Enhancing anti-Müllerian hormone processing reduces preantral follicle survival but spares female reproduction in mice
Shreya Maskey, William A Stocker, Lauren R Alesi, Michael W Pankhurst, Hugo W G Herron-Vellacott, Sophie G Harrison, Cassy M Spiller, Adam Hagg, Amy L Winship, Craig A Harrison, Kelly L Walton
TL;DR
Enhancing AMH processing in mice reduces preantral follicle survival but does not affect overall female fertility or reproductive function.
Contribution
A novel mutation in the AMH cleavage site was introduced in mice to improve AMH maturation and assess its physiological effects.
Findings
Enhanced AMH maturation led to a 25% reduction in ovarian mass in female mice.
Mutant AMH increased atretic secondary follicles, indicating a role in preantral follicle survival.
Female fertility and estrous cyclicity remained unaffected despite changes in ovarian structure.
Abstract
Anti-Müllerian hormone (AMH) is produced by granulosa cells within growing ovarian follicles and limits the number of follicles reaching ovulation. AMH is synthesized as a precursor protein comprising N-terminal prodomains and C-terminal mature domains, separated by a furin-like cleavage motif (RXXR). Proteolytic maturation of AMH (140 kDa) is required to release the bioactive mature dimer (25 kDa), which potentiates signaling via AMH receptors (AMHR2 and ALK2/3). However, the abundance of unprocessed AMH in human follicular fluid suggests that cleavage within the ovary is inefficient. This study hypothesized that enhancing AMH maturation would increase AMH activity in vitro and in vivo. Using targeted mutagenesis, we optimized the murine AMH cleavage site (from wild-type (WT) 443RTGR445 to 443RKKR445) and showed in vitro that this favored production of bioactive AMH. We then introduced…
Genes, proteins, chemicals, diseases, species, mutations and cell lines named across the full text — each resolved to its canonical identifier and authoritative record.
Click any figure to enlarge with its caption.
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7| Gene | Forward primers | Reverse primers |
|---|---|---|
|
| CGGGAATCCAAGAAGATTGA | TTCAGCTTGTGGATGTGCTC |
|
| GACAGGCACCTTGTGGAAAT | GAGGTTCACGCCACCTACTC |
| Cyp17A | GAGTTTGCCATCCCGAAGGA | CCAGCTCCGAAGGGCAAATA |
|
| GCGGAATATGAAAGGATTAAGG | GTCACTATAGAGTGTTGCTTC |
|
| AGAGCTTCAAAGTTTATGCC | AGTCTCTGACATCCAATTCC |
|
| CAATTTAACAGCCCTCCTAAG | CACCAACATCTTGATGATCC |
|
| GCAACCCCTACCACTTCAGC | GTGGCTTGTACTGGTCAGGAG |
|
| CCCTGCGACGAGAAAGCTC | GCTCTTTTCGTTGAGGCAAACC |
|
| CTGTCGGAACGTAGCCTGG | GTGGTTCATGTCGTCCAAGAG |
|
| GAAGATGGTTATCGTCACCACC | CGTTCCAGGCATTGTACCACT |
|
| CAGCACGGCCCCAATGTAT | GGGACCTTTTCATATCCAGGACA |
|
| TGCATCAGTGACGGTAAACCA | TTCTTCAGCCGTGCAACAATC |
|
| CCAGGAAACATCAGTGAGTCC | GGATGGAACTTGGAATCGGTCA |
- —University of Queensland10.13039/501100001794
- —KLW Research Support Package
- —Rebecca L. Cooper Medical Research Foundation10.13039/501100001061
- —Australian Government Research Training Program Stipend scholarship
Peer Reviews
No public reviews on file for this paper yet. If you reviewed it on a platform where reviews are public (OpenReview, ICLR, NeurIPS, ICML), you can paste yours below so the community can read it here.
Videos
No videos yet. Explain this paper in a talk, walkthrough, or lecture? Add one.
Taxonomy
TopicsOvarian function and disorders · Reproductive Biology and Fertility · Reproductive Health and Technologies
Anti-Müllerian hormone (AMH) is a member of the transforming growth factor-β (TGF-β) superfamily, initially named for its role in driving Müllerian duct regression during male sexual differentiation (1). While in males AMH primarily regulates sex differentiation and testicular development (1-3), in females AMH regulates postpubertal ovarian function (4). In adult females, AMH is produced by the granulosa cells of small growing ovarian follicles and limits primordial follicle activation and transition to the primary follicle state (5, 6). AMH also desensitises developing follicles to follicle-stimulating hormone (FSH) (7-9), and influences follicle survival and growth via atresia (10-12). AMH exerts these physiological actions at a cellular level via interactions with serine/threonine kinase transmembrane receptors, the AMH-specific type II receptor, AMHRII (13, 14), and the type I receptors ALK2, ALK3, and potentially ALK6, which then stimulate an intracellular SMAD1/5/9 signaling cascade (15). Intriguingly, AMH is detected at ng/mL levels in the circulation of reproductively aged females, and the AMH receptors are present in extragonadal tissues such as the pancreas (16, 17), spleen (18), adrenals (19), skeletal muscle (18, 20), and gonadotropin-releasing hormone (GnRH) neurons in the hypothalamus (21). However, the majority of studies support that AMH functions mainly in a local, intraovarian manner.
