Bovine respiratory syncytial virus utilizes the human insulin-like growth factor 1 receptor in the late stages of infection

TL;DR

This study shows that the bovine respiratory syncytial virus uses the human insulin-like growth factor 1 receptor to spread efficiently in later stages of infection.

Contribution

The study reveals a novel role of IGF1R in the late stages of BRSV infection, not required for initial entry.

Findings

A recombinant BRSV with a ZsGreen reporter gene was successfully generated and showed similar growth to the wild-type virus.

HEK293T cells were found to be permissive to BRSV infection.

IGF1R is not essential for early BRSV infection but supports efficient viral propagation at later stages.

Abstract

Bovine respiratory syncytial virus (BRSV) is a major viral pathogen associated with the bovine respiratory disease complex, which is a leading cause of morbidity, mortality and economic loss in the cattle industry worldwide. Clinical infection is most severe in young calves, where it commonly causes lower respiratory tract inflammation, bronchopneumonia and predisposition to secondary bacterial infections. In experimental research, BRSV is typically maintained in Vero and MDBK cells. Although reverse genetics systems have been established for BRSV, we developed a bacterial artificial chromosome-based reverse genetics system for the virus. We successfully recovered a recombinant BRSV with the ZsGreen reporter gene inserted between the P and M genes. The recombinant virus displayed comparable growth kinetics to the WT strain, demonstrating the utility of the system for generating reporter viruses. Reporter virus infectivity assessments in mammalian MDBK, VeroE6, HEp-2 and HEK293T cells revealed that HEK293T cells are permissive to BRSV. To investigate the potential role of human insulin-like growth factor 1 receptor (hIGF1R), which human RSV uses for entry, we infected insulin-like growth factor 1 receptor (IGF1R)-knockout (KO) 293 T cells with BRSV-ZsGreen. At 24 h post-infection (hpi), ZsGreen levels were similar between WT and hIGF1R-KO cells; however, by 72 hpi, viral spread was markedly reduced in hIGF1R-KO cells and correlated with IGF1R levels. These findings suggest that IGF1R is dispensable for early BRSV infection but contributes to efficient viral propagation in later stages.

Figures

Generation of recombinant BRSV expressing the ZsGreen gene using a BAC. (a) Schematic diagram of the construction of the minigenome and helper plasmids. Grey triangle, T7 promoter; HHR, hammerhead ribozyme; tr, trailer sequence; GE, gene end; Nluc, NanoLuc luciferase; GS, gene start; le, leader sequence; HDVR, hepatitis D virus ribozyme; black triangle, CAGGS promoter; N, N gene of BRSV; L, L gene of BRSV; P, P gene of BRSV; M2-1, M2-1 gene of BRSV. The pBAC-T7-bRSV minigenome was transfected into BHK/T7-9 cells along with four helper plasmids. The transfected cells were lysed, and luciferase activity was measured using GloMax Explorer (Promega) to assess minigenome activity. *P<0.001, as determined by statistical analysis. (b) Schematic diagram of the full-length cDNA used for generating the recombinant BRSV-A51908-ZsGreen virus. pBAC-T7-BRSV-A51908-ZsGreen was transfected into BHK/T7-9 cells along with four helper plasmids, and the recombinant BRSV-A51908-ZsGreen virus was recovered from the transfected cells. (c) ZsGreen signal detected in BHK/T7-9 cells transfected with pBAC-T7-BRSV-A51908-ZsGreen along with helper plasmids. L+. BHK/T7-9 cells transfected with pBAC-BRSV-A51908-ZsGreen, pCAGGS-BRSV-N, P, M2-1 and L. L–: BHK/T7-9 cells transfected with pBAC-BRSV-A51908-ZsGreen, pCAGGS-BRSV-N, P and M2-1, but without L. On day 6 post-transfection, ZsGreen signal was observed using an EVOS M7000 microscope. (d) Growth of the recombinant virus in comparison with that of the parental virus, BRSV-A51908. Vero E6 cells were infected with rec-BRSV-A51908-ZsGreen at an MOI of 0.1. The infected cells were frozen and thawed at the indicated time points and centrifuged. The virus titre in the supernatant was subsequently determined using the TCID50 method. The parental virus, BRSV-A51908, was used as a control.

Proliferation of BRSV in cultured cells as assessed using the reporter virus, rec-BRSV-A51908-ZsGreen. (a) rec-BRSV-A51908-ZsGreen was infected into the indicated cells at an MOI of 0.1. At 24 and 48 hpi, ZsGreen signals were observed using a M7000 microscope. (b) Virus titre in cells infected with rec-BRSV-A51908-ZsGreen. Cells were infected with rec-BRSV-A51908-ZsGreen at an MOI of 0.1. At 48 hpi, the cells were freeze-thawed three times. Lysates were obtained by centrifugation and subjected to a TCID50 assay. Error bars indicate standard deviations of three independent experiments. *P<0.05; P<0.01. (c) IGF1R expression levels in the indicated cells. Cell lysates were prepared using radioimmunoprecipitation assay buffer and subjected to SDS-PAGE and Western blotting using an anti-hIGF1R antibody (1 : 1,000). Bands were visualized using a chemiluminescence super kit. Actin was used as a loading control.

Rec-BRSV-A51908-ZsGreen virus spread in HEK293T-hIGF1R-KO cells in late infection. (a) Western blotting was performed as described in the ‘Methods’ section. (b) HEK293T-WT and HEK293T-hIGF1R-KO (clone 37) cells were seeded at a density of 1.0×104 cells per well (100 µl) in 96-well plates and incubated at 37 °C in a 5% CO2 atmosphere overnight. At the indicated time points, cells were subjected to the MTT assay. (c) ZsGreen-positive cells among HEK293T-hIGF1R-KO cells infected with rec-BRSV-A51908-ZsGreen. HEK293T-hIGF1R-KO cells were infected with the virus at an MOI of 1.0. ZsGreen-positive cells among the infected cells were quantified at the indicated times post-infection using the M7000 microscope. (d) Quantitative analysis of ZsGreen-positive cells among infected cells using the ImageJ software. Error bars indicate standard deviations from three independent experiments. *P<0.05; P<0.01. (e) Viral RNA was detected using qPCR with a specific probe and primer set. HEK293T-hIGF1R-KO cells were infected with rec-BRSV-A51908-ZsGreen at an MOI of 0.1. Total RNA was extracted from the infected cells and subjected to qPCR analysis. Error bars indicate standard deviations from three independent experiments. *P<0.001.

