Effect of mixed infection with Trypanosoma cruzi and the fungus Metarhizium anisopliae on survival, parasitemia, and immune response in Triatoma pallidipennis (Hemiptera: Reduviidae)

TL;DR

This study explores how a fungus and a parasite interact in a bug that spreads Chagas disease, showing how they affect the bug's survival and immune system.

Contribution

The study reveals how coinfection with a fungus and a parasite alters immune gene expression and parasitemia in a Chagas disease vector.

Findings

Coinfection reduced parasitemia, suggesting interference between the fungus and the parasite.

Metarhizium anisopliae caused the highest mortality in infected insects.

Immune gene expression varied significantly depending on the type of infection and gut region.

Abstract

Entomopathogenic fungi (EPF) are promising tools for controlling vectors of Chagas disease, yet the immunological effects of simultaneous infection with Trypanosoma cruzi and EPF remain largely unknown. We investigated how single infections with T. cruzi (Tc) or Metarhizium anisopliae (Ma), and coinfection (Tc+Ma), affect survival, parasitemia, and immune gene expression in Triatoma pallidipennis (Stål, 1872). Survival of T. pallidipennis differed significantly among treatments, insects only infected with Ma causing the greatest mortality. Parasitemia decreased notably in coinfected insects, suggesting interference between pathogens. Gene expression patterns varied across gut regions: phenoloxidase was strongly upregulated in Ma infections, but reduced in coinfection; defensins increased primarily in Tc infections; and lectins were elevated in Tc and Ma single infections but consistently suppressed in coinfection. These results indicate that M. anisopliae remains effective as a biocontrol agent even in infected insects with T. cruzi, and that competitive interactions between fungus and parasite modulate both parasitemia and the insect’s immune response.

Figures

Survival of fifth instar nymphs (n5) infected with Trypanosoma cruzi (Tc), Metarhizium anisopliae (Ma), and both pathogens (Tc+Ma); n = 25.

Parasitemia in fifth instar nymphs (n5) infected with Trypanosoma cruzi (Tc) or T. cruzi + M. anisopliae (Tc+Ma); n = 15. Bars indicate SD.

Dynamics of gene expression in the gut of T. pallidipennis infected with T. cruzi and/or M. anisopliae. The relative expression levels from phenoloxidase (PPo, A and B), defensins (Def, C and D), and Lectin (Lect, E and F) were measured in the anterior midgut (AMG) and posterior midgut (PMG) segments. Triatoma pallidipennis nymphs were infected with T. cruzi (Tc) or M. anisopliae (Ma) or with both pathogens (Tc+Ma). Gene expression was assessed before infection (day 0, D0) and after infection (day 9, D9). The bars indicate the fold change in expression at D9 (gray) relative to D0.

Tables

Table 1.. Primer sequences for immune response genes

Name	Forward (3′-5′)	Reverse (5′-3′)	Target
Phenoloxidase (PPo)	CACGCGGTATTGATATCTTGGG	GATCATGACAGAGCGCAATGG	Insect
Defensins (Def)	CGCCCTGGCTTACTCATATC	CACAGGTGGCTCTCTTCAGAC	Insect
Lectins (Lect)	TCCCACCAAACTTCCACTCC	GGCAAAGATGAACCGCTACC	Insect
β-Actin housekeeping (Act)	CACCCCAGCAATGTATGTAG	ACCATCAGGAAGTTCGTAAG	Insect

Full text

Introduction

The flagellate parasite T. cruzi (Trypanosomatida: Trypanosomatidae) causes Chagas disease, which is recognized as a chronic disease by the World Health Organization (WHO) (WHO 2019). Although several forms of human transmission of Chagas disease have been reported, vector transmission remains the most important (Carbajal-de-la-Fuente et al. 2023). After ingesting blood from an infected mammal, T. cruzi differentiates in the digestive tract of the vector. In the anterior midgut (AMG), blood trypomastigotes transform into spheromastigotes; in the posterior midgut (PMG), epimastigotes anchor to the perimicrovillar membrane and replicate. Metacyclogenesis occurs in the rectum, producing metacyclic trypomastigotes that constitute the infective phase of the parasite and are shed in the vector’s feces and urine (Nogueira et al. 2015). The gut is also the site of interactions between T. cruzi and other symbiotic microorganisms, such as bacteria and fungi, that enable or disrupt parasite establishment (Schaub 2024). The triatomine species T. pallidipennis, a major vector of T. cruzi in central Mexico (Alejandre-Aguilar et al. 2023), offers a relevant model for exploring these interactions.

