Pro-resolving Annexin A1-derived peptide Ac2-26 reduces nociception and mitigates joint damage in experimental osteoarthritis

TL;DR

A peptide derived from Annexin A1 reduces joint pain and damage in a mouse model of osteoarthritis.

Contribution

The study demonstrates that Ac2-26, a peptide from Annexin A1, mitigates OA-related nociception and joint damage in mice.

Findings

AnxA1-deficient mice showed increased joint pain and inflammation compared to wild-type mice.

Ac2-26 treatment reduced mechanical nociception, tissue damage, and metalloproteinase-3 expression in OA-affected joints.

Ac2-26 normalized the increased number of synoviocytes expressing RANKL induced by collagenase.

Abstract

We investigated whether treatment with Annexin A1 (AnxA1) ameliorated joint nociception and tissue damage in an experimental osteoarthritis (OA) model.

OA was induced by injection of collagenase into the tibiofemoral joint of wild-type (WT) and AnxA1-deficient male Balb/c mice. The control group received saline. Groups of WT mice were treated weekly with Ac2-26, an active peptide corresponding to the N-terminal region of AnxA1, in the affected joint. Mechanical nociception was analyzed weekly, and samples were collected 6 weeks after OA induction to analyze histopathology and markers of joint damage by qPCR and flow cytometry.

The expression of Anxa1 is upregulated in the joints at the 1st and 3rd week and returned to the basal level at the 6th week after OA induction. AnxA1-deficient mice had persistent nociception and increased joint inflammation when compared to WT mice, although both groups had comparable cartilage damage. In WT mice, the treatment with Ac2-26 decreased joint nociception, tissue damage, and the expression of metalloproteinase-3 in the joint tissue. The collagenase injection increased the number of FAP+CD90− fibroblast-like and CX3CR1+macrophage-like synoviocytes expressing RANKL when compared to saline-injected mice. Treatment with Ac2-26 normalized the latter parameters.

AnxA1 and Ac2-26 are promising molecules that regulate key processes in OA, effectively mitigating tissue damage and dysfunction in a model of OA in mice.

The online version contains supplementary material available at 10.1007/s00011-026-02191-z.

We wanted to find out if a treatment with the pro-resolving molecules called Annexin A1 (AnxA1) could reduce joint pain and damage in a mouse model of osteoarthritis (OA).

Osteoarthritis was induced in mice by injecting a chemical called collagenase into their knee joints. We used mice that lacked the AnxA1 protein, and others without gene modification. A group of normal mice was treated weekly with a piece of the AnxA1 protein called Ac2-26, which was injected into their affected joints. Pain was measured every week after the induction of this model up to 6 weeks. The joints were collected at the end for the analysis of signs of tissue damage and inflammation.

The level of AnxA1 in the joints increased in the first few weeks after OA induction but returned to normal at the later time point. Mice without AnxA1 had more joint pain and inflammation than normal mice, although both groups showed similar cartilage damage. The Ac2-26 treatment reduced joint pain, tissue damage, and enzymes related to cartilage damage. This model of OA increased the number and activation of important cells present into the joint, but Ac2-26 treatment reduced these levels back to normal.

AnxA1 and its active portion, Ac2-26, could be useful for treating OA by reducing joint damage and pain.

The online version contains supplementary material available at 10.1007/s00011-026-02191-z.

Figures

AnxA1 is transiently upregulated in the joint tissue of collagenase-induced OA in mice and controls joint nociception. WT mice were challenged with intra-articular injection of collagenase VII on days 1 and 3, and the control group received saline (10 µL). Periarticular tissue was collected 1, 3, and 6 weeks later to evaluate AnxA1 expression (n = 3) by A Western blot and B plotted as densitometry of intact AnxA1 (37 Kda) when normalized by β-actin expression. C The kinetics of joint nociception of WT and AnxA1-deficient (AnxA1^−/−^) mice (n = 5) were assessed weekly and D plotted as the area

The absence of AnxA1 increases joint inflammation after collagenase injection. Wild-type (WT) and AnxA1-deficient (AnxA1^−/−^) mice were challenged with intra-articular injection of collagenase VII on days 1 and 3 and the control group received saline (10 µL). Joint tissues were collected 6 weeks later for histopathological analysis. A Representative images of hematoxylin and eosin (HE) and Safranin-O/fast green staining. B Inflammatory score. C OARSI score. (*) for *p* < 0.05 when compared to the control group and (#) for *p* < 0.05 when compared to the control WT mice (N = 3–5) using one-way