IGF1R is not required for the binding and entry of rec-BRSV-A51908-ZsGreen. (a) Viral RNA amounts after single infection in WT and hIGF1R-KO cells. HEK293T-WT or HEK293T-hIGF1R-KO cells were infected with rec-BRSV-A51908-ZsGreen at an MOI of 0.1. After 8 or 16 hpi, total RNA was extracted from the infected cells and subjected to qPCR using a probe and primer set specific to the viral M RNA. Error bars indicate standard deviations from three independent experiments. ns, not significant. (b, c) Binding efficiency of rec-BRSV-A51908-ZsGreen to HEK293T-hIGF1R-KO cells. HEK293T-WT and HEK293T-hIGF1R-KO cells were placed on ice for 30 min in pre-cooled media. Then, the cells were infected with rec-BRSV-A51908-ZsGreen at an MOI of 1. (b) At 1 hpi at 4 °C (to allow viral binding only) or (c) at 1 hpi at 37 °C (to allow both viral binding and entry), total RNA was extracted from the infected cells and subjected to qPCR using a specific probe and primer set targeting the viral M gene RNA. Error bars indicate standard deviations from three independent experiments. ns, not significant. (d) Minigenome assay in HEK293T-hIGF1R-KO cells or HEK293T-WT cells. HEK293T-hIGF1R-KO cells were transfected with pBAC-T7-minigenome along with pCAG-BRSV-N, pCAG-BRSV-P, pCAG-BRSV-L, pCAG-BRSV-M2-1 and pCAG-T7-pol. At 48 h post-transfection, the cells were lysed using Passive lysis 5X buffer. The lysates were subjected to a NanoLuc luciferase assay using GloMax Explorer. Error bars indicate standard deviations from three independent experiments. ns, not significant. (e) Western blotting was performed as described in the ‘Methods’ section.

IGF1R is required for cell-to-cell spread of rec-BRSV-A51908-ZsGreen. (a) HEK293T-hIGF1R-KO cells were mixed with HEK293T-WT cells at the indicated ratios. The mixed cells were infected with rec-BRSV-A51908-ZsGreen at an MOI of 0.1. After 24, 48 and 72 hpi, ZsGreen-positive cells were observed using the EVOS M7000 microscope. (b) Quantitative analysis of ZsGreen-positive areas using the ImageJ software. Error bars indicate standard deviations from three independent experiments. *P<0.05; P<0.01.

IGF1R is required for efficient late-stage spread of BRSV, but not HRSV. (a) Infection spread in IGF1R-KO and WT cells expressing recombinant HRSV expressing ZsGreen. HEK293T-WT and HEK293T-hIGF1R-KO cells were infected with Rec-HRSV-A2-ZsGreen at an MOI of 1.0. At 72 hpi, ZsGreen-expressing cells were observed using the M7000 microscope. (b) Data were quantified from (a) by selecting five areas per condition, and values are shown as mean±sd after normalization to WT (set to 1). HRSV and BRSV indicate human RSV-infected and bovine RSV-infected samples, respectively. *P<0.001. (c) hIGF1R was transiently expressed in 293T-hIGF1R KO cells by reverse transfection with pCAG-hIGF1R-IRES-mCherry plasmid, followed by infection with Rec-BRSV-ZsGreen at an MOI of 0.1. At 72 h post-infection, viral spread was analysed by flow cytometry based on ZsGreen and mCherry fluorescence, and the proportions of the infected cells were quantified separately in IGF1R-positive and IGF1R-negative populations. As a control, cells transfected with the pCAG-mCherry plasmid were used. (d) Western blotting was performed as described in the ‘Methods’ section.

Full text

Data Summary

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Introduction

Bovine respiratory syncytial virus (BRSV) is an enveloped, non-segmented, negative-sense RNA virus of the family Pneumoviridae [13]. It primarily causes respiratory disease in cattle [4], and the gastrointestinal symptoms reported in some cases are considered indirect or secondary effects rather than evidence of direct enteric infection [2]. In lactating cows, it generally results in a substantial decline in milk production, resulting in significant economic losses. While a single BRSV infection can trigger an adaptive immune response in cows, it does not induce lifelong immunity, and thus reinfection can occur [15].

BRSV has a 15-kbp negative-stranded RNA genome that, similar to human respiratory syncytial virus (HRSV), harbours 10 genes and encodes 11 proteins [4]. BRSV is highly homologous to HRSV, with 29% amino acid similarity in the attachment glycoprotein (G) and 81% in the fusion glycoprotein (F). The F protein of HRSV directly mediates cell membrane fusion and facilitates entry by interacting with insulin-like growth factor 1 receptor (IGF1R) [69] and nucleolin [6,1012]. The HRSV G protein also mediates cell adhesion by binding to host heparan sulphate proteoglycans and CX3CR1 [613]. However, for BRSV, the cellular receptor bound by the F protein has not yet been identified. To gain a comprehensive understanding of the intracellular replication mechanism of BRSV, studying its entry mechanism is important.

BRSV can replicate in primary bovine cell cultures derived from various tissues, including the testes, turbinate, tracheae, aorta, spleen and lungs [2]. Additionally, it can be adapted to grow in primary cells from other animal species, including sheep [1415]. Studies have shown that BRSV is capable of replicating in certain human cell lines, as well as in Vero cells, Madin–Darby bovine kidney (MDBK) cells and avian-derived cell lines, indicating a broad cross-species infectivity under experimental conditions [1617].

To elucidate the replication mechanism of BRSV, reverse genetics systems utilizing the T7 promoter have been established [1820]. Generally, a reporter gene is inserted between the phosphoprotein (P) and matrix (M) genes. In the present study, we created a reporter virus by inserting the ZsGreen reporter gene between the P and M genes.

As 293 T cells are permissive to reporter BRSV, we established human insulin-like growth factor 1 receptor (hIGF1R)-knockout (KO) 293 T cells and examined their susceptibility to infection. The results showed that, 24 h post-infection (hpi), BRSV reporter infection levels did not significantly differ between WT and IGF1R-KO cells. At 72 hpi, BRSV reporter infection levels increased in WT cells but not in KO cells. hIGF1R expression did not affect viral RNA replication in a BRSV minigenome. Furthermore, the requirement of IGF1R in BRSV viral entry differed from that of HRSV. Our data indicate that BRSV uses IGF1R for cell entry in the late stage of its replication cycle, but not in the initial stage.

Methods

Cells and viruses

BHK/T7-9 hamster kidney cells stably expressing T7RNAP (RCB4942; RIKEN BRC cell bank, Ibaraki, Japan) [21] were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) (Nacalai Tesque, Kyoto, Japan) containing 5% inactivated FBS (Biosera, Cholet, France) and 10% tryptose phosphate broth (Sigma‐Aldrich, St. Louis, MO, USA). HEp-2 human epithelial carcinoma cells, contaminated with HeLa cells, MDBK and Vero E6 African green monkey kidney cells, were maintained in DMEM containing 10% FBS. BRSV strain A51908 was used in this study.