Much of the evidence surrounding AMH actions in the ovary has been garnered from gene silencing/knockout mouse (Amh^−/−^) studies (6). In Amh^−/−^ female mice, primordial follicle recruitment is accelerated leading to an earlier exhaustion of the ovarian reserve (5, 6). Ovarian analyses of adult female Amh^⁻/⁻^ mice also revealed that AMH desensitizes developing follicles to FSH, as these mice had more growing follicles relative to wild-type controls following FSH stimulation (7-9). In support, FSH-mediated selection of dominant follicles only begins once AMH levels drop at the large antral state, enabling ovulation (8). In contrast, viral-mediated overexpression of AMH in mice halts folliculogenesis at the primary stage, and folliculogenesis is reinstated upon AMH withdrawal, providing a rationale for investigating AMH as a contraceptive (22). Accordingly, we and others have recently demonstrated that adeno-associated viral (AAV)-mediated delivery of AMH analogs blocks fertility, but not necessarily ovulation in cats (23, 24). In-depth analyses of ovarian folliculogenesis in transgenic AMH-overexpressing mice indicate that AMH prevents the growing follicle pool from becoming too large by promoting follicle atresia (10, 25). AMH gene variants that interfere with expression and/or activity have also been identified in women with ovarian disorders, such as premature ovarian failure (POF) and polycystic ovarian syndrome (PCOS), which strongly supports the notion that AMH homeostasis underpins healthy ovarian function (26-30). While these studies have identified that supraphysiological or complete absence of AMH bears consequences for ovarian function, they may not accurately reflect AMH functions at physiological concentrations.
Proteolytic maturation is a rate-limiting step in the activation of most TGF-β ligands; therefore, manipulating TGF-β ligand precursor cleavage efficiency is an attractive means to titrate ligand bioactivities both in vitro and in vivo (31-34). Previously, our team demonstrated that blunting the proteolytic maturation of related ovarian TGF-β proteins, inhibin A and inhibin B, resulted in significant disruptions to ovarian functions in the mouse (33). We introduced an inactivating point mutation into the mouse Inha gene, which maintained pro-inhibin A/B production at naturally occurring sites and stages, but prevented the generation of processed bioactive inhibin A/B (33). It was found that inhibition of inhibin A/B processing resulted in significant disruptions to folliculogenesis and pregnancy in mice, supporting that inhibin A/B processing is essential for normal female fecundity and fertility (33). Notably, using this approach, we discovered novel and physiologically relevant roles for the inhibins in female fecundity and fertility, which were not identified using conventional gene knockout approaches. Indeed, lack of inhibin-α production in Inha^−/−^ mice resulted in gonadal tumors and lethal cachectic muscle wasting from 6 weeks of age in both males and females (35, 36). Thus, manipulating proteolytic maturation of TGF-β proteins is an effective way to alter ligand activation status and capture physiologically relevant actions.
Previous studies support that proteolytic maturation of AMH is a rate-limiting step for AMH bioactivity in both rodents and humans, and that targeted modification of the AMH cleavage site can enhance its in vitro bioactivity (32, 37-39). This study aimed to assess whether enhancing endogenous proteolytic maturation of AMH increases AMH signaling, thereby demonstrating that cleavage efficiency is rate-limiting in the adult mouse ovary. To address this, we first introduced an optimal cleavage site into mouse AMH (p. 444Thr > Lys and p. 445Gly > Lys or 443_RTGR_446→RKKR). We first confirmed in vitro that this resulted in significant improvements to AMH processing and, consequently, bioactivity. Following validation, we introduced this optimized cleavage site into the mouse Amh gene in C57BL6/J mice using CRISPR/Cas9 technology and assessed the reproductive consequences in the resulting AMH^RKKR/RKKR^ adult female mice. Our results support a primary physiological role for ovarian AMH in limiting preantral follicle survival, and that enhancing AMH proteolytic maturation is otherwise nondisruptive to female reproduction.
Materials and methods
Generation of mouse AMH variant expression constructs
An AMH expression construct was generated by PCR amplification (encoding GenBank ID: NP_031471.2) of mouse ovarian cDNA kindly provided by Dr Ann Drummond (Hudson Institute of Medical Research, Clayton, VIC, Australia) using primers flanking the ORF (sense 5′-ctagaagcttatgcaggggccacacctctctcc-3′ and anti-sense 5′-ctaggaattctcaccggcagccgcactcggtggc-3′), followed by cloning into the mammalian expression vector pcDNA3.1+ (ThermoFisher Scientific, Waltham, MA, USA) between the restriction sites HindIII and EcoRI. The QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies) was employed to modify the furin cleavage site between the pro- and mature domains of mouse AMH (mAMH). Adjacent point mutations (c. 2075C > A, p. 444Thr > Lys and c. 2077 GG > AA, p. 445Gly > Lys) were introduced into mAMH using custom mutagenic primers (sense 5′-gaagggcgtgggagaaagaagcgcagcgcggggacaggg-3′ and anti-sense 5′-ccctgtccccgcgctgcgcttctttctcccacgcccttc-3′). The resultant DNA construct was transformed into high-efficiency 5-α competent Escherichia coli cells (New England Biolabs, Notting Hill, Australia), and colonies were selected and propagated in the LB medium (with 100 µg/mL of ampicillin) at 37 °C overnight. Plasmid DNA was extracted using the PureYield^TM^ Plasmid Miniprep System (Promega, Madison, WI, USA) according to the manufacturer's guidelines. Following purification, constructs were verified by DNA sequencing (Micromon DNA Sequencing Facility, Monash University, Australia). Following mutagenesis, the ZymoPURE^TM^ II Plasmid Maxiprep Kit (Zymo Research, Irvine, CA) was used according to the manufacturer's instructions to produce large quantities of purified DNA for transient transfection of mammalian cells.
Transient expression of AMH variants in HEK293 cells and detection via western blotting
The mAMH protein variants were generated by transient transfection of human embryonic kidney 293 (HEK293) cells (Thermo Fisher Scientific, Waltham, MA, USA). In brief, HEK293 cells were plated at 4 × 10^5^ cells/well in a poly-D-lysine covered 12-well plate in Dulbecco Modified Eagle Medium (DMEM, Thermo Fisher Scientific) supplemented with 10% foetal bovine serum (FBS, Thermo Fisher Scientific) and incubated at 37 °C in 5% CO_2_. After 24 hours, plasmid DNA (2.5 µg/well) was combined in a 1:1 ratio with polyethyleneimine (PEI)-MAX (Polysciences, Warrington, PA, USA), and after 30 minutes, DNA–PEI complexes were added directly to cells and incubated in OPTI-MEM (Life Technologies, Carlsbad, CA, USA) for 4 hours before OPTI-MEM was refreshed. Expression was maintained at 37 °C in 5% CO_2_ for approximately 90 hours before the collection of conditioned media containing secreted AMH.