Historically, triatomine control has relied on the use of pyrethroid insecticides; however, in recent decades, resistance has been reported in species such as Triatoma infestans and Rhodnius prolixus (Mougabure-Cueto and Picollo 2015). Furthermore, these products have little effect on triatomine eggs, allowing for recolonization of houses after fumigation. An alternative for controlling T. cruzi vectors is EPF, such as Metarhizium anisopliae (Hypocreales: Clavicipitaceae), which causes high mortality in all nymphal instars and adult stages of triatomines (Flores-Villegas et al. 2016, Rangel et al. 2020, Toriello et al. 2022). The infection mechanism requires contact between conidia and the cuticle, and the fungus is capable of inducing a systemic immune response through structures such as blastospores and the production of immunosuppressive substances such as destruxins and some proteases (Thomas and Read 2007).

An infection by EPF activates the immune response, disrupts intestinal homeostasis, and triggers the expression of signaling pathways that have evolved to fight this type of pathogen, such as the IMD pathway, which produces antimicrobial peptides (AMPs); the Toll pathway, which is involved in the binding of pathogens to their recognition protein; and the Janus kinase (JAK)/STAT pathway, which regulates melanization by the enzyme phenoloxidase (Zeng et al. 2022). Other key components of the humoral immune response in insects are based on enzymes such as phenoloxidase (PPo), AMPs such as defensins (Def), and pattern recognition proteins (PRPs) such as lectins (Lect) (Flores-Villegas et al. 2015). PPo is responsible for the production of melanin to encapsulate pathogens (Cerenius and Söderhäll 2021). Def are among the most important AMPs with activity against Gram-positive bacteria and fungi (Díaz-Garrido et al. 2018). Lectins, which are glycoproteins with agglutination activity against Trypanosoma cruzi, are involved in cellular processes such as encapsulation, phagocytosis, and nodulation (Ratcliffe et al. 2024).

On the other hand, insects are affected by various types of parasites and pathogens throughout their life cycle. Insect vectors are an interesting case because, in addition to being a necessary intermediate for the transmission and, in some cases, development of the parasites they harbor, they can simultaneously acting as host to other types of parasites and pathogens while functioning as vectors (Singh et al. 2017, Vieira et al. 2018, Ratcliffe et al. 2024).

Different models have been proposed to explain the outcome of mixed infections in hosts. On the one hand, it is possible that the invasion of 2 or more parasite species is completely detrimental to the host, exerting a synergistic pathological effect (Dutt et al. 2022). A second possibility is that certain combinations of parasites may be beneficial to the host, in which case the parasites could be competing species once established in a host (Dutt et al. 2022, Venter et al. 2022, Trillo et al. 2023). Notably, some studies report that coinfection with T. cruzi and M. anisopliae can increase vector survival compared with infection by the fungus alone, suggesting competitive interactions or immunomodulatory effects exerted by T. cruzi (Garcia et al. 2016, Flores-Villegas et al. 2020).

As noted above, this study explored how single infections with T. cruzi (Tc), M. anisopliae (Ma), and mixed infections (Tc+Ma) influence the survival, parasitemia, and immune response of T. pallidipennis. To characterize the humoral response, we quantified the expression of genes encoding PPo, Def, and Lect in the anterior and PMG. Together, these analyses provide insight into the physiological and immunological interactions occurring when a major Chagas disease vector is simultaneously exposed to its natural parasite and a potential biological control agent.