Plasmid construction

Total RNA was extracted from Vero E6 cells infected with BRSV-A51908 and reverse transcribed into cDNA using SuperScript IV (Invitrogen, Waltham, MA, USA). Four helper plasmids, pCAG-bRSV-A51908-N, pCAG-bRSV-A51908-P, pCAG-bRSV-A51908-M2-1 and pCAG-bRSV-A51908-L, were generated using specific primers to amplify the N, P, M2-1 and L genes. The amplified cDNAs were cloned into the pCAGGS vector using In-Fusion Snap Assembly Master Mix (Takara, Shiga, Japan). The IGF1R gene, obtained from 293 T cell cDNA, was amplified by PCR. Then, the human IGF1R gene was cloned into the pCAGGS vector. To facilitate observation of cells expressing human IGF1R, mCherry driven by IRES was cloned downstream of the human IGF1R gene. The resulting plasmid was designated pCAG-hIGF1R-IRES-mCherry. pCAG-mCherry was used as a negative control. The sequences of all plasmid constructs were confirmed using Sanger sequencing (outsourced to Eurofins Genomics, Ebersberg, Germany).

Minigenome construction

A bacterial artificial chromosome (BAC) DNA clone of SARS-CoV-Rep [22] was used as a backbone to generate a pBAC-T7-BRSV-A51908 minigenome vector. To generate the pBAC-T7-BRSV-A51908 minigenome, a minigenome comprising the negative-sense trailer and leader regions of BRSV-A51908 and the reverse-complement sequence of the NanoLuc luciferase gene (Promega, Madison, WI, USA) was synthesized together with the sequences of hammerhead ribozyme and hepatitis delta virus antigenomic ribozyme using custom gene synthesis services (Eurofins, Nantes, France).

Minigenome assay

BHK/T7-9 cells seeded in a 24-well plate (Greiner Bio-One, Kremsmünster, Austria) were transfected with pBAC-T7-bRSV-minigenome (1,000 ng well^−1^), pCAG-bRSV-A51908-N (500 ng well^−1^), pCAG-bRSV-A51908-P (100 ng well^−1^), pCAG-bRSV-A51908-M2-1 (100 ng well^−1^) and pCAG-bRSV-A51908-L (300 ng well^−1^) using TransIT-LT1 (Mirus, Madison, WI, USA) according to the manufacturer’s instructions. After 48 h, transfected cells were collected, and NanoLuc luciferase activity was determined using the Nano-Glo Luciferase Assay System (Promega) and a GloMax Explorer microplate reader (Promega).

Infectious BAC construction

Total RNA was extracted from Vero E6 cells infected with BRSV-A51908 and reverse transcribed into cDNA using SuperScript IV. Five fragments were amplified using the following primer sets: 5′- TCTGATGAGTCCGTGAGGACGAAACCCGGAGTCCCGGGTCACGCGAAAAAATGCGTATAACAAAC-3′ and 5′- TTTGCCCCAATTTTACTTTATTTTTACTAACTATGTGGAATCACAGGCTG-3′, 5′-TCCGCCTTGCCCTGAGTTAATAAAAACATGGGGCAAATATGGAGACATAC-3′ and 5′-CTGAAGGAGGCCGGTTCATT-3′, 5′-AATTGCAGTCACTTATGCAAAATGAACCGGCCTCCTTCAG-3′ and 5′-GTACTGGGAGTATTGTCACTTATGACT-3′, 5′-ATAATATACTCTCAGTCATAAGTGACAATACTCCCAGTAC-3′ and 5′-TATATTGGTGATAGATTTAGTGCCTGATATTAAATTAACA-3′, 5′-TGTTAATTTAATATCAGGCACTAAATCTATCACCAATATA-3′ and 5′-TTCGGATGCCCAGGTCGGACCGCGAGGAGGTGGAGATGCCATGCCGACCCACGAGAAAAAAAGTATCAAA-3′. The ZsGreen fragment was amplified using primers 5′- TTCCACATAGTTAGTAAAAATAAAGTAAAATTGGGGCAAATACAAAAACCATGGCCCAGTCCAAGCACGG-3′ and 5′- ATATTTGCCCCATGTTTTTATTAACTCAGGGCAAGGCGGAGCCGGAGGCG-3′. The six PCR fragments were assembled using Gibson assembly with Gibson Assembly Ultra Master Mixes (2X) (TelesisBio, San Diego, CA). The SARS-CoV-Rep BAC DNA clone [22] was used as a backbone. The sequences of all BAC constructs were confirmed using Sanger sequencing (Eurofins Genomics).

Recovery of recombinant viruses

BHK/T7-9 cells seeded in 6-well plates (Greiner Bio-One) were transfected with pBAC-T7-bRSV-A51908-ZsGreen (4,000 ng well^−1^), pCAG-bRSV-A51908-N (2,000 ng well^−1^), pCAG-bRSV-A51908-P (400 ng well^−1^), pCAG-bRSV-A51908-M2-1 (400 ng well^−1^) and pCAG-bRSV-A51908-L (1,200 ng well^−1^) using TransIT-LT1 (Mirus). Transfected cells were cultured at 37 °C for 6 days. Then, cell pellets were collected by freezing and thawing in the presence of 25% sucrose. After centrifugation (500 g, 5 min), the supernatant was collected and stored as P0 virus. P0 virus was passaged two times in Vero E6 cells in a 6-well plate, and P2 virus was used in experiments.

Titration

The infectious titre of each virus was assessed in Vero E6 cells using the TCID_50_ method, as described previously [23].

Analysis of viral growth kinetics

Vero E6 cells were seeded into 24-well plates (Greiner Bio-One) at 1.0×10^5^ cells well^−1^ and cultured at 37 °C overnight. Cells were inoculated with rec-BRSV-A51908-ZsGreen or BRSV-A51908 at a multiplicity of infection (MOI) of 0.1. After incubation at 37 °C for 1 h, the inoculum was removed, and 1 ml of DMEM containing 10% FBS was added to each well. The infected cells were cultured at 37 °C for 24, 48, 72 and 96 h. Culture supernatants were removed, followed by the addition of 25% sucrose in PBS and storage at –80 °C until use. The samples were subjected to three freeze–thaw cycles and centrifuged at 500 g for 5 min. Infectious viral titres in the supernatants were measured using the TCID_50_ method as described above.

Western blotting

Cells were lysed in radioimmunoprecipitation assay buffer (50 mM Tris-HCl, pH 7.6, 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, Nacalai Tesque). After centrifugation at 16,000 g, the supernatants were collected and mixed with 2X sample buffer (0.1 M Tris-HCl, pH 6.8, 4% SDS, 20% glycerol, 0.004% bromophenol blue and 10% 2-mercaptoethanol). After the samples were boiled, proteins were separated using 5–20% SDS-PAGE (e-PAGEL, ATTO) and transferred onto a polyvinylidene difluoride membrane (QBlot kit, ATTO). The membrane was blocked with 3% skim milk in PBS containing 0.05% Tween-20 (Nacalai Tesque). Rabbit anti-hIGF1R (ab182408; Abcam) and mouse anti-β-actin (Sigma-Aldrich, St. Louis, MO, USA) were used as primary antibodies, and goat anti-rabbit IgG-HRP (Sigma-Aldrich) or goat anti-mouse IgG-HRP (Sigma-Aldrich) was used as a secondary antibody. Protein bands were visualized using ChemiLumi One Ultra (Nacalai Tesque) in a LuminoGraph I image analyser (ATTO).