Following transfection, conditioned media were concentrated 12.5-fold using Nanosep microconcentrator devices (3 kDa molecular weight cut-off; Pall Life Sciences, Port Washington, NY, USA). The samples were then reduced using β-mercaptoethanol, separated by 10% SDS-PAGE, and analyzed by Western blot. AMH forms were detected using primary mAb-5/6 antibody at 1:5000 dilution (cat no ab24542, Abcam, Cambridge, UK, RRID: AB_2801539). A secondary horseradish peroxidase-conjugated anti-mouse IgG at 1:10 000 dilution (GE Healthcare, Buckinghamshire, UK) was used. The proteins were detected using LumiLight chemiluminescence reagents (Roche, Basel, Switzerland) and a ChemiDoc MP system (Bio-Rad, Hercules, CA, USA). Densitometry was measured using Image Lab^TM^ software (Bio-Rad).
Analysis of AMH bioactivity in vitro
HEK293 cells were plated at 1.5 × 10^4^ cells/well in 96-well plates in DMEM/10% FBS and incubated at 37 °C in 5% CO_2_. The next day, cells were transfected with plasmid DNA consisting of: 4 × BRE-luc (99 ng/well), AMHR2 (0.8 ng/well), and ALK2 (0.3 ng/well) expression constructs (32), following dilution in OPTI-MEM and subsequent complexing with Lipofectamine^TM^ 2000 Transfection Reagent (cat no. 11668019, ThermoFisher Scientific, Carlsbad, CA), according to the manufacturer's guidelines. Transfected cells were then treated with increasing doses of conditioned media containing AMH variants (0-13 ng/mL, collected from transiently transfected cells, as described above) diluted in serum-free media (DMEM high glucose, 1 mM sodium pyruvate, Life Technologies) and 0.01% BSA (Sigma–Aldrich, St. Louis, MO, USA) and incubated overnight at 37 °C in 5% CO_2_. The medium was then removed, and cells were lysed with solubilization buffer (1% Triton X-100, 26 mM glycylglycine [pH 7.8], 16 mM MgSO_4_, 4 mM EGTA, and 900 µM dithiothreitol [DTT]). Lysates were then transferred to white 96-well plates (Corning® Costar®, Corning, NY, USA) before measuring luminescence after the addition of luciferin substrate (Promega, Madison, WI, USA) using a CLARIOstar microplate reader (BMG Labtech, Ortenberg, Germany).
Generation of AmhRKKR/RKKR mutant mice
Mutant Amh^RKKR/RKKR^ mice harboring the 443_RTGR_446→RKKR point mutations (c. 2075C > A, p. 444Thr > Lys, and c. 2077 GG > AA, p. 445Gly > Lys) were generated by the Monash Genome Modification Platform using CRISPR/Cas9 technology on a C57BL/6J background. A guide RNA 5′-tgccgagtggcatgggcgggaagggcgtgggagaacggggcgcagcg-3′ designed to target exon five murine transcript ID ENSMUST00000036016.6 was co-injected with repair template 5′-gccgagtggcatgggcgggaagggcgtgggagaaagaagaggtccgcggggacagggaca-3′) into mouse zygotes. Following homology-directed repair with the injected template, c. 2074_2076 > AAG, and c. 2077_2079 GGG > AAG nucleotide mutations encoding p. Thr444Lys and p. Gly445Lys codon changes were introduced into the genome. Polymerase chain reaction was performed on products (610 bp) amplified from tail clip DNA, using forward (5′-tgctagtcctacatctggctga-3′) and reverse (5′-gtccagggtatagcactaacagg-3′) primers. PCR products then underwent restriction digest with EarI (resulting in 610 and 322 bp/288 bp products), to identify mutant founders to establish the colony. Routine genotyping using tail clip DNA was performed in-house, and mutant mice were bred to homozygosity and compared with age-matched wild-type littermates.
Animal studies
All animal breeding and experimental protocols were approved by the University of Queensland Animal Ethics Committee and conducted in accordance with the relevant codes of practice (National Health and Medical Research Council of Australia). Animals were housed in a 12-hour light/dark cycle with ad libitum food and water. At the experimental endpoint, 12- and 24-week-old (and 52-week-old) animals were collected at the estrus stage of the cycle and weighed, and cardiac puncture was performed under anesthesia to collect terminal blood samples. After coagulation, serum was obtained by centrifugation, then stored at −80 °C for use in serum hormone assays. Reproductive organs were collected, weighed, and the ovaries were either fixed for histological analysis or snap-frozen for transcript analysis. Uteri were weighed, fixed, and processed for histological analyses. To monitor estrous cycle stage lengths, daily vaginal cytology was conducted on 12-week-old female mice for 15 consecutive days (40). Vaginal cytology was also performed to ensure that tissue collections were synchronized at the estrus stage of the cycle. Slides containing vaginal smears were categorized based on the cell types present using methods previously described (40).
Serum hormone assays
Serum AMH (limit of detection 2.3 pg/mL, Ansh Labs, cat no AL-105, RRID:AB_2783659) and inhibin B levels (limit of detection 1.6 pg/mL, Ansh Labs, cat no AL-107, RRID:AB_2783661) were measured using enzyme-linked immunosorbent assay kits following the manufacturer's instructions (Ansh Laboratories Biotechnology, Webster, TX, USA).
Elevated AMH bioactivity in serum collected from Amh^RKKR/RKKR^ mice relative to wild-type littermates was validated ex vivo using the AMH-responsive luciferase reporter assay in HEK293 cells, as described above. Briefly, transfected cells were treated with serum from female wild-type and Amh^RKKR/RKKR^ mice diluted 1:100 in serum-free medium and incubated overnight at 37 °C in 5% CO_2_. The next day, the medium was removed, and cells were lysed before measuring luminescence.