Materials and Methods

Insect Rearing and Sourcing

Fifth instar (n5) Triatoma pallidipennis nymphs were used, bred under laboratory conditions (60% RH, 28 °C and a 12:12 h light/dark photocycle) in the insectarium of the Parasite Biology Laboratory of the Faculty of Medicine, UNAM.

Trypanosoma cruzi Isolate

The isolate used was Morelos ITRI/MX/12/MOR, named after the WHO nomenclature (Favila-Ruiz et al. 2018). It was first isolated in 2012 from a T. pallidipennis specimen collected in Cuernavaca, Morelos. The strain is biologically and molecularly characterized as TCI and is maintained in the Parasite Biology Laboratory by cyclic passages in CD-1 mice (Favila-Ruiz et al. 2018). Mice were reared and provided by Unidad Académica de Bioterio (UAB), authorized and accredited by Servicio Nacional de Sanidad, Inocuidad y Calidad Agroalimentaria (SENASICA) from Facultad de Medicina, UNAM. Mice were maintained in accordance with NOM-062-ZOO-1999 “Technical specifications for the production, care and use of laboratory animals,” in the accommodation room from Departamento de Microbiología y Parasitología, from the same faculty, conditions were 40% to 60% RH, 12:12 h light/dark photocycle, a maximum of 85 decibels, with not food and water restrictions in cages (19.05 × 29.21 × 12.7 cm, with 4 animals/cage). The appropriate Ethics Committee approved this study with permit No. 001-2020/004-CIC-2020.

Metarhizium anisopliae and Conidial Formulation

Monospore cultures of the M. anisopliae strain EH-473/4 were used. The strain was isolated in 1994 from a specimen of Aeneolamia sp. (Hemiptera: Cercopidae) collected from a sugar cane crop in San Luis Potosí, Mexico. The isolate is held in the repository of the Basic Mycology Laboratory, Department of Microbiology and Parasitology, Faculty of Medicine, UNAM, and is registered in the World Federation for Culture Collections (WFCC) as BMFM-UNAM 834.

The fungus M. anisopliae (473/4) was grown on potato dextrose agar (PDA) plates at 27 °C for 10 d. Airborne conidia were obtained by scraping the surface of the culture with a spatula. A liquid formulation was prepared consisting of M. anisopliae adjusted at 10^9^ conidia/ml as the active ingredient, plus 90% vegetable oil, 8% emulsifiers, and 2% humectant. The viability of conidia in the formulation was assessed prior to each bioassay, as described by Murillo-Alonso et al. (2019). The viability of the formulated conidia was >95% in all cases.

Infection Procedures

Trypanosoma cruzi infection

The insects were fasted for 10 d after molting from n4 to n5 and then fed on female CD-1 mice weighing 20 to 25 g, previously inoculated intraperitoneally with 20,000 parasites/ml. The mice were used for feeding 20 d after infection, which corresponds to the growth phase of the T. cruzi isolate ITRI/MX/12/MOR. The control group of triatomines was fed on uninfected mice. A single anaesthetized (combined xylazine 5 mg/kg and ketamine 100 mg/kg, intraperitoneally) CD-1 mouse was positioned in a special dispositive to feed triatomines and protect the rodent’s well-being. The device consists of a rounded plastic container (30 mm diameter × 15 mm long) with a mesh for abdomen exposition and a hold on the container top for mouse breath. One time feeding session (3 insects/mouse) lasted 20 min for both groups (not enabling a total engorgement). The experiments were performed on dark conditions (Favila-Ruiz et al. 2018). All animal procedures were approved by Internal Committee for the Care and Use of Laboratory Animals, in Spanish, Comité Interno para el cuidado y uso de animales de laboratorio (CICUAL), from Facultad de Medicina, UNAM, with permit No. 001-2020/004-CIC-2020.