Quantitative PCR

Total RNA was extracted from infected cells using a PureLink RNA Mini Kit (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s instructions and stored at –80 °C until use. BRSV M mRNA was amplified in a StepOne Real-Time PCR System (Applied Biosystems, Waltham, MA, USA) using a Thunderbird Probe one-step qRT-PCR kit (TOYOBO), primers SS23 (5′-GGCAAATATGGAGACATACGTGAA-3′) and SS24 (5′-TCTTTTTCTATGACATTGTACTGAACAG-3′), and a FAM-labelled specific probe, SS001 [5′-(FAM)CTGTGTAAGTTGATCCTTCATGGAGTT(TAM)-3′]. Cycling conditions were 95 °C for 1 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 45 s. Absolute quantification was performed using a standard curve generated from in vitro-transcribed RNA synthesized with T7 RNA polymerase using a plasmid DNA template. For plasmid construction, the BRSV M gene region was amplified by PCR using 5′-AGGGAGACCGGAATTCGGGGCAAATATGGAGACATACGTG-3′and 5′-TACCGAGCTCGAATTCTTTTTATTTATCTAACTGAGG-3′ and cloned into the pSPT18 vector. The resulting plasmid was used as a template for in vitro RNA synthesis using T7 RNA polymerase.

Binding assay and viral M gene mRNA quantification

HEK293T-WT and HEK293T-hIGF1R-KO cells were used in binding assays. One day before infection, cells were seeded in 12-well plates at 2×10^5^ cells per well and grown until ~90% confluence. Immediately prior to inoculation, culture plates, complete medium and PBS were pre-cooled on ice for 30 min. Virus inoculum was prepared in pre-cooled medium at an MOI of 1. Cells were washed once with ice-cold PBS and incubated with 1 ml of inoculum per well. Adsorption was carried out at 4 °C for 60 min on a pre-cooled metal block, with gentle rocking every 10 min to allow attachment while minimizing internalization. After adsorption, the cells were washed thrice with ice-cold PBS to remove unbound viruses, and total RNA was extracted on ice using a PureLink RNA Mini Kit. As a temperature control, parallel plates were processed identically except that adsorption was performed at 37 °C for 60 min using pre-warmed medium and PBS. BRSV M mRNA in total RNA was quantified using quantitative PCR (qPCR) as described above.

Generation of hIGF1R-KO HEK293T cells using CRISPR/Cas9

IGF1R-KO HEK293T cells were generated using the CRISPR/Cas9 system. A single-guide (sg)RNA targeting hIGF1R (ClinVar accession no. NM_000875.5) was designed using CHOPCHOP [24] and cloned into a CRISPR/Cas9 vector (pX330-IGF1r). In addition, the hIGF1R sgRNA was inserted between the EGFP fragments of the pCAG-EGxxFP plasmid [25]. HEK293T cells were transfected with the above two plasmids (pX330-IGF1r and pCAG-EGxxFP-IGF1r) using TransIT-LT1 (Mirus) according to the manufacturer’s instructions. Forty-eight hours later, GFP-positive cells were isolated using fluorescence-activated cell sorting and seeded into 96-well plates at one cell per well to establish clonal populations. Individual clones were expanded and screened for IGF1R KO using genomic PCR and Sanger sequencing of the target locus. Loss of IGF1R protein expression was confirmed using immunoblotting with an anti-IGF1R antibody (1 : 1,000; ab182408; Abcam).

Complementation and flow cytometry assay

Reverse transfection was performed to express human IGF1R in 293T-hIGF1R-KO cells. Cells were seeded at a density of 1×10⁵ cells ml^−1^ and transfected with a mixture containing 2 µg of pCAG-hIGF1R-IRES-mCherry, 6 µl of TransIT-LT1 and 200 µl of Opti-MEM. As a control, cells were transfected in parallel with 2 µg of pCAG-mCherry using the same transfection conditions. The transfection mixtures were incubated for 15 min at room temperature (RT). After incubation, the cells were seeded onto a six-well culture plate. After 24 h of transfection, the 293T-hIGF1R-KO cells were infected with Rec-BRSV-ZsGreen at an MOI of 0.1. Seventy-two hours post-infection, the culture media were removed from the infected cells, and the cells were washed with PBS. Thereafter, the infected cells were collected by pipetting with media and transferred into new tubes. The samples were centrifuged at 500×g for 3 min, and then the cells were fixed using 4% paraformaldehyde for 15 min at RT. The cell pellets were washed twice using PBS and resuspended in PBS, followed by sorting of fluorescence-positive cells using an SH800S cell sorter (SONY) equipped with a disposable sorting chip. ZsGreen and mCherry signals were detected using the 488 nm and 561 nm lasers, respectively, and fluorescence compensation was set using single-colour control samples. Target populations were defined by forward scatter/side scatter gating, doublet exclusion and two-parameter ZsGreen–mCherry dot plots, and the selected cell populations were sorted in purity mode into collection tubes containing culture medium.

Analysis of viral spread using ZsGreen reporter viruses

HEK293T cells or HEK293T-hIGF1R-KO cells were seeded onto culture plates at a density of 1×10⁵ cells per well and infected with recombinant BRSV-ZsGreen or recombinant HRSV-ZsGreen at the indicated MOI. ZsGreen fluorescence was observed using the M7000 microscope system under identical exposure time and gain settings for all conditions.

For quantitative analysis, captured images were processed using ImageJ software. ZsGreen-positive signals were identified by applying a fixed threshold to all images, and viral spread was quantified by measuring the ZsGreen-positive area. The threshold was set at 60 by red overlay, and then the image was converted to binary (Black and White), followed by measurement of the area. All ImageJ parameters, including threshold values and size filters, were kept constant across samples to allow direct comparison between conditions.

Statistical analysis

Data are reported as mean±sd. Group means were compared using ANOVA in GraphPad Prism version 10 (GraphPad Software, San Diego, CA, USA). Statistical significance was set at P<0.05.

Results

Generation of recombinant BRSV expressing the ZsGreen gene using a BAC

We previously reported a BAC-based reverse genetics system for HRSV [2326]. In the present study, we used the methods reported in our previous papers to establish a recombinant (rec-)BRSV. Total RNA was extracted from cultured Vero E6 cells infected with BRSV-A51908 using a QIAamp Viral RNA Kit and reverse transcribed into cDNA using SuperScript IV reverse transcriptase. PCR fragments were generated using specific primer sets. First, we constructed a BAC DNA (pBAC-T7-BRSV-minigenome) for a minigenome assay using the PCR fragments, according to a previous report [23]. The pBAC-T7-BRSV-minigenome was transfected into cells along with helper plasmids expressing BRSV-N, BRSV-P-, BRSV-M2-1 and BRSV-L, and luciferase activity was measured 48 h after transfection (Fig. 1a). Luciferase activity was significantly (P<0.001) increased in the presence of the L protein-expressing plasmid (Fig. 1a).