Ovarian histological analysis
Whole ovaries from 12-, 24-, and 52-week-old Amh^WT/WT^, and Amh^RKKR/RKKR^ mice were collected, weighed, and fixed in 10% neutral buffered formalin (NBF) for 24 hours at room temperature. The samples were then processed using Leica ASP300S Tissue Processor (Leica Biosystems) at the University of Queensland School of Biomedical Sciences Histology Core Platform. The processed samples were then paraffin-embedded, and whole ovaries were exhaustively sectioned at 4 µm (Leica RM2245 Microtome), and every 10th section was stained using periodic acid-Schiff reagent and Mayer hematoxylin counterstain. The stained slides were then imaged using an Aperio XT Brightfield slide scanner, and follicles were counted by a blinded assessor using Aperio ImageScope software (Leica Biosystems). Follicle types examined included primordial (oocyte with a clear nucleus surrounded by a single layer of squamous granulosa cells), primary (oocyte with a clear nucleus surrounded by a single layer of cuboidal granulosa cells), secondary (oocyte with a clear nucleus, at least one granulosa cell in the second layer and no visible antrum), small antral (oocyte with a clear nucleus, surrounded by more than two layers of granulosa cells and <200 µm diameter maximal dimension with visible small areas of antral fluid), medium antral (oocyte with a clear nucleus, 200-300 µm with visible antral spaces), large antral (oocyte with a clear nucleus, 300-350 µm with large antral space/s), preovulatory (oocyte with a clear nucleus, >350 µm with single large antral cavity with cumulous surrounding the oocyte) and corpus luteum (consisting of luteinized follicular mass), as previously described (40). Atretic secondary and antral follicles were classified if ≥10% of granulosa cells appeared pyknotic, or if they contained a degenerating oocyte, indicated by the presence of eosinophilia, irregular oolemma, or a fragmented germinal vesicle. The total number of follicles was obtained by multiplying the raw counts of follicle samples by a correction factor of ten (with the exception of the corpora lutea number) to account for sections not enumerated.
Ovarian transcript analysis
Total RNA was isolated from whole ovaries of 12-week-old Amh^WT/WT^ and Amh^RKKR/RKKR^ females using TRIzol (ThermoFisher Scientific) according to the manufacturer's guidelines. Following RNA extraction, 1 µg RNA was reverse-transcribed using SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen; ThermoFisher Scientific). Gene expression was analyzed by qRT-PCR using SYBR primers (Sigma and ThermoFisher Scientific) and a Real-Time PCR detection system (QuantStudio^TM^ 7 Real-Time PCR system, ThermoFisher Scientific). Target gene expression was normalized to the housekeeping gene Rpl19 using cycle threshold (Ct) values, which were logarithmically transformed using the 2^−ΔCT^ method to obtain ΔΔCT. Data are presented as fold change relative to the control sample after being normalized to Rpl19 as the housekeeper. Primer sequences used for gene signatures associated with steroidogenesis (StAR, Cyp19a1, Hsd3b1, Cyp17a, and Hsd17b1), ovarian surface epithelium (Smad6, Igfbp5, Cxcl14, and Id3) (41), and mesenchymal/stromal cells (Tgfbi, Cxcl12, and Igfbp3) (41) are listed in Table 1.
Fertility analyses of female mice
For analysis of fertility, 8- to 12-week-old AMH^WT/WT^, and Amh^RKKR/RKKR^ female mice were mated with age-matched wild-type male proven stud breeders until 3 litters were obtained for up to 5 months, and live offspring numbers were recorded at birth and pup weights were recorded at weaning.
Uterine histological analyses
Uteri were excised and weighed from AMH^WT/WT^ and Amh^RKKR/RKKR^ female mice aged 12 weeks. For each animal, both uterine horns were fixed in 10% (vol/vol) NBF for 24 hours at room temperature. The tissues were then processed, embedded, and sectioned at a thickness of 5 µm. Following sectioning, the uterine sections were dewaxed in xylene (2 minutes each) and rehydrated through a graded ethanol series (100-70%, 2 minutes each) and dH_2_O. For counterstaining, the slides were incubated in Mayer hematoxylin for 15 minutes and then rinsed with tap water until the solution was clear. They were subsequently stained with eosin for 2 minutes and rinsed again. The sections were dehydrated through a graded ethanol series (70-100%, 2 minutes each), cleared with xylene (2 minutes each), and mounted using DPX mounting medium (cat. no AJA3197; ThermoFisher Scientific, Carlsbad, CA). Slides were then imaged using an Aperio XT Brightfield slide scanner, and histological assessment was performed using Aperio ImageScope software (Leica Biosystems).
Analysis of male reproductive tissue
Whole testes from 12- and 24-week-old Amh^WT/WT^ and Amh^RKKR/RKKR^ mice were dissected, weighed, pierced with a fine needle, and fixed in Bouin (Sigma–Aldrich) for 5 hours at room temperature. Testes were processed and paraffin-embedded. After embedding, testes were cut at 5 µm sections, dewaxed, and stained using periodic acid-Schiff reagent and hematoxylin as described above.
Statistical analysis
Data are presented as individual values as well as mean ± standard error of mean (SEM). Data were analyzed using unpaired t-tests, one- or two-way analysis of variance (ANOVA) with Dunnett or Sidak multiple comparisons test as specified (GraphPad Prism 10.3.1). Statistical significance was achieved when P < .05 (α critical value was set at .05).