Metarhizium anisopliae infection

Plastic containers (17 × 16 cm) lined with sterile filter paper were used. Five milliliters of the emulsified formulation (water formulation 1:10, v/v) of conidia (10^9^ conidia/ml) was applied to the filter paper using a manual sprayer. Nymphs from each group were then placed in the container. For the control treatment, 5 ml of sterile distilled water was sprayed. After 10 min of exposure to the treated surface, each insect was individually transferred to Petri dishes and maintained at 28 °C and 80% RH. Insect mortality was recorded every 24 h for 15 d.

Coinfection by T. cruzi and M. anisopliae

Insects were first infected with T. cruzi as described above. Within 24 h of confirmation of parasite infection, the insects were infected with M. anisopliae as described above.

Confirmation of Infection and Quantification of Parasites

In the nymph groups infected (*n *= 15, per treatment) with T. cruzi and coinfection by T. cruzi and M. anisopliae, the presence of the parasite was confirmed 9 d after infection. Rectal contents were obtained by abdominal pressure, and feces were placed in an Eppendorf microtube with 20 μl of isotonic saline (0.9%). The mixture was vortexed for 1 min and diluted 1:10 for parasite counting in a Neubauer chamber under a 40× objective on an Olympus CH2 light microscope.

Gut Extraction and Processing

The gut of insects from each experimental group was removed on day 0 (*n *= 8; total sample = 24) and day 9 post infection (*n *= 8; total sample = 24) (Lobo et al. 2015). Each specimen was placed in a Petri dish with ice and dissected under a stereoscopic microscope (Carl Zeiss, Stemi 2000). The abdomen of each insect was first cleaned with a swab impregnated with 70% alcohol, and the insect’s limbs were removed to prevent movement. The fat body and Malpighian tubules were separated with entomological forceps under a stereoscopic microscope, and the intestine was dissected and sectioned into anterior midgut (AMG) and PMG. Samples were washed with 200 μl of 1× PBS, pH 7, during the procedure.

RNA Extraction and Synthesis of Complementary DNA (cDNA)

Total RNA was extracted using the Trizol method (Life Technologies, United States), which was adapted and standardized for 100 mg of tissue; the protocol includes homogenization and lysis, phase separation, RNA precipitation, washing and elution. Two hundred microliters of Trizol was added to each sample. The mixture was manually homogenized with a pestle (Axygen, PEs-15-B-SI), transferred to 1.5-ml tubes, and incubated for 5 min at room temperature. Then, 200 μl chloroform was added; samples were vortexed (Thomas Scientific 945700) at maximum speed for 15 s and incubated for 3 min at room temperature. The samples were then centrifuged at 12,000 × g for 15 min at 4 °C. The aqueous phase was transferred to a new tube and 500 μl of cold isopropanol was added, mixed by inversion and allowed to precipitate overnight at −20 °C to improve RNA recovery. The sample was then centrifuged at 12,000 × g for 10 min at 4 °C; the supernatant was removed and the pellet was washed with 500 μl of 75% ethanol, centrifuged at 7,500 × g for 5 min, and washed again. The pellet was washed again with 1 ml of 100% ethanol and dried by inverting the tubes on a rack for 10 min. The pellet was resuspended with 50 to 100 μl of injectable water, depending on the size of the pellet, and stored at −70 °C until use.

Total RNA was quantified using a Nanodrop spectrophotometer. Purity was estimated by spectrophotometry at 260/280/230 nm, and RNA integrity was assessed on a 2% agarose gel. Prior to the reverse transcriptase reaction, RNA was pretreated with DNase (RQ1 RNase-free DNase, Promega) to remove contaminating DNA. To each tube, 1 μl 10× DNase buffer (Promega) and 1 μl DNase were added, and samples were incubated at 37 °C for 30 min; the reaction was stopped with 1 μl Stop Solution (Promega) and incubated at 65 °C for 10 min.

cDNA synthesis was performed with a high-capacity reverse transcription kit (Applied Biosystems-Thermo Fisher), using 10 μl of RNA, according to the manufacturer’s instructions and using random primers included in the kit.