*Generation of recombinant BRSV expressing the ZsGreen gene using a BAC. (a) Schematic diagram of the construction of the minigenome and helper plasmids. Grey triangle, T7 promoter; HHR, hammerhead ribozyme; tr, trailer sequence; GE, gene end; Nluc, NanoLuc luciferase; GS, gene start; le, leader sequence; HDVR, hepatitis D virus ribozyme; black triangle, CAGGS promoter; N, N gene of BRSV; L, L gene of BRSV; P, P gene of BRSV; M2-1, M2-1 gene of BRSV. The pBAC-T7-bRSV minigenome was transfected into BHK/T7-9 cells along with four helper plasmids. The transfected cells were lysed, and luciferase activity was measured using GloMax Explorer (Promega) to assess minigenome activity. **P<0.001, as determined by statistical analysis. (b) Schematic diagram of the full-length cDNA used for generating the recombinant BRSV-A51908-ZsGreen virus. pBAC-T7-BRSV-A51908-ZsGreen was transfected into BHK/T7-9 cells along with four helper plasmids, and the recombinant BRSV-A51908-ZsGreen virus was recovered from the transfected cells. (c) ZsGreen signal detected in BHK/T7-9 cells transfected with pBAC-T7-BRSV-A51908-ZsGreen along with helper plasmids. L+. BHK/T7-9 cells transfected with pBAC-BRSV-A51908-ZsGreen, pCAGGS-BRSV-N, P, M2-1 and L. L–: BHK/T7-9 cells transfected with pBAC-BRSV-A51908-ZsGreen, pCAGGS-BRSV-N, P and M2-1, but without L. On day 6 post-transfection, ZsGreen signal was observed using an EVOS M7000 microscope. (d) Growth of the recombinant virus in comparison with that of the parental virus, BRSV-A51908. Vero E6 cells were infected with rec-BRSV-A51908-ZsGreen at an MOI of 0.1. The infected cells were frozen and thawed at the indicated time points and centrifuged. The virus titre in the supernatant was subsequently determined using the TCID50 method. The parental virus, BRSV-A51908, was used as a control.

To generate recombinant viruses expressing ZsGreen, we constructed pBAC-T7-BRSV-ZsGreen, with the ZsGreen gene inserted between the P and M genes (Fig. 1b). BHK/T7-9 cells were seeded into 6-well plates at 4×10^5^ cells well^−1^ and transfected with 4,000 ng of genomic BAC DNA and 1,200 ng of L, 400 ng of P, 400 ng of M2-1 and 2,000 ng of N expression helper plasmids, using X-tremeGene9. Six days after transfection, ZsGreen-positive BHK/T7-9 cells were observed under a fluorescence microscope (Fig. 1d, upper panel). For infectious virus recovery, the culture medium was removed, and after the addition of 500 µl of 25% sucrose in PBS, the transfected cells were stored at –80 °C. The stored samples were thawed, centrifuged at 500 g at 4 °C for 5 min, and the supernatant was collected as passage 0 (P0) virus. Vero E6 cells were seeded at 2.0×10^5^ cells per well in a 6-well culture plate, and 500 µl of the recovered P0 virus was added and allowed to adsorb at 37 °C for 1 h. Then, 2 ml of DMEM with 5% FBS was added, and ZsGreen-positive cells were counted. As shown in Fig. 1d (lower panel), ZsGreen-positive cells were expanded at 4 days post-infection. After confirming the appearance of sufficient ZsGreen-positive cells, P1 virus stocks were prepared using the same method used to prepare P0 virus stocks.

Next, we comparatively assessed the proliferation of the ZsGreen reporter virus and parental WT virus in cultured cells. Vero E6 cells seeded at 1.0×10^5^ cells per well in 24-well plates were infected with the ZsGreen virus at an MOI of 0.1, and viral particles were collected over time. For virus recovery, we used the same method as that used for P0 viral stock preparation. Virus titres were determined using the TCID_50_ method, using 20 µl of recovered virus solution. Vero E6 cells were seeded into 96-well plates at 1.0×10^5^ cells ml^−1^ and cultured in the presence of the virus solution for 3 days. Thereafter, they were incubated with rabbit anti-RSV N-protein peptide antibody (Eurofins) as a primary antibody and goat anti-rabbit IgG (H+L) CF594-conjugated antibody (Sigma) as a secondary antibody. N-positive cells were counted under a microscope, and the TCID_50_ was calculated using the Reed and Muench method. As shown in Fig. 1d, the proliferation rate did not significantly differ between BRSV-WT and rec-BRSV-A51908-ZsGreen virus.

Proliferation of BRSV in cultured cells as assessed using the reporter virus, rec-BRSV-A51908-ZsGreen

Next, we evaluated the infectivity of BRSV in various cell lines, including monkey-derived Vero E6 cells, MDBK cells and human HEp-2 and HEK293T cells, using the ZsGreen reporter virus. As shown in Fig. 2a, Vero E6 cells, which are commonly used for BRSV culture, comprised high numbers of ZsGreen-positive cells, whereas MDBK cells comprised relatively lower numbers of ZsGreen-positive cells. Notably, both HEp-2 and HEK293T cells comprised higher numbers of ZsGreen-positive cells than Vero E6 cells.

*Proliferation of BRSV in cultured cells as assessed using the reporter virus, rec-BRSV-A51908-ZsGreen. (a) rec-BRSV-A51908-ZsGreen was infected into the indicated cells at an MOI of 0.1. At 24 and 48 hpi, ZsGreen signals were observed using a M7000 microscope. (b) Virus titre in cells infected with rec-BRSV-A51908-ZsGreen. Cells were infected with rec-BRSV-A51908-ZsGreen at an MOI of 0.1. At 48 hpi, the cells were freeze-thawed three times. Lysates were obtained by centrifugation and subjected to a TCID50 assay. Error bars indicate standard deviations of three independent experiments. *P<0.05; *P<0.01. (c) IGF1R expression levels in the indicated cells. Cell lysates were prepared using radioimmunoprecipitation assay buffer and subjected to SDS-PAGE and Western blotting using an anti-hIGF1R antibody (1 : 1,000). Bands were visualized using a chemiluminescence super kit. Actin was used as a loading control.

To confirm the spread of the ZsGreen virus in the above cell lines, we quantified infectious virus in the cell supernatant at 48 hpi using the TCID_50_ method. In line with the ZsGreen distribution shown in Fig. 2a, the amount of infectious virus in HEK293T and HEp-2 cells reached up to 1.26×10^6^ TCID_50_ ml^−1^, whereas virus titres in Vero E6 and MDBK cells were lower, at 2.37×10^5^ TCID_50_ ml^−1^ and 2.01×10^5^ TCID_50_ ml^−1^, respectively.