Results
Optimizing the proteolytic cleavage site of mouse AMH increases the production of bioactive AMH in vitro
Full-length, dimeric 140 kDa AMH precursors undergo proteolytic cleavage to allow the mature bioactive 25 kDa dimers to bind and activate target receptors and subsequent intracellular SMAD1/5/9 signaling (Fig. 1A). Although proteolytic processing is required for AMH bioactivity, intraovarian cleavage is largely inefficient, resulting in approximately 10-fold more unprocessed relative to mature AMH in female follicular fluid (42). We hypothesized that enhancing cleavage efficiency of AMH by modifying two residues in the cleavage site, p. 444Thr > Lys and p.445Gly > Lys, or 443_RTGR_446→RKKR, would favor the formation of mature bioactive AMH. Western blot analysis of conditioned media from HEK293 cells transiently overexpressing wild-type or RKKR forms of mouse AMH revealed that the RKKR modification markedly enhanced processing (Fig. 1B, 1C). Densitometric analyses showed that although total AMH protein levels secreted (precursor AMH + mature AMH) were comparable, there was significantly more (6-fold) mature AMH in medium from cells transfected with the RKKR form (Fig. 1C). To confirm that enhanced processing translated to heightened bioactivity, an AMH-responsive in vitro luciferase-reporter assay was conducted. While medium containing wild-type AMH displayed minimal bioactivity at the concentrations tested, medium containing AMH_RKKR increased luciferase activity markedly, in a dose-dependent manner (Fig. 1D). Indeed, at the highest dose (13 ng/mL), AMH_RKKR medium induced a significantly (P < .0001) and 10-fold higher luciferase response than equal volumes of media containing wild-type AMH (Fig. 1E).
*In vitro analyses of the effect of AMH Thr444Lys and Gly445Lys (RKKR) point mutations. (A) AMH is synthesized as a large precursor, which folds and dimerizes before proteolytic cleavage, yielding the active pro-mature AMH dimer which binds AMHRII, leading to prodomain dissociation and type I receptor recruitment, and subsequent activation of the SMAD1/5/9 signaling cascade. (B) Wild-type (WT) and mutant (RKKR) expression constructs were transfected into HEK293 cells and the resultant AMH forms secreted into conditioned media were assessed by Western blot under reducing conditions, using monoclonal anti-AMH 5/6, directed to the mature domain. (C) Total and mature AMH bands were quantified using densitometric analysis and presented as mean ± SEM from 3 assays replicated with (n = 3) per assay. Data were analyzed using an unpaired t-test, *P < .05. (D) In vitro bioactivity was assessed using HEK293 cells transfected with an AMH-responsive luciferase reporter (BRE-Luc), AMHRII, and ALK2 expression vectors, by overnight treatment with increasing concentrations of WT or RKKR forms of mouse AMH forms (in conditioned media). (E) Analysis of luciferase reporter response (BRE-Luc) at the highest dose (13 ng/mL) of conditioned media containing WT or RKKR forms of mouse AMH. Luciferase activity is presented as mean ± SEM relative to an adjusted value of 1.0 for the mean of wells that received fresh medium alone. The experiment was repeated 3 times. Data were analyzed using a two-way ANOVA with Sidak multiple comparisons test or unpaired t-test ***P < .0001.
Adult female AmhRKKR/RKKR mice have reduced ovarian mass
Following in vitro validation of the mouse AMH 443_RTGR_446→RKKR cleavage site modification, we generated Amh^RKKR/RKKR^ mice. The RKKR cleavage site point mutations (c. 2075C > A, p. 444Thr > Lys, c. 2077 GG > AA, p. 445Gly > Lys) were introduced into exon 5 of the Amh gene in C57Bl6/J mice using CRISPR/Cas9 technology (Fig. 2A). In 12-week-old female Amh^RKKR/RKKR^ mice, total serum AMH levels (Fig. 2B, precursor + mature AMH), and ovarian AMH content (Fig. 2C) were comparable to age-matched Amh^WT/WT^ female mice, supporting our in vitro observations (Fig. 1B, 1C). However, serum from 12-week-old Amh^RKKR/RKKR^ female mice induced a significantly greater (P < .01) and 16% higher luciferase response than age-matched Amh^WT/WT^ female serum in cells transfected with a SMAD1/5/9-responsive reporter and AMH receptors (Fig. 2D), consistent with a higher proportion of cleaved bioactive AMH being released from the ovary into the circulation. The inherently low levels of AMH in serum (<5 ng/200 µL, Fig. 2B) and adult ovaries (<3 ng/ovary, Fig. 2C), limited the ability of immunoblotting to detect enhanced AMH processing. Interestingly, ovaries from 12-week-old Amh^RKKR/RKKR^ mice (2.6 ± 0.7 mg) were significantly (P < .01) and −25% lower in mass, relative to age-matched ovaries of Amh^WT/WT^ females (3.4 ± 0.7 mg) (Fig. 2F), while body weight was unchanged (Fig. 2E). Analyses of the reproductive tracts also revealed a near-significant trend (P = .059) in lower uteri masses for 12-week-old Amh^RKKR/RKKR^ mice (58.5 mg ± 21.5) relative to uteri from Amh^WT/WT^ females (85.3 mg ± 38.9, Fig. 2G). Despite changes in ovarian mass at 12 weeks-of-age, circulating levels of inhibin B, a marker of ovarian function/folliculogenesis assessed by ELISA, were comparable between genotypes (Fig. 2H).
*Generation and characterization of the AmhRKKR/RKKR mouse line. (A) CRISPR/Cas9 technology was used to introduce Thr444Lys and Gly445Lys double mutations into the Amh gene. Total serum AMH (B) and ovarian AMH levels (C) were measured in 12-week-old female mouse by ELISA. (D) Bioactivity in serum was assessed using a HEK293 cell-based AMH-responsive luciferase reporter assay (BRE-Luc). Cells were treated with serum (1:100 dilution in serum-free media) obtained from wild-type (AMHWT/WT) or homozygous mutant (AmhRKKR/RKKR) female mice at 12 weeks of age. Luciferase activity for cells treated with serum is presented as the mean ± SEM, relative to an adjusted value of 1.0 for the mean of wells that received serum-free media. (E) Body, (F) ovary, and (G) uteri masses were recorded for 12-week-old females collected at the estrus stage. (H) Serum inhibin B levels were measured using an inhibin B ELISA in 12-week-old female mice. Data presented as mean ± SEM (n = 6-11/genotype). Data analyzed using unpaired t-tests, *P < .01.