The treatment with Ac2-26 reduces joint nociception after collagenase injection. Wild-type (WT) mice were challenged with intra-articular injection of collagenase VII on days 1 and 3, and the control group received saline (10 µL). After 1 or 3 weeks post-collagenase injection, mice were treated weekly with Ac2-26 (10 µM/10 µL; i.a.) up to week 5. The joint nociception was analyzed before the Ac2-26 treatment. A Scheme showing the strategy of Ac2-26 treatment. B The kinetics of joint nociception were assessed weekly and C plotted as the area under the curve, considering the average values of th

The treatment with Ac2-26 reduces joint damage after collagenase injection. Wild-type (WT) mice were challenged with intra-articular injection of collagenase VII on days 1 and 3, and the control group received saline (10 µL). After 1 or 3 weeks post collagenase injection, mice were treated weekly with Ac2-26 (10 µM/10 µL; i.a.) up to week 5. Joint tissues were collected 6 weeks later for histopathological analysis and *mmp3* expression. A Scheme showing the strategy of Ac2-26 treatment. B OARSI score (n = 4–5). C Expression of *mmp3* (n = 5–6). D Representative images of hematoxylin and eosin

The treatment with Ac2-26 reduces the activation of synoviocytes after collagenase injection. Wild-type (WT) mice were challenged with intra-articular injection of collagenase VII on days 1 and 3, and the control group received saline (10 µL). After 3 weeks post collagenase injection, mice were treated weekly with Ac2-26 (10 µM/10 µL; i.a.) up to week 5. Joint tissues were collected 6 weeks later for the analysis of synoviocyte population and activation by flow cytometry. A Number and B RANKL expressing macrophage-like synoviocytes. C Number and D RANKL expressing CD90^+^FAP^+^ fibroblast-like

Full text

Introduction

Osteoarthritis (OA) is one of the most important causes of functional limitation and disability, especially among women and elderly people [1]. It is a chronic disease affecting the whole joint tissues, primarily leading to progressive damage to articular cartilage and, subsequently, to the subchondral bone and surrounding synovial structures [2]. Pain is the typical OA symptom that leads people to present to healthcare providers, and its diagnosis is helped with imaging exams [3]. Although the progression of OA is generally slow, it can potentially lead to complete joint impairment, as no OA-modifying medications have yet been approved, resulting in a strong indication for joint replacement surgery, particularly of the hip and knee joints [4, 5].

Synovitis has been directly associated with the progression of joint damage, pain, and disability in patients with OA. It is characterized by important changes in synoviocyte functions, including their uncontrolled proliferation and invasion of surrounding tissues [6, 7]. The sustained activation of these cells, together with persistent leukocyte infiltration, especially composed of mononuclear cells, produces inflammatory mediators involved in the pathogenesis of OA [8]. There is also activation of matrix metalloproteinases (MMP3, MMP13) and release of alarmins (S100A8/9), which are involved in tissue damage in OA [9, 10]. In addition to eicosanoids, cytokines, such as IL-6 and TGFβ, and chemokines, such as CCL2 and CCL17, contribute to this process, which leads to the aggregation and death of chondrocytes, activation of osteoclasts and osteoblasts of the subchondral bone. Activation of these cells results in disordered cartilaginous and bone neoformation, promotes osteophytosis that coexists with erosion of the cartilage and the underlying bone, with irreversible damage to the joint [11–14]. Therapeutically, steroidal (corticosteroid) and nonsteroidal (NSAID) anti-inflammatory drugs remain the most widely used analgesics, but, in addition to their questionable efficacy, adverse events limit their use and do not alter the prognosis of OA [15, 16].