HRSV utilizes IGF1R for entry [7]. The results presented in Fig. 2a, c suggested that BRSV may also be capable of utilizing human molecules for the entry or replication step. We assessed IGF1R protein levels in the above cell lines using western blotting. Notably, IGF1R protein levels were lower in Vero E6 cells, with high numbers of ZsGreen-positive cells, than in MDBK cells, with relatively fewer ZsGreen-positive cells. Similarly, IGF1R protein levels were low in HEp-2 cells, which comprised numerous ZsGreen-positive cells. Comparative amino acid sequence analysis showed that the IGF1R used in this study shared 99% and 97% sequence identities with human IGF1R in monkeys and cattle, respectively. Although IGF1R protein levels varied among the examined cell lines and did not directly correlate with the number of ZsGreen-positive cells, these observations suggest that BRSV infection is not solely determined by IGF1R expression levels. Rather, IGF1R may function as a host factor that facilitates efficient viral entry or subsequent intracellular processes in a cell-type–dependent manner, particularly in HEK293T cells.

Rec-BRSV-A51908-ZsGreen virus spread in HEK293T-hIGF1R-KO cells in the late infection stage

Next, we generated hIGF1R-KO HEK-293T cells to determine the effect thereof on BRSV usage of hIGF1R for infection. A 20-nt sgRNA (TTGCTCATTAACATCCGACG) targeting hIGF1R was cloned into the pX330 plasmid, which was then transfected into HEK-293T cells. GFP-positive cells were separated using a cell sorter to isolate 3-positive clones. IGF1R protein expression was assessed using western blotting, which revealed that the protein was absent in clone 37 (Fig. 3a). The effect of IGF1R-KO on cell proliferation was assessed using the [3-(4,5-dimethylthiazol-2-yl)−2,5 diphenyl tetrazolium bromide] MTT assay. HEK293T-hIGF1R-KO cells were seeded into a 96-well plate, and cell proliferation was examined at 16, 24 and 48 h. Cell viability did not significantly differ between KO and WT cells (Fig. 3b).

*Rec-BRSV-A51908-ZsGreen virus spread in HEK293T-hIGF1R-KO cells in late infection. (a) Western blotting was performed as described in the ‘Methods’ section. (b) HEK293T-WT and HEK293T-hIGF1R-KO (clone 37) cells were seeded at a density of 1.0×104 cells per well (100 µl) in 96-well plates and incubated at 37 °C in a 5% CO2 atmosphere overnight. At the indicated time points, cells were subjected to the MTT assay. (c) ZsGreen-positive cells among HEK293T-hIGF1R-KO cells infected with rec-BRSV-A51908-ZsGreen. HEK293T-hIGF1R-KO cells were infected with the virus at an MOI of 1.0. ZsGreen-positive cells among the infected cells were quantified at the indicated times post-infection using the M7000 microscope. (d) Quantitative analysis of ZsGreen-positive cells among infected cells using the ImageJ software. Error bars indicate standard deviations from three independent experiments. *P<0.05; **P<0.01. (e) Viral RNA was detected using qPCR with a specific probe and primer set. HEK293T-hIGF1R-KO cells were infected with rec-BRSV-A51908-ZsGreen at an MOI of 0.1. Total RNA was extracted from the infected cells and subjected to qPCR analysis. Error bars indicate standard deviations from three independent experiments. **P<0.001.

Next, HEK293T-hIGF1R-KO#37 cells were infected with rec-BRSV-A51908-ZsGreen at an MOI of 1, and ZsGreen-positive cells were observed under a fluorescence microscope at 24, 48 and 72 hpi. In HEK293T-WT cells, ZsGreen-positive cells were clearly observed at 24 hpi and their numbers increased at 48 and 72 hpi (Fig. 3c, d). Although a modest increase in ZsGreen-positive cells was observed in HEK293T-hIGF1R-KO cells between 24 and 48 hpi (Fig. 3c), this increase was significantly attenuated compared with that in hIGF1R-positive cells. Consistent with this observation, quantitative analysis revealed a significant reduction in viral spread in hIGF1R-KO cells relative to that in WT cells (Fig. 3d).

Next, viral RNA in HEK293T-WT and HEK293T-hIGF1R-KO cells inoculated with rec-BRSV-A51908-ZsGreen at an MOI of 0.1 was quantified using real-time qPCR. At 72 hpi, RNA was extracted from infected cells and subjected to qPCR using specific primers and a specific probe. In line with ZsGreen expression in HEK293T-WT cells, the amount of viral RNA was increased in WT cells at 72 hpi, whereas in hIGF1R-KO cells, it was low at this time point (Fig. 3e). At 24 hpi, viral RNA amounts in hIGF1R-KO cells and WT cells were comparable. While viral entry and early replication were not markedly affected in hIGF1R-deficient cells, the absence of hIGF1R significantly impaired viral spread during later stages of infection. These findings corroborated that hIGF1R functions as an important host factor facilitating BRSV propagation and spread in HEK293T cells in late infection stages.

IGF1R is not required for the binding and entry of rec-BRSV-A51908-ZsGreen

To verify that hIGF1R is required during the late phase but not the early phase of BRSV infection, BRSV RNA was quantified in HEK293T-WT and HEK293T-hIGF1R-KO cells at 8 and 16 hpi, using qPCR. At 8 hpi, viral RNA levels were relatively low, and no significant difference was observed between WT and hIGF1R-KO cells (Fig. 4a).

IGF1R is not required for the binding and entry of rec-BRSV-A51908-ZsGreen. (a) Viral RNA amounts after single infection in WT and hIGF1R-KO cells. HEK293T-WT or HEK293T-hIGF1R-KO cells were infected with rec-BRSV-A51908-ZsGreen at an MOI of 0.1. After 8 or 16 hpi, total RNA was extracted from the infected cells and subjected to qPCR using a probe and primer set specific to the viral M RNA. Error bars indicate standard deviations from three independent experiments. ns, not significant. (b, c) Binding efficiency of rec-BRSV-A51908-ZsGreen to HEK293T-hIGF1R-KO cells. HEK293T-WT and HEK293T-hIGF1R-KO cells were placed on ice for 30 min in pre-cooled media. Then, the cells were infected with rec-BRSV-A51908-ZsGreen at an MOI of 1. (b) At 1 hpi at 4 °C (to allow viral binding only) or (c) at 1 hpi at 37 °C (to allow both viral binding and entry), total RNA was extracted from the infected cells and subjected to qPCR using a specific probe and primer set targeting the viral M gene RNA. Error bars indicate standard deviations from three independent experiments. ns, not significant. (d) Minigenome assay in HEK293T-hIGF1R-KO cells or HEK293T-WT cells. HEK293T-hIGF1R-KO cells were transfected with pBAC-T7-minigenome along with pCAG-BRSV-N, pCAG-BRSV-P, pCAG-BRSV-L, pCAG-BRSV-M2-1 and pCAG-T7-pol. At 48 h post-transfection, the cells were lysed using Passive lysis 5X buffer. The lysates were subjected to a NanoLuc luciferase assay using GloMax Explorer. Error bars indicate standard deviations from three independent experiments. ns, not significant. (e) Western blotting was performed as described in the ‘Methods’ section.