Given that AMH modulates aromatase expression, and that changes in ovarian and uteri masses are often associated with altered steroid tone (43, 44), we examined steroidogenic gene transcripts in whole ovarian lysates via qRT-PCR (Fig. 3A-3E). We found a significant (P < .05) increase (1.8-fold) in StAR transcripts in 12-week-old Amh^RKKR/RKKR^ ovaries relative to Amh^WT/WT^ (Fig. 3A), whereas ovarian transcripts for all other steroidogenic genes examined (Cyp19a1, Hsd3b1, Cyp17a1, and Hsd17b1) were comparable across genotypes (Fig. 3B-3E). Ovarian surface epithelium and mesenchymal/stromal cell genetic markers have also previously been shown to be altered by supraphysiological AMH (41). Accordingly, we examined ovarian surface epithelium (Smad6, Igfbp5, Cxcl14, and Id3) and mesenchymal/stromal cell (Tgfbi, Cxcl12, and Igfbp3) transcript levels in whole ovarian lysates but found no differences between genotypes in 12-week-old female mice all collected at estrus (Fig. 3F-3L).
*Gene expression analyses of whole ovaries via qRT-PCR. Transcriptional markers for (A-E) steroidogenesis, (F-H) ovarian surface epithelium, and (I-L) mesenchymal/stromal cells were measured in whole ovaries of 12-week-old AmhRKKR/RKKR and AMHWT/WT females. Data presented as mean ± SEM (n = 6-8/genotype) and were normalized to housekeeper Rpl19. Data were analyzed using unpaired t-tests, P < .05.
AmhRKKR/RKKR mouse ovaries have more atretic preantral follicles, but estrous cycling, and female fertility are unaffected
Despite the significant reductions in ovarian masses, AMH^RKKR/RKKR^ ovary morphology appeared relatively normal at 12 weeks of age, with follicles present at all developmental stages from primordial through to preovulatory, and corpora lutea (Fig. 4A). Follicle enumeration revealed no quantitative differences in the numbers of primordial, primary, secondary, antral follicles (Fig. 4B), activation rate of primordial follicles (primary-to-primordial ratio, Fig. 4C), or postovulatory corpora lutea (Fig. 4D), in the ovaries of Amh^RKKR/RKKR^ and Amh^WT/WT^ mice. Further classification of antral follicles (Fig. 4E) also revealed no significant differences in the quantities of small, medium, late antral, or preovulatory follicles (Fig. 4F). However, analysis of atretic secondary and antral follicle counts (Fig. 4G) revealed a significantly greater portion (Fig. 4H) of atretic secondary follicles in Amh^RKKR/RKKR^ females relative to Amh^WT/WT^ controls (1.6-fold higher, P < .05).
*Analysis of the ovarian phenotypes in 12-week-old female AmhRKKR/RKKR mice. (A) Ovaries collected from 12-week-old wild-type (AMHWT/WT) or homozygous mutant (AmhRKKR/RKKR) female mice were PAS-stained for histological analysis. Bar represents 200 μm. (B) Growing follicles: primordial, primary, secondary, and antral follicles (arrow heads), the ratio of primary:primordial follicles (C), and corpora lutea (D), were counted in the ovaries of 12-week-old mice. (E) Representative images of each follicle classification (i) primordial, (ii) primary, (iii) secondary, (iv) small antral, (v) medium antral, (vi), large antral, and (vii) pre-ovulatory. Arrows represent antral spaces; scale bar represents 500 μm. (F) Antral follicles were further classified into small antral (<200 μm diameter maximal dimension), medium antral (200-300 μm), large antral (300-350 μm), and pre-ovulatory (> 350 μm) follicles. The number (G) and proportion (H) of atretic secondary and antral follicles were determined. Data presented as mean ± SEM (n = 8-9/genotype). Data analyzed using two-way ANOVA with Sidak post hoc test and unpaired t-tests, P < .05.
Morphologically, the uteri from Amh^RKKR/RKKR^ mice appeared normal at 12 weeks of age, with the glands (arrow heads), stroma (arrows), and myometrial layer (dotted line) all showing consistent morphology across genotypes (Fig. 5A). Examination of vaginal cytology revealed that both 12-week-old Amh^WT/WT^ and Amh^RKKR/RKKR^ mice progressed through all stages of the estrous cycle (Fig. 5B, 5C) and spent comparable time in each stage (Fig. 5D). This indicates that cyclicity, as well as folliculogenesis, were unaltered in 12-week-old Amh^RKKR/RKKR^ females. We also assessed the fertility of Amh^RKKR/RKKR^ females and found that litter sizes (Fig. 5E) and pup weights at weaning (Fig. 5F) were comparable to Amh^WT/WT^ females across 3 litters.
Reproductive characterization of female AmhRKKR/RKKR mice. (A) Uteri collected from 12-week-old wild-type (AMHWT/WT) or homozygous mutant (AmhRKKR/RKKR) female mice at the estrus stage were stained with hematoxylin and eosin for histological analysis (bar represents 500 µm). Representative plots depicting the estrous cycle of individual (B) AMHWT/WT or (C) AmhRKKR/RKKR mice, with y-axis representing the phase of the estrous cycle (P, proestrus; E, estrus; M, metestrus; D diestrus). (D) The number of days spent in each stage of the estrous cycle was quantified for AMHWT/WT (n = 4) and AmhRKKR/RKKR mice (n = 6). AMHWT/WT (n = 3) and AmhRKKR/RKKR (n = 6) dams were mated with AMHWT/WT male studs. (E) Number of pups per litter and (F) pup weights at weaning, for litters produced by AMHWT/WT and AmhRKKR/RKKR dams were measured. Data presented as mean ± SEM and was analyzed using two-way ANOVA with Sidak post hoc test and unpaired t-tests. No significance was detected.
As the ovaries from 12-week-old Amh^RKKR/RKKR^ mice weighed significantly less than those of age-matched Amh^WT/WT^ mice (Fig. 3E), we next assessed whether this difference persisted at 24 weeks. Surprisingly, there were no significant differences in body (Fig. 6A), ovary (Fig. 6B), or uteri masses (Fig. 6C) between 24-week-old Amh^WT/WT^ and Amh^RKKR/RKKR^ mice. While follicle enumeration revealed no differences in the number of primordial, primary, secondary, antral follicles, or corpora lutea across genotypes (Fig. 6D, 6E), 24-week-old Amh^RKKR/RKKR^ mouse ovaries contained both a significantly greater number (Fig. 6F, 4-fold higher, P < .001) and proportion (Fig. 6G, 4.9-fold higher, P < .0001) of atretic secondary follicles relative to Amh^WT/WT^ ovaries. No significant shifts were observed in body, ovary, or uteri masses between female Amh^WT/WT^ and Amh^RKKR/RKKR^ mice aged 52 weeks old (Fig. 6H-6J).