Pro-resolving mediators, which actively participate in interrupting the inflammatory response and promote tissue repair [17], are suggested as capable of relieving pain and halting the progression of rheumatic diseases. Their actions can be resumed by, among others, stopping polymorphonuclear infiltration in the tissue and induction of their apoptosis, enhancing their clearance by macrophages (efferocytosis), reprogramming macrophage phenotype, and promoting pain remission [18, 19]. Annexin A1 (AnxA1), a glucocorticoid-regulated protein, has a potent effect on the control of inflammation, as an anti-inflammatory action by inhibiting the enzymes phospholipase A2 (PLA2) and cyclooxygenase-2 (COX-2) and stimulating the synthesis of anti-inflammatory molecules, such as the cytokine IL-10 [20, 21]. The peptide Ac2-26 derived from the N-terminal region of AnxA1 has been demonstrated to have a potent pro-resolving effect in experimental models of arthritis, reducing the intensity and duration of joint inflammation and nociception [22]. In the context of OA, a tendency towards a decrease in AnxA1 expression was observed in the cartilage of individuals suffering from the disease when compared to the cartilage of control individuals, indicating the participation of the protein in the pathogenesis of the disease [23, 24]. Thus, this study aimed to investigate the contribution and potential therapeutic use of AnxA1 to the inflammation, damage, and nociception in an experimental model of OA induced by the injection of collagenase in mice.

Methods

Animals and the experimental model of osteoarthritis

Adult (8 weeks old) male wild-type (WT) mice and mice deficient for AnxA1 (AnxA1^−/−^) of Balb/c background were used in this study (Approved by local ethical committee #240/2020). The model of collagenase-induced OA (CiOA) was established via intra-articular injection of type VII collagenase (Sigma-Aldrich, C0773, 1 U/10 µL) into the joint cavity of anesthetized mice (ketamine and xylazine, i.p.) at days 1 and 3, with the analyses evaluated weekly up to week 6 after the first injection of collagenase [25]. Negative control groups received saline injections in the joints at days 1 and 3. For standardization, we used the right knee for the collagenase or saline injections.

Groups of WT mice were treated weekly with an intra-articular injection of Ac2-26 (10 µM/10 µL), starting 1 (W1) or 3 (W3) weeks after the first injection of collagenase. The positive control group (CiOA without Ac2-26 treatment) received weekly injections of saline into the joints from week 1 to 5. For any intra-articular injection, the animals were anesthetized with inhaled isoflurane. Nociception measurements were performed weekly, immediately before the treatments with Ac2-26 or saline. At different moments, mice were killed by overexposure to the anesthetic solution (ketamine and xylazine, i.p.), and joint tissues were collected for histopathology analysis and markers of joint inflammation and damage.

Mechanical nociception analysis

Mice were individually housed in acrylic cages (12 × 10 × 17 cm) with wire grid floors in a noise-controlled room for 20 min to acclimate before the experiment. To identify the withdrawal threshold, a von Frey electronic algesimeter (INSIGHT Instruments, Ribeirão Preto, SP, Brazil) was applied according to the methods previously used [26]. Using a portable force transducer with a polypropylene tip (4.15 mm), an increasing vertical force was applied to the central plantar surface of the mouse’s paw, a stimulus for knee flexion, which triggers a paw withdrawal movement, the characteristic aversive behavior. The maximum value (in grams) was recorded by an electronic component of the device. The withdrawal threshold was calculated by repeating the procedure in triplicate for each mouse (and the means were expressed as absolute values) and was conducted in a blinded experimental condition.

Histology H&E and Safranin-O/fast green staining

Samples from the tibiofemoral joint were collected and fixed in 10% (v/v) buffered formalin (pH 7.4) for 48 h and decalcified for 30 days in 14% EDTA (pH 7.3). Tissues were embedded in paraffin, sectioned (5 µm), and stained with Hematoxylin–Eosin (H&E). Then, the samples were examined and classified by a pathologist blindly regarding the following parameters: severity of synovial hyperplasia, intensity of inflammatory infiltrate, and changes in bone and cartilage.

For the OA score, the samples were also stained Safranin-O/fast green via standard procedures. Cartilage degradation was assessed by histopathological analysis using a standardized scoring system, with the analysis performed by two examiners blinded to the treatment groups. The evaluation parameters were as follows: (1) cartilage structure (0–6), (2) cartilage cells (0–3), (3) Safranin-O/Fast Green staining (0–4), and (4) tidemark integrity (0–1).

Western blot

The protein content of the tissue surrounding the committed joint was extracted and determined using the Bradford assay reagent. The extracts (20 μg) were separated by electrophoresis on a 10% SDS-PAGE gel and transferred to nitrocellulose membranes. The membranes were blocked overnight at 4 °C with PBS containing 5% (w/v) skim milk and 0.1% Tween 20, washed three times with PBS containing 0.1% Tween 20, and then incubated with anti-AnxA1 and anti-β-actin antibodies in PBS containing 5% (w/v) BSA and 0.1% Tween 20. After washing, the membranes were incubated with a peroxidase-conjugated secondary antibody. Immunoreactive bands were visualized using an ECL detection system. AnxA1 values were quantified using densitometric analysis software (ImageJ, National Institutes of Health, Bethesda, MD). Changes in protein levels were estimated relative to the control (saline-injected group), and the results were expressed as an increase in arbitrary units of AnxA1 normalized to β-actin values in the same sample.