As BRSV RNA levels did not differ between WT and hIGF1R-KO cells at 8 hpi, we assessed virus adsorption by the two cell lines using a binding assay. HEK293T-WT and HEK293T-hIGF1R-KO cells were infected with rec-BRSV-A51908-ZsGreen at an MOI of 1 at 4 °C for 1 h. Then, the culture medium was removed, the cells were washed with PBS and total RNA was extracted. Viral RNA was quantified using qPCR. As shown in Fig. 4b, c, the RNA copy numbers of the viral M gene in KO cells at 37 °C and at 4 °C were comparable to those in WT cells. The RNA levels in KO cells showed no significant difference from those in WT cells at either 37 °C or 4 °C, confirming that BRSV does not require IGF1R during the early stages of infection.

To rule out the possibility that BRSV requires IGF1R for RNA replication, we performed a minigenome assay. We transfected HEK293T-hIGF1R-KO cells with pBAC-T7-minigenome-BRSV, along with helper plasmids, and measured luciferase activity in the transfected cells 48 h later. No significant difference in luciferase activity was observed between the transfected WT and hIGF1R-KO cells (Fig. 4d). These results support the data presented in Fig. 3, showing that IGF1R is important for viral spread in the late stages of infection.

IGF1R is required for cell-to-cell spread of rec-BRSV-A51908-ZsGreen

To analyse the effect of hIGF1R expression on the spread of BRSV infection during the late infection period, HEK293T-hIGF1R-KO and HEK293T-WT cells were mixed at the ratios shown in Fig. 5a, and ZsGreen fluorescence was evaluated. The number of ZsGreen-positive cells was the lowest at 0% HEK293T-WT cells (i.e. 100% HEK293T-hIGF1R-KO cells) and the highest at 100% HEK293T-WT cells. The number of ZsGreen-positive cells increased with increasing proportion of HEK293T-WT cells (Fig. 5a). A similar trend was observed when ZsGreen-positive cells were quantified using ImageJ (Fig. 5b). These results corroborated that hIGF1R plays a key role in the spread of BRSV infection during the late infection period.

*IGF1R is required for cell-to-cell spread of rec-BRSV-A51908-ZsGreen. (a) HEK293T-hIGF1R-KO cells were mixed with HEK293T-WT cells at the indicated ratios. The mixed cells were infected with rec-BRSV-A51908-ZsGreen at an MOI of 0.1. After 24, 48 and 72 hpi, ZsGreen-positive cells were observed using the EVOS M7000 microscope. (b) Quantitative analysis of ZsGreen-positive areas using the ImageJ software. Error bars indicate standard deviations from three independent experiments. *P<0.05; *P<0.01.

IGF1R is required for efficient late-stage spread of BRSV but not HRSV

Our data showed that hIGF1R is critical for late-stage BRSV infection. Further, hIGF1R is a receptor for HRSV [7]. Therefore, we examined potential differences between HRSV and BRSV in the usage of IGF1R as an entry receptor. We infected HEK293T-hIGF1R-KO and HEK293T-WT cells with a recombinant HRSV-A2-ZsGreen virus generated in a previous study [23]. As shown in Fig. 6a, at 72 hpi, the number of ZsGreen-positive cells in HEK293T-hIGF1R-KO cells infected with rec-BRSV-A51908-ZsGreen was low compared to that in infected WT cells, consistent with the data shown in Fig. 3c, d. Moreover, the size of fused cells was small in hIGF1R-KO cells infected with rec-BRSV-A51908-ZsGreen (Fig. 6a). In contrast, ZsGreen-positive cell numbers and fused cell sizes in hIGF1R-KO cells infected with rec-HRSV-A2-ZsGreen were comparable to those in WT cells infected with rec-HRSV-A2-ZsGreen (Fig. 6a).

*IGF1R is required for efficient late-stage spread of BRSV, but not HRSV. (a) Infection spread in IGF1R-KO and WT cells expressing recombinant HRSV expressing ZsGreen. HEK293T-WT and HEK293T-hIGF1R-KO cells were infected with Rec-HRSV-A2-ZsGreen at an MOI of 1.0. At 72 hpi, ZsGreen-expressing cells were observed using the M7000 microscope. (b) Data were quantified from (a) by selecting five areas per condition, and values are shown as mean±sd after normalization to WT (set to 1). HRSV and BRSV indicate human RSV-infected and bovine RSV-infected samples, respectively. **P<0.001. (c) hIGF1R was transiently expressed in 293T-hIGF1R KO cells by reverse transfection with pCAG-hIGF1R-IRES-mCherry plasmid, followed by infection with Rec-BRSV-ZsGreen at an MOI of 0.1. At 72 h post-infection, viral spread was analysed by flow cytometry based on ZsGreen and mCherry fluorescence, and the proportions of the infected cells were quantified separately in IGF1R-positive and IGF1R-negative populations. As a control, cells transfected with the pCAG-mCherry plasmid were used. (d) Western blotting was performed as described in the ‘Methods’ section.

To quantitatively assess viral infection, ZsGreen-positive cells were enumerated using ImageJ following infection of HEK293T-hIGF1R KO cells with BRSV-ZsGreen or HRSV-ZsGreen. For each virus, the number of ZsGreen-positive cells was normalized to the corresponding number in WT cells, which was set to 1. Under this normalization, the relative number of ZsGreen-positive cells was higher in hIGF1R-KO cells infected with HRSV-ZsGreen than in those infected with BRSV-ZsGreen (Fig. 6b). These results suggest that the requirement for IGF1R may differ between BRSV and HRSV under the conditions tested.

Our findings contradict a previous report that HRSV cannot infect hIGF1R-KO cells [7]. Although the cell lines used in the present study differ from those used in the previous study, our data suggest that the requirement for hIGF1R differs between HRSV and BRSV during entry in HEK293T cells.

To evaluate the role of hIGF1R expression in the late-stage spread of bovine RSV, hIGF1R was transiently expressed in HEK293T-hIGF1R KO cells using a reverse transfection approach. Following transfection, cells were infected with recombinant bovine RSV expressing ZsGreen (Rec-BRSV-ZsGreen) at an MOI of 0.1. At 72 h post-infection, viral spread was assessed by flow cytometry based on ZsGreen fluorescence, and the proportion of infected cells was quantified separately in IGF1R-positive and IGF1R-negative populations.

In cells transfected with pCAG-IGF1R-IRES-mCherry, the total numbers of IGF1R-mCherry-negative and -positive cells were 73,316.3±1329.6 and 12,980.3±438.8, respectively. The expression of hIGF1R in cells transfected with pCAG-hIGF1R-IRES-mCherry via immunoblotting can be confirmed in 293T-hIGF1R-KO cells (Fig. 6d), but the expression of IGF1R-mCherry in 293T-hIGF1R-KO cells was limited to approximately 15.0%. Under these conditions, only 1.92±0.199% of IGF1R-negative cells were ZsGreen-positive, whereas 22.31±1.264% of IGF1R-positive cells were ZsGreen-positive, indicating markedly enhanced viral spread in cells expressing hIGF1R (Fig. 6c).

