGACTGGqPCRInterferon-induced GTP-binding protein Mx mx XM_022744797F: GGGGTCAGAAGGAGATCACAR: ACCAGCTCAAGCGTCAGTTTqPCRBeta-actin bact KX570957F: CCCTGTCCTGCTCACAGAGGR: CAAGTCCAGACGCAGGATGGConventional PCRNNV coat protein cp D38636F: CAACTGACAACGATCACACCTTCR: CAATCGAACACTCCAGCGACAqPCR[24]Protein A rdpr AF319555F: GTGTCCGGAGAGGTTAAGGATGR: CTTGAATTGATCAACGGTGAACAqPCR[24]T4 region NNV nodaF2.3 -CRTCYCTYGAGACACCTGAnPCR[50] nodaRev2 -CSCCAWCTGTGAAYGTMTTGTnPCR[51] nodaFw1 -CCTGARGASACCACCGCTCCMATNested PCR[51] nodaR3.2 -TGTARTCAATGGRCARCGGNested PCR[50]
Real-time PCR was performed as previously described [45] with a CFX96 Real-Time System (Biorad, Hercules, CA) using SYBR Green PCR Core Reagents (Applied Biosystems, Waltham, MA) and specific primers for NNV and relevant immune-related molecules genes (Table 2). For NNV detection, only Ct values ≤ 35 were considered as positives. The Cts obtained in the positive controls for cp and rdrp expression were 23.78 and 26.59, respectively. For the study of relevant-immune gene expression, each mRNA gene expression was corrected by the geometric mean of elongation factor 1 alpha (ef1a) and beta-actin (bact) gene expressions in each sample and expressed as 2^−ΔCt^, where ΔCt is determined by subtracting gene expression of ef1a Ct value from the target Ct [46]. The reference genes (ef1a and bact) used showed high stability of Ct values and pattern of expression through the different samples (Supplementary Fig. 2). In all cases, the melting curve was analysed and only one peak was confirmed, demonstrating the specificity of each reaction. For the NNV qPCR, the melting curves perfectly matched that from the positive control. In all cases, the negative controls resulted in no amplification. The efficiency of NNV detection by qPCR was calculated as E=(10^− 1/slope^ − 1) × 100, using a standard curve of a plasmid coding the cp or the rdrp genes of RGNNV. Slope for the cp detection was of −3.6213 (R² = 0.9545) and for rdrp of −3.1363 (R² = 0.9894).
Nested PCR was performed in two steps of conventional PCR as previously described [47]. In the first step, cDNA was used as template and the annealing temperature was 54 °C, while in the nested step the product of the first PCR and 52 °C were used as template and annealing temperature, respectively. Moreover, beta-actin, as a housekeeping gene, expression was also evaluated by conventional PCR using 55 °C as annealing temperature. The product of nPCR corresponded to the T4 region of NNV which size was 163 bases pair (bp). The amplicon was visualized by electrophoresis on 2% agarose gels stained with Red Safe (iNtRON Biotechnology). Negative controls with no template were always included in all reactions. Positive controls of known infected tissues were included when diagnosis PCRs were performed.
Sex Steroids Determination
Plasma levels of 11-ketotestosterone (11-KT) and 17β-estradiol (E_2_) were quantified by ELISA following a modified method previously described [48]. The 11-KT and E_2_ standards, mouse anti-rabbit IgG monoclonal antibody (mAb), and specific anti-steroid antibodies and enzymatic tracers (steroid acetylcholinesterase conjugates) were obtained from Cayman Chemical. The acetylcholinesterase activity was revealed using Ellman’s reagent as substrate and measured at 450 nm of wavelength. A standard curve for each of the steroids being quantified was prepared using serial dilutions from 6.13 × 10^− 4^ to 2.5 ng/mL (0.03–125 pg/well) and included in each assay. Standards and extracted serum samples were run in duplicate. The lower limit of detection for all the assays was 0.02 pg/mL. The intra-assay coefficients of variation (calculated from duplicate samples) were 18.73% ± 7.55% for 11-KT and 20.99% ± 9.94% for E_2_. The inter-assay coefficient of variation was determined at 50% of binding and was 40% for 11-KT (n = 2 assays) and 12.5% for E_2_ (n = 2 assays).
Statistical Analysis
The BestKeeper algorithm index (BestKeeper^®^ software) and repeated par-wise regression analysis were used according to the methodology previously described [46] to determine the stability of housekeeper genes expression. All data were represented and analyzed with the GraphPad Prism 9 software (GraphPad Software, Inc. La Jolla, USA). In the assays using the luciferase reporter cells, regression analysis between inducibility and TCID_50_/mL showing the highest R^2^ value were used to estimate viral titres (TCID_50_/mL). For the transcription of immune genes and sex hormone levels specimens were grouped in two groups for each sex: negative (negative with all techniques) and NNV+ve (NNV-positive with PCR) for representation and analysis. Within each sex, statistical differences between samples were evaluated using a two-tailed unpaired Student’s t-test, with p < 0.05 considered statistically significant.
Supplementary Information
Below is the link to the electronic supplementary material.ESM 1(DOCX 223 KB)ESM 2(XLSX 24.4 KB)ESM 3(DOCX 20.0 KB)