Quantification of mRNA expression by qRT-PCR

Total RNA was extracted and isolated from the tissue surrounding the joint of mice using Trizol reagent (Invitrogen Life Technologies Corporation-Carlsbad, CA, USA) according to the manufacturer’s instructions. The purity of the total RNA was determined using a Nanodrop 1000 spectrophotometer (Thermo Scientific-Waltham, MA, USA). For the reverse transcription of 500 ng of total RNA isolated to cDNA, a mixture containing the reserve transcriptase, SuperScript III, a recombinant ribonuclease inhibitor (RNAse Out; Invitrogen Life Technologies Corporation), and dithiothreitol (DTT; 1 mM) was used. The reverse transcription step was performed in duplicate and the total cDNA concentration was similar in all samples. For quantitative real-time qPCR, the Power SYBR Master Mix reagent (Invitrogen Life Technologies Corporation) and the pars primers (Integrated DNA Technologies-Coralville, IA, USA) plus cDNA were placed in a 96-well plate, in duplicate, at a total reaction volume of 10 μL, using the StepOneTM system (Applied Biosystems, Waltham, MA, USA) in programmed reaction: initial heating at 95 °C for 10 min, followed by 40 cycles at 95 °C for 60 s and 48 °C for 1 min. Data were analyzed using the StepOneTM System software and processed by the 2^−ΔCT^ method. This method directly uses the CT (threshold cycle) information generated by a qPCR system to calculate the relative expression of genes in the target and reference samples, using a reference gene to normalize the RT-qPCR. The primer pairs sequences used were:mmp3FW: CACTCACAGACCTGACTCGGTT.RV: AAGCAGGATCACAGTTGGCTGG

The initiator and probe sequences were verified with the BLAST™ software. The 18 s was used as the reference control gene, and the results were expressed as “Fold Increase” compared to the negative control groups injected with saline.

Flow cytometry analysis

A pool of two synovial tissues from the tibiofemoral joint was used for each sample analyzed by flow cytometry. Samples were incubated with collagenase (10 mg/mL; Collagenase D—Sigma Aldrich #C2139) for 1 h at 37 °C followed by passage through a 70 μm cell strainer to obtain cell suspensions. For the identification of macrophage population, anti-CD45 PercP (Biolegends #103131), anti-CD11b APC-Cy7 (BD Pharmingen #562127), anti-F4/80 FITC (Biolegends #123107), and anti-CX3CR1^+^ PECy7 (Biolegends #149015) were used. Anti-CD90 PE (Biolegends #109006) and anti-FAP BV421 (eBioscience #BMS168) were used for synovial fibroblasts. Anti-RANKL PE (BD Pharmingen #560295) was used for the analysis of synoviocyte activation. After surface marking (30 min), cells were fixed by incubation with 4% formaldehyde for 20 min. The negative controls were cells labeled only with secondary anti-rabbit antibodies bound to fluorochromes. The labeled cells were acquired with the BD FACSCanto II cell analyzer (BD Bioscience) and analyzed with the FlowJo software (Tree Star Inc., USA).

Statistical analysis

Data were statistically analyzed using GraphPad Prism version 9.5 (GraphPad Software Inc., CA, USA). The normality of the data was assessed with the Shapiro–Wilk test. Results are expressed as the mean ± standard error of the mean (SEM). Differences between means were evaluated by analysis of variance (ANOVA) followed by Tukey’s post hoc test. Statistical significance was set at p < 0.05 (*).