Quantitative PCR

Quantitative PCR (qPCR) was performed with specific oligonucleotides for PPo, Def, and Lect, genes encoding proteins involved in the insect humoral immune response (Lobo et al. 2015), and β-actin (Act), a housekeeping gene abundant in the cytoskeleton. The oligonucleotide sequences are listed in Table 1. All oligonucleotides were previously tested for the absence of dimers or cross-hybridization. For qPCR, cDNA samples (1:10 dilution) and a Rotor-Gene Q thermocycler (Qiagen, Hilden, Germany) were used. SYBR Green dye (2× KAPA SYBR FAST qBioline) was used for fluorescence detection. Each reaction mixture consisted of 5 μl SYBR Green, 2 μl cDNA, 2 μl primers, and 1 μl ultrapure water.

The amplification conditions for the primers were set as follows: denaturation at 95 °C for 10 min, followed by 40 cycles of three amplification segments (30 s at 95 °C for denaturation, 30 s at 55 °C for alignment, and 30 s at 72 °C for chain extension). Reaction mixtures containing the primers but no cDNA template were used as blanks. The assay was performed in duplicate. The DDCt method was used to quantify gene expression, and the change in relative expression was calculated as the change in induction between day 0 and day 9. The mean and standard error of eight independent biological and 2 technical replicates are reported.

Statistical Methods

An independent group was used to assess the effect of treatments on triatomine survival; mortality was recorded daily for 30 d after each treatment on fifth-instar nymphs (n = 25 per treatment). Survival was evaluated using the Kaplan–Meier estimator. Median survival was analyzed using the log-rank Mantel–Cox test. For all tests, differences were considered significant at *P *< 0.05. Differences in parasitemia between groups infected with T. cruzi (Tc) and coinfection by T. cruzi and M. anisopliae (Ma) were analyzed using an unpaired t-test. Repeated measures ANOVA followed by Tukey’s post hoc test was used to analyze gene expression as a function of treatment. All experiments were performed in duplicate and data are expressed as mean ± SD. Statistical analyses were performed with GraphPad Prism 9 v.9.4.1.

Results

Survival Dynamics of Triatoma pallidipennis

Survival was significantly different between the three groups (χ^2^ = 19.22, *P *< 0.001) (Fig. 1). Survival in the T. cruzi-infected group was 100% (*n *= 25) at 15 d. In the M. anisopliae-infected group, 0% (*n *= 25) survival was observed at day 10. Meanwhile, in the group infected with T. cruzi + M. anisopliae, survival was 0% (*n *= 25) on day 13. We found significant differences in survival between Tc and Ma (χ^2^ = 15.01, *P *= 0.0001). Significant differences were also observed between Tc and Tc+Ma (χ^2^ = 15.74, *P *< 0.001). In contrast, no significant differences were found between Ma and Tc+Ma (χ^2^ = 0.0077, *P *= 0.9299). The median survival time (day on which 50% of the population was alive) was day 6 for the Ma and Tc+Ma groups and was not calculated for the Tc group because there was no mortality from day 15 to day 30.

Survival of fifth instar nymphs (n5) infected with Trypanosoma cruzi (Tc), Metarhizium anisopliae (Ma), and both pathogens (Tc+Ma); n = 25.

Parasitemia

On day 9 post-infection, 320,000 parasites/ml were counted in the T. cruzi-infected group, while insects infected with T. cruzi + M. anisopliae harbored 4,000 parasites/ml (*F *= 5.6; df = 14; *P *= 0.0025) (Fig. 2).

Parasitemia in fifth instar nymphs (n5) infected with Trypanosoma cruzi (Tc) or T. cruzi + M. anisopliae (Tc+Ma); n = 15. Bars indicate SD.

Infection Modulates Phenoloxidase Expression in T. pallidipennis Gut

At 9 d post infection (D9), phenoloxidase (PPo) expression in the anterior midgut (AMG) was higher when induced by M. anisopliae (54.2-fold). Co-infection (Tc+Ma) resulted in a reduction of this response (5-fold). Significant differences were observed between Tc and Ma (*P *< 0.0001) and between Ma and Tc+Ma (*P *< 0.0001) groups at day 9, but not between Tc and Tc+Ma (*P *= 0.9991) (Fig. 3A).