As a control, cells were transfected with pCAG-mCherry alone. Under this condition, the total numbers of mCherry-negative and mCherry-positive cells were 54,299.6±4803.2 and 34,476.3±4855.0, respectively. The proportion of ZsGreen-positive cells among mCherry-negative cells was 1.88±0.077%, while that among mCherry-positive cells was 3.70±0.353% at 72 h post-infection (Fig. 6c), indicating only a modest increase associated with mCherry expression itself.

Collectively, these results demonstrate that the expression of hIGF1R substantially enhances the late-stage infectious expansion of bovine RSV, whereas expression of mCherry alone has minimal effect, supporting a specific role for hIGF1R in promoting viral spread.

Discussion

HRSV induces clear syncytium formation in infected cultured cells [2730]. Binding of the RSV F protein to the host receptor is necessary for syncytium formation [28]. HRSV utilizes IGF1R as an entry receptor. Binding of the HRSV F protein to IGF1R induces the translocation of nucleolin from the nucleus to the cytoplasm [713]. Our data showed that IGF1R expression levels differ among cultured cells. Although BRSV may use a different cell surface receptor for entry than HRSV does, infectivity was not correlated with IGF1R expression levels in MDBK and HEp-2 cells (Fig. 2c). Despite high IGF1R expression levels, the infectivity of rec-BRSV-A51908-ZsGreen was low (Fig. 2). Similar results were obtained in HEp-2 cells infected with rec-BRSV-A51908-ZsGreen. Hence, IGF1R is unlikely to serve as the primary entry receptor for BRSV but may assist in the entry process.

We investigated the cell-to-cell transmission of BRSV in the presence of IGF1R. However, we did not examine events downstream of the binding of F to IGF1R. HRSV F protein binding to IGF1R triggers a signalling cascade that recruits nucleolin to the cell surface [12], a process that plays an important role in viral infection. Future studies should determine whether nucleolin is also required for BRSV infection.

Infection with rec-BRSV-A51908-ZsGreen produced a comparable number of ZsGreen-positive cells at 24 hpi in HEK293T-hIGF1R-KO cells and HEK293T-WT cells expressing IGF1R, indicating that IGF1R is not required for viral entry. However, by 72 hpi, the number of ZsGreen-positive cells was markedly reduced in HEK293T-hIGF1R-KO cells versus HEK293T-WT cells, in which extensive syncytia formation was observed. These results demonstrate that while IGF1R is dispensable for the early stage of BRSV infection, it is critical for efficient cell-to-cell viral spread in the late stage.

We selected HEK293T cells for the present study for two reasons: (i) BRSV replicated in HEK293T to levels comparable to those observed in HEp-2 and Vero E6 cells and (ii) HEK293T cells are highly amenable to genome engineering, allowing the use of IGF1R-KO approaches. Notably, unlike in a previous study using mosquito cells [7], HRSV entry in HEK293T cells was detected even when hIGF1R was depleted. This discrepancy indicates cell-type- and species-dependent receptor usage: IGF1R may be required for viral entry in certain non-mammalian cells, but is not strictly required in cultured human cells, in which alternative attachment and/or entry factors are present.

For BRSV, our data indicated that IGF1R contributes primarily to late-stage spread rather than initial entry, reinforcing the notion that IGF1R functions as a facilitator or cofactor rather than an obligate entry receptor in mammalian cells. These findings suggest that the use of other cell lines, including HEK293T cells, may be useful to identify additional determinants of BRSV/HRSV entry.

In addition to the F protein, the G protein plays a crucial role in HRSV attachment to host cells [6]. The HRSV G protein interacts with glycosaminoglycans, such as heparan sulphate, and with specific protein receptors to facilitate virion attachment to the cell surface [31]. The HRSV G protein binds to CX3CR1 for attachment [13], and this interaction contributes to host immune response modulation, including interference with chemokine signalling [32]. Although the receptor usage of BRSV G protein has not been fully elucidated, structural and sequence similarities suggest that it may share binding properties with HRSV G protein, potentially engaging with glycosaminoglycans or other, yet unidentified receptors on the host cell surface. Given that our data indicate that IGF1R is not the primary entry receptor for BRSV, BRSV G protein-mediated attachment may be largely independent of IGF1R, and differences in G protein–receptor interactions between HRVS and BRSV may contribute to the observed differences in cell tropism and syncytium formation. Future studies focusing on the receptor-binding domain of the BRSV G protein and its roles in both cell-free and cell-to-cell transmission will be essential to fully elucidate the entry mechanisms of this virus.

During infection, viruses spread through two major pathways: cell-free and cell-to-cell transmission [33]. Based on our observation that IGF1R KO impaired late-phase propagation without altering early events, we posit that BRSV exploits IGF1R primarily for cell-to-cell transmission. Consistent herewith, virion-binding assays and early RNA measurements revealed no differences between HEK293T-WT and HEK293T-hIGF1R-KO cells, indicating that IGF1R is dispensable for the cell-free pathway and that alternative attachment/entry factors mediate this route. In contrast, for HRSV, robust syncytium formation was observed in HEK293T cells, irrespective of IGF1R expression, implying that, in these cells, HRSV entry and subsequent fusion may rely on host determinants. Collectively, these findings suggest that RSV receptor usage is both route-specific (cell-free vs. cell-to-cell) and cell type-dependent, underscoring the value of examining diverse cell systems to delineate the entry mechanisms of BRSV and HRSV.

Buchholz et al. [16] created a chimeric virus in which the F protein of BRSV was replaced with that of HRSV. Although the cell lines used in the present study differed from those used in their study, their results showed that a chimeric virus with HRSV F protein tended to replicate more efficiently than the virus with BRSV F protein, suggesting that the HRSV F protein is more likely to induce cell fusion.

Amino acid sequence alignments have suggested that the F protein is highly conserved between HRSV and BRSV. In contrast, notable sequence differences are observed in both the F1 and F2 subunits between HRSV and BRSV. The HRSV F2 subunit is crucial for proper folding, trimerization and surface expression of the F protein through its disulphide linkage to F1 [34]. Mutations in F2 can destabilize the prefusion conformation or impair conformational triggering, leading to reduced fusion efficiency [3536]. In particular, seven residues within the apical loop of the F2 subunit differ between the two viruses. Studies have shown that the apical unstructured loop of the HRSV F2 subunit (residues 62–75; SNIKKNKCNGTDAK) is critical for fusion activity [3536]. Mutations such as K65Q or K66Q resulted in reduced fusion activity, despite the mutant F protein still being expressed on the cell surface [35]. Interestingly, in BRSV, the amino acid residues at positions 65 and 66 are both glutamines (65Q and 66Q). Further investigation of this region using chimeric viruses will improve our understanding of IGF1R-dependent cell-to-cell transmission. However, in the present study, we focused on the entry process of BRSV using HEK293T cells and identified virus-specific differences between BRSV and HRSV in their dependence on host factors during cellular entry.

In conclusion, this study demonstrated that the F protein of BRSV binds to cells independent of IGF1R in the early stages of infection and induces fusion via IGF1R in the late stages. Although there remain many unknowns regarding the receptor usage of BRSV for differences, this study contributed to the elucidation of its intracellular invasion mechanism.