Results

AnxA1 is transiently expressed in synovial tissue, and its absence is associated with increased joint nociception and inflammation in experimental OA

After induction of experimental OA in wild-type animals, the tissue surrounding the affected joint was removed to evaluate AnxA1 expression. As shown in Fig. 1, the expression of the intact (active) form of AnxA1 increased on days 7 and 21, returning to basal levels by day 42.Fig. 1. AnxA1 is transiently upregulated in the joint tissue of collagenase-induced OA in mice and controls joint nociception. WT mice were challenged with intra-articular injection of collagenase VII on days 1 and 3, and the control group received saline (10 µL). Periarticular tissue was collected 1, 3, and 6 weeks later to evaluate AnxA1 expression (n = 3) by A Western blot and B plotted as densitometry of intact AnxA1 (37 Kda) when normalized by β-actin expression. C The kinetics of joint nociception of WT and AnxA1-deficient (AnxA1^−/−^) mice (n = 5) were assessed weekly and D plotted as the area under the curve considering the mean of paw withdrawal threshold. For graph B (*) for p < 0.05 when compared to the control group using one-way ANOVA followed by the Tukey’s post-test. Graph C: (#) Two-way repeated measures ANOVA with Šídák's multiple comparisons test; Graph D: (#) for p < 0.05 when compared to the control WT mice using unpaired t test

As pain is a hallmark of OA disability, we evaluated mechanical nociception at different time points after collagenase injection (Fig. 1C, D). The peak of joint nociception occurred 1 week after the first intra-articular challenge with collagenase, as indicated by the markedly reduced paw withdrawal threshold in these mice (Fig. 1C). It is also clear that the nociception decreased over the following weeks, as demonstrated in other studies using the same OA model [27, 28]. However, nociceptive levels remained higher than those observed in the basal evaluations. During the first 2 weeks post-collagenase injection, AnxA1^−/−^ mice exhibited lower nociceptive response than WT mice. However, this trend reversed in weeks 5 and 6, with AnxA1^−/−^ mice maintaining significantly higher nociceptive levels than WT controls throughout this later period (Fig. 1C). The sustained nociception in AnxA1^−/−^ mice was reflected in a significantly larger area under the curve (AUC) over the experimental timeline (Fig. 1D).

Given that significant tissue alterations in joint structures in this model manifest weeks after collagenase injection [25, 27], the histopathological analysis was performed only 6 weeks after the first collagenase challenge, which was the end time point. This model and the disease in humans are associated with relatively mild synovitis and signs of inflammation when compared to other common arthritides, such as rheumatoid arthritis [29] and gout [30]. As evidenced by H&E staining, a mild inflammatory score was evident in collagenase-injected WT mice as compared to saline-injected WT mice (Fig. 2A, B). However, OA Anxa1^−/−^ mice had increased inflammatory scores when compared to the OA WT group (Fig. 2A, B). On the other hand, based on Safranin-O/Fast-green staining, both OA WT and OA Anxa1^−/−^ groups presented intense loss of joint structure compared to the respective saline-injected groups, but without differences between them (Fig. 2A, C).Fig. 2. The absence of AnxA1 increases joint inflammation after collagenase injection. Wild-type (WT) and AnxA1-deficient (AnxA1^−/−^) mice were challenged with intra-articular injection of collagenase VII on days 1 and 3 and the control group received saline (10 µL). Joint tissues were collected 6 weeks later for histopathological analysis. A Representative images of hematoxylin and eosin (HE) and Safranin-O/fast green staining. B Inflammatory score. C OARSI score. (*) for p < 0.05 when compared to the control group and (#) for p < 0.05 when compared to the control WT mice (N = 3–5) using one-way ANOVA followed by the Tukey’s post-test

Treatment with the AnxA1-derived peptide, Ac2-26, improves nociception and joint damage in experimental OA

Given that AnxA1^−/−^ mice displayed persistent nociception and increased inflammatory scores compared with WT counterparts in this model, it was investigated whether the peptide Ac2-26 could control these hallmark signs of OA disease. The peptide Ac2-26 is related to the N-terminal part of AnxA1 and mimics the anti-inflammatory and pro-resolving effects of the intact protein [31]. Ac2-26 was given intra-articularly once a week in the same joint that received collagenase, and the treatments started at the 1st or the 3rd week after the first injection of collagenase (Fig. 3A). Nociception was evaluated weekly just before the treatment with Ac2-26. As shown in Fig. 3B, treatment with Ac2-26 reduced joint nociception, as indicated by an increased paw withdrawal threshold 1 week later, regardless of when the treatment was initiated. However, there was an oscillation of this anti-nociceptive effect in later weeks, which could be explained by a slight decrease in nociception in OA mice treated with saline, as a characteristic of this model [27, 28]. By analyzing the areas under the curves, plotted from 1 week after the start of each treatment, there was a significant reduction in joint nociception (higher paw withdrawal threshold) in both Ac2-26-treated groups (Fig. 3C).Fig. 3. The treatment with Ac2-26 reduces joint nociception after collagenase injection. Wild-type (WT) mice were challenged with intra-articular injection of collagenase VII on days 1 and 3, and the control group received saline (10 µL). After 1 or 3 weeks post-collagenase injection, mice were treated weekly with Ac2-26 (10 µM/10 µL; i.a.) up to week 5. The joint nociception was analyzed before the Ac2-26 treatment. A Scheme showing the strategy of Ac2-26 treatment. B The kinetics of joint nociception were assessed weekly and C plotted as the area under the curve, considering the average values of the paw withdrawal threshold. () for p < 0.05 when compared to control group (Saline) and (#) for p < 0.05 compared to the vehicle-treated OA group using two-way repeated measures ANOVA with Šídák's multiple comparisons test for graph B (N = 5); () for p < 0.05 when compared to the control group (Saline) and (#) for p < 0.05 when compared to vehicle-treated OA group (N = 5) using one way ANOVA followed by the Tukey´s post-test for graph C