*Analysis of the ovarian phenotype of aged female AmhRKKR/RKKR mice. (A) Body, (B) ovary, and (C) uteri masses were recorded in 24-week-old females collected at the estrus stage. (D) Growing follicles: primordial, primary, secondary, and antral follicles, as well as (E) corpora lutea, were counted in the ovaries of 24-week-old mice. The number (F) and proportion (G) of atretic secondary and antral follicles were determined. (H) Body, (I) ovary, and (J) uteri masses were recorded in 52-week-old females. Data presented as mean ± SEM (n = 4-12/genotype). Data were analyzed using two-way ANOVA with Sidak post hoc test and unpaired t-tests, ***P < .001, ***P < .0001.
Testis morphology appears normal in male AmhRKKR/RKKR mice
As Amh is also expressed in the testis (45), we analyzed the testes in adult male mice. We found that testis, seminal vesicle, and total body weights were comparable at both 12- and 24-weeks of age in Amh^RKKR/RKKR^ and Amh^WT/WT^ male mice, as was overall testis morphology (Fig. 7A-7G). Furthermore, fertility appeared unaffected as male Amh^RKKR/RKKR^ mice produced litters of 4 and 6 pups from two separate mating trials.
Characterization of male AmhRKKR/RKKR mice. (A) Body, (B) seminal vesicle, (C) and testis masses, and (D) representative testis histology (bar represents 200 µM) for 12-week-old AMHWT/WT and AmhRKKR/RKKR male mice. (E) Body, (F) seminal vesicle, and (G) testis masses in 24-week-old male mice. Data presented as mean ± SEM (n = 10-12/genotype). Data were analyzed an using unpaired t-test.
Discussion
Proteolytic maturation of TGFβ superfamily precursor ligands is a crucial rate-limiting step in ligand activation, including for AMH (38, 46-48). We have shown that mouse, human, and feline AMH are inherently poorly processed, resulting in predominantly precursor AMH forms when synthesized in vitro (24, 32). Consistent with this, precursor AMH is the major AMH form in ovarian follicular fluid (42). Here, we investigated whether enhancing AMH proteolytic maturation disrupted ovarian homeostasis in mice. Initial in vitro validation studies supported that enhancement of the mouse AMH furin site (443_RTGR_446→RKKR) significantly increased the proportion of bioactive AMH, confirming that the native site is suboptimal when the protein is overexpressed in HEK293 cells. In vivo enhancement of precursor AMH processing in Amh^RKKR/RKKR^ female mice resulted in modest shifts in ovarian physiology. Indeed, adult 12-week-old Amh^RKKR/RKKR^ female mice had significantly reduced (−25%) ovarian masses, and while maturing follicle numbers were unaffected, the ovaries from both 12- and 24-week-old Amh^RKKR/RKKR^ females comprised a greater proportion of atretic secondary follicles. While this study focused on the impacts of enhanced AMH maturation on adult female reproduction, analyses of male Amh^RKKR/RKKR^ littermates supported that testis functions were not affected.
Marked shifts in ovarian mass are often indicative of significant impacts on folliculogenesis (49). While no quantitative differences in maturing follicles were observed from histological analyses of 12-week-old Amh^RKKR/RKKR^ and Amh^WT/WT^ ovaries, both 12- and 24-week-old Amh^RKKR/RKKR^ females had a significantly greater proportion of atretic secondary follicles within their ovaries. As secondary follicles are highly abundant and represent the largest of the prenatal follicles (100-200 µM), it is plausible that loss of cellular and follicular structural integrity/density in atretic secondary follicles could be contributing to the reductions in ovarian mass in 12-week-old Amh^RKKR/RKKR^ females. However, the fact that ovarian masses were unaltered in 24-week-old Amh^RKKR/RKKR^ females, despite them having 4-fold more atretic secondary follicles, argues that other factors are constraining ovarian mass in these 12-week-old females. An alternate explanation for the reduction in ovarian mass in 12-week-old Amh^RKKR/RKKR^ females could be stromal atrophy, reflective of changes in intraovarian androgens or pituitary-derived gonadotrophic hormones (50). Endocrine analyses of pituitary gonadotropins could offer additional insight into potential stromal influences; however, unchanged antral follicle numbers argue against alterations in circulating FSH levels. Additionally, serum inhibin B, a marker of FSH bioactivity, was unaltered between genotypes.
That the ovaries of both 12- and 24-week-old Amh^RKKR/RKKR^ females comprised a significantly greater proportion of atretic secondary follicles underscores AMH's primary physiological role in preantral follicle survival (10-12). The larger antral follicles in 12- and 24-week-old Amh^RKKR/RKKR^ female ovaries appeared to be less susceptible to AMH-mediated atresia, possibly due to these follicles being less responsive to AMH owing to reduced AMHR2 receptor expression (51), and/or these antral follicles having greater sensitivity to the survival-inducing activity of FSH. Overall, these findings support that altering AMH activation status influences preantral follicle survival in adult female mice. However, enhanced precursor AMH processing does not appear to affect AMH's canonical role in primordial follicle activation (5, 6), suggesting that modest changes in AMH bioactivity are non-disruptive to the ovarian reserve.