Dynamics of gene expression in the gut of T. pallidipennis infected with T. cruzi and/or M. anisopliae. The relative expression levels from phenoloxidase (PPo, A and B), defensins (Def, C and D), and Lectin (Lect, E and F) were measured in the anterior midgut (AMG) and posterior midgut (PMG) segments. Triatoma pallidipennis nymphs were infected with T. cruzi (Tc) or M. anisopliae (Ma) or with both pathogens (Tc+Ma). Gene expression was assessed before infection (day 0, D0) and after infection (day 9, D9). The bars indicate the fold change in expression at D9 (gray) relative to D0.

In the PMG, the group infected with Ma led the expression levels (5-fold). Significant differences were observed between Tc and Ma (*P *= 0.0236) and between Ma and Tc+Ma (P < 0.0001) (Fig. 3B).

Infection Modulates Defensins Expression in T. pallidipennis Gut

The expression of the gene encoding Def in the AMG of T. pallidipennis increased mainly in the group infected with T. cruzi (8.2-fold), while it increased only 2.9-fold in the group infected with M. anisopliae. No significant differences were observed between Ma and Tc+Ma (*P *= 0.8929), but there were differences between Tc and Tc+Ma (*P *= 0.0003) and between Tc and Ma (*P *< 0.0001) (Fig. 3C).

In the PMG, Def expression in the Tc+Ma group decreased by 0.5-fold, with no significant differences observed with the Ma group (*P *= 0.0897), although there were differences with Tc (*P *= 0.0426). No significant differences were observed between Tc and Ma (*P *= 0.9952) (Fig. 3D).

Infection Modulates Lectins Expression in T. pallidipennis Gut

Lect expression in the AMG increased with monoinfections: group infected with T. cruzi (20.8-fold) and infected with M. anisopliae (20.7-fold) compared to baseline (D0). Interestingly, the Tc+Ma group showed a low fold change (1.8) (Fig. 3E). Significant differences were only observed between Tc and Tc+Ma (*P *< 0.0001) and between Ma and Tc+Ma (*P *< 0.0001) (Fig. 3E).

Significant differences were observed in the expression of Lect in the PMG of Triatoma pallidipennis across all groups (Fig. 3F). Overall, in the group infected with T. cruzi, this expression increased 8.7-fold. Significant differences were found between Tc and Ma (*P *< 0.0001), between Ma and Tc+Ma (*P *= 0.0013), and between Tc and Tc+Ma (*P *< 0.0001).

Discussion

The infection of T. pallidipennis with T. cruzi, M. anisopliae, or both pathogens simultaneously leads to distinct physiological and immunological outcomes. These differences are reflected in variation in vector survival, parasitemia and differential expression of key immune-related genes across anterior and PMG. Together, these findings indicate that single and mixed infections elicit markedly different host responses throughout the course of infection, highlighting the complex interplay between the subpathogen and the entomopathogenic fungus within the triatomine vector.

Comparison between Tc and Ma indicated that individuals treated with the EPF died earlier. This is consistent with previous studies that also reported 0% survival in triatomines on days 8 to 10 after infection with M. anisopliae (Flores-Villegas et al. 2016, Flores-Villegas et al. 2020, Toriello et al. 2022), highlighting the ability of the EPF to reduce insect survival. In contrast, the group infected with T. cruzi showed no mortality during the first 15 d after infection, and survival was recorded until the adult stage (50 d after infection), in line with the findings of Franzim-Junior et al. (2018).

When the insects were co-infected with T. cruzi and M. anisopliae, survival was prolonged to 13 d, although the difference in survival with the Ma group was not significant. In this regard, previous studies suggest a protective effect or tolerance in the insect against microorganisms that may compete with the parasite for resources (Garcia et al. 2016, Flores-Villegas et al. 2020).