As AMH regulates ovarian steroidogenesis (8, 43) and modulates ovarian epithelium and mesenchymal/stromal cell functions (41), we also examined several gene transcripts associated with these processes in whole ovaries. We observed a significant elevation in StAR transcripts in Amh^RKKR/RKKR^ ovaries, which mediates the transport of cholesterol from the outer to the inner mitochondrial membrane, a first and rate-limiting in steroidogenesis (52). While evidence supports that AMH typically attenuates granulosa cell steroidogenesis (44), studies in mice suggest that heightened AMH tone can reshape follicle composition to increase theca cell steroidogenesis (12), which may account for the elevated levels of StAR transcripts in Amh^RKKR/RKKR^ ovaries. Although we were unable to detect any significant changes in other steroidogenic gene transcripts, or ovarian epithelium and mesenchymal/stromal cell markers within whole ovaries, a single-cell RNA sequencing approach assessing distinct cell populations within the ovaries may have permitted the detection of more subtle effects—as observed by Meinsohn and colleagues following exogenous overexpression of AMH (41). The tendency for the uteri in 12-week-old Amh^RKKR/RKKR^ to be lower in mass (P = .059) is suggestive of reduced estradiol tone in these females, however, no shifts in estrogen steroidogenesis genes (Cyp19A1 and Hsd17b1) were observed.
Our data support that while supraphysiological elevations in circulating AMH are disruptive to ovarian folliculogenesis and fertility in mice and cats (22-24), more modest increases in bioactive AMH levels are tolerated, at least in the mouse. By manipulating AMH processing at the genomic level, thereby altering the proportion of bioactive AMH produced from native tissues at normal time points, our results more accurately reflect how changes in physiological AMH tone influence reproductive functions. Indeed, manipulation of the proteolytic maturation state and thereby bioactivity of endogenous AMH affirmed its primary physiological role in constraining preantral follicle survival. That no additional ovarian or fertility consequences, including effects on the ovarian reserve, were observed in Amh^RKKR/RKKR^ females suggests that the low levels of fully processed AMH present within the ovaries are sufficient to sustain AMH functions. Alternatively, precursor AMH may be cleaved extracellularly within the ovarian stroma, and therefore, its abundance in follicular fluid may not accurately reflect its maturation status across the entire ovary (42, 53). Indeed, AMH that has escaped the ovary appears for the most part to be cleaved, as the fully processed AMH bioactive form predominates in serum (42). This would also explain why we only observed a modest spike (16%) in serum AMH bioactivity, using the AMH-responsive luciferase reporter assay, for Amh^RKKR/RKKR^ mice. Consistent with this, analyses of testis secretions from male rodent embryos indicate that AMH is efficiently processed within the embryonic gonad (38).
Although enhancing AMH processing had only a modest impact on female reproduction in the mouse, this does not negate the importance of AMH cleavage as a critical regulatory step in AMH bioactivity. Inhibition of AMH maturation is likely to result in more pronounced reproductive effects, similar to what has been observed in Amh knockout models (6). This is supported by studies on human AMH genetic variants that have been mechanistically shown to reduce AMH activity and are associated with reproductive disorders such as POF (54, 55). Additionally, women with POF exhibit low and declining levels of AMH, reflecting a reduced number of ovarian follicles. Altered AMH levels have also been implicated in the development of PCOS (56-58). Ultimately, the proteolytic maturation of AMH, like most TGF-β ligands, is a tightly governed process and a critical checkpoint for titrating AMH actions.
In conclusion, enhancement of AMH processing reduces ovarian prenatal follicle survival but spares female reproduction in mice. While in vitro optimization of the mouse AMH protease cleavage site is clearly advantageous in favoring the production of bioactive AMH, in vivo this has more modest consequences for ovarian physiology—primarily affecting secondary follicle survival. Emerging evidence supports that while AMH is poorly processed, AMH is optimally and sufficiently processed to regulate physiological processes in the mouse. Ultimately, this data reflect the complex nature of physiological systems in the governance of TGF-β ligand activation, suggesting that the proportions of pro:mature ligand forms in circulation may not accurately reflect their activity potential. Further studies are needed to elucidate the mechanisms by which AMH precursor forms are activated within the ovary, with implications for both ovarian homeostasis and reproductive aging.
The reference list from the paper itself. Each links out to its DOI / PubMed record.
- 1Jost A, Gonse-Danysz P, Jacquot R. Studies on physiology of fetal hypophysis in rabbits and its relation to testicular function. J Physiol Paris. 1953;45(1):134‐136.13062163 · pubmed ↗
- 2Jost A . On the derived streams of castrated rabbit embryos of both sexes at 21 days. C R Seances Soc Biol Fil. 1947;141(3-4):135.20268971 · pubmed ↗
- 3Mullen RD, Behringer RR. Molecular genetics of Müllerian duct formation, regression and differentiation. Sex Dev. 2014;8(5):281‐296.25033758 10.1159/000364935 PMC 4378544 · doi ↗ · pubmed ↗
- 4Dewailly D, Andersen CY, Balen A, et al The physiology and clinical utility of anti-Mullerian hormone in women. Hum Reprod Update. 2014;20(3):370‐385.24430863 10.1093/humupd/dmt 062 · doi ↗ · pubmed ↗
- 5Durlinger AL, Gruijters MJ, Kramer P, et al Anti-Mullerian hormone inhibits initiation of primordial follicle growth in the mouse ovary. Endocrinology. 2002;143(3):1076‐1084.11861535 10.1210/endo.143.3.8691 · doi ↗ · pubmed ↗
- 6Durlinger AL, Kramer P, Karels B, et al Control of primordial follicle recruitment by anti-Mullerian hormone in the mouse ovary. Endocrinology. 1999;140(12):5789‐5796.10579345 10.1210/endo.140.12.7204 · doi ↗ · pubmed ↗
- 7Xu J, Bishop CV, Lawson MS, Park BS, Xu F. Anti-Müllerian hormone promotes pre-antral follicle growth, but inhibits antral follicle maturation and dominant follicle selection in primates. Hum Reprod. 2016;31(7):1522‐1530.27165618 10.1093/humrep/dew 100PMC 4901882 · doi ↗ · pubmed ↗
- 8Visser JA, Themmen APN. Role of anti-Müllerian hormone and bone morphogenetic proteins in the regulation of FSH sensitivity. Mol Cell Endocrinol. 2014;382(1):460‐465.23994017 10.1016/j.mce.2013.08.012 · doi ↗ · pubmed ↗