A significant reduction in the number of parasites was observed in the co-infected group compared to the Tc group. The reduction in parasitemia has been described as possibly due to the fungal blastospores encapsulating or phagocytosing the parasite (Ma et al. 2023) or even releasing secondary metabolites such as destruxins (dtx) into the insect’s hemolymph and gut, triggering a systemic response (Yin et al. 2021). An alternative explanation is that dtx, due to their antibiotic activity, could inhibit the development of microorganisms competing for the same substrate (Lobo et al. 2015).

Our results show that in the AMG, PPo expression is elevated in the group infected with M. anisopliae, but it decreases when the insects are infected only with T. cruzi or in the mixed infection T. cruzi + M. anisopliae. In the PMG, the response is similar: lower expression levels when T. cruzi is present, either alone or in co-infection with M. anisopliae. This suggests that phenoloxidase is expressed at high levels in both regions of the intestine during infection with an EPF, as previously reported (Duffield et al. 2023). Phenoloxidase expression has been studied in Triatoma infestans exposed to the fungus Beauveria bassiana, and high expression of the gene has been reported in the nine days following treatment with the EPF (Lobo et al. 2015).

Def expression in the AMG was elevated in the group infected with T. cruzi and decreased in groups infected only with M. anisopliae or co-infected with T. cruzi and M. anisopliae. In the PMG, the pattern of Def expression was similar: high in T. cruzi and M. anisopliae, but lower in co-infection with both pathogens. It is possible that in this gut segment, replication of the infective stage of the parasite (metacyclic trypomastigote) causes high levels of expression of this gene when the insect is infected with T. cruzi, while expression decreases when the pathogen is M. anisopliae or in mixed infections. The trypanocidal activity of defensins has been demonstrated in T. pallidipennis (Díaz-Garrido et al. 2021). In our study, the Def gene significantly increased its expression in monoinfections with T. cruzi. In contrast, another study observed a lower expression of this gene in T. infestans when infected with B. bassiana, indicating a poor effect of this antimicrobial peptide against fungi (Lobo et al. 2015).

In the AMG, lectin (Lect) expression was elevated in the group infected with either T. cruzi or M. anisopliae and low in the group co-infected with T. cruzi and M. anisopliae, while in the PMG, lectin expression was higher in the T. cruzi group compared to both the M. anisopliae-infected group and the mixed infection group. Lectins show agglutinating activity against T. cruzi in the hemolymph and gut of the vector Rhodnius prolixus (Araújo et al. 2021). During EPF infections, lectins are highly expressed in insects such as Helicoverpa armigera (Gui-Jie et al. 2023). In contrast, Lobo et al. (2015) reported a low Lect expression in T. infestans infected with B. bassiana. Our results confirm that there is a high lectin-mediated immune response in the AMG and PMG in monoinfections with T. cruzi. Similarly, infection with M. anisopliae in the PMG elicited a high lectin response, in contrast to the findings of Lobo et al. (2015) using B. bassiana as EPF. A possible explanation is that while lectin activity remains low in the AMG, perhaps due to low protozoan replication and/or damage by the EPF, a higher response is observed in the PMG due to greater flagellate replication and/or damage caused by this parasite.

In general, the group infected with T. cruzi showed high expression of defensins and lectins, while insects infected with M. anisopliae showed high expression of phenoloxidase and lectins. Interestingly, co-infection with both pathogens resulted in lower expression of phenoloxidase, defensins and lectins, suggesting that the immune response is differentially expressed.

Our results demonstrate that the expression of humoral response genes in the gut of the vector T. pallidipennis differs in the insect during interaction with T. cruzi and/or M. anisopliae as a biological control agent. In strategies involving the use of biocontrol agents such as EPFs, it is critical to consider the life history, behavior, and immune response of the insect in order to develop effective biological insecticides for the control of medically important vectors.

Finally, future studies should investigate the gut microbiota, which may interact with T. cruzi and M. anisopliae, incorporate additional physiological parameters such as reproductive and developmental impacts, and quantify fungal load throughout infection progression.