Interestingly, there was no reduction in the inflammatory score in the histopathology analysis regardless of the moment when the treatment was started (data shown). However, the treatment strategies caused a substantial reduction in bone and cartilage damage as evaluated using the OARSI score for this model as compared to the non-treated osteoarthritic group (Fig. 4B, D). The reduction of tissue damage in Ac2-26-treated mice could be associated with reduced levels of metalloproteinase 3 in the tissue surrounding the joint in these groups (Fig. 4C).Fig. 4. The treatment with Ac2-26 reduces joint damage after collagenase injection. Wild-type (WT) mice were challenged with intra-articular injection of collagenase VII on days 1 and 3, and the control group received saline (10 µL). After 1 or 3 weeks post collagenase injection, mice were treated weekly with Ac2-26 (10 µM/10 µL; i.a.) up to week 5. Joint tissues were collected 6 weeks later for histopathological analysis and mmp3 expression. A Scheme showing the strategy of Ac2-26 treatment. B OARSI score (n = 4–5). C Expression of mmp3 (n = 5–6). D Representative images of hematoxylin and eosin (HE) and Safranin-O/fast green staining. (*) for p < 0.05 when compared to the control group and (#) for p < 0.05 when compared to the vehicle-treated OA group using one way ANOVA followed by the Tukey’s post-test

Treatment with Ac2-26 decreased the activation of synoviocytes

Activated macrophages and fibroblast-like synoviocytes play a critical role in the pathogenesis of OA, invading surrounding tissues and releasing cytokines and enzymes that cause inflammation, bone and cartilage degradation, and pain [32–34]. Here, mouse synovium tissues were collected 6 weeks after collagenase injection for the analysis of synoviocyte activation. There was an increased number of synovial CX3CR1^+^ macrophages (Fig. 5A) and lining (FAP^+^CD90^−^) (Fig. 5B) and sublining (FAP^+^CD90^+^) (Fig. 5C) fibroblast populations over the negative control groups (saline). The treatment with Ac2-26 decreased the number of macrophage-like synoviocytes (Fig. 5A) and lining fibroblast-like synoviocytes (Fig. 5B). In addition, Ac2-26 treatment decreased the number of these synovial cells expressing RANKL (Fig. 5D, E), a critical molecule involved in osteoclast formation and consequently bone degradation [35]. There were no differences in the number and activation of sublining synovial fibroblasts upon Ac2-26 treatment (Fig. 5C, F).Fig. 5. The treatment with Ac2-26 reduces the activation of synoviocytes after collagenase injection. Wild-type (WT) mice were challenged with intra-articular injection of collagenase VII on days 1 and 3, and the control group received saline (10 µL). After 3 weeks post collagenase injection, mice were treated weekly with Ac2-26 (10 µM/10 µL; i.a.) up to week 5. Joint tissues were collected 6 weeks later for the analysis of synoviocyte population and activation by flow cytometry. A Number and B RANKL expressing macrophage-like synoviocytes. C Number and D RANKL expressing CD90^+^FAP^+^ fibroblast-like synoviocytes. E Number and F RANKL expressing CD90^−^FAP^+^ fibroblast-like synoviocytes. (*) for p < 0.05 when compared to the control group and (#) for p < 0.05 when compared to vehicle-treated OA group (N = 4–5) using one way ANOVA followed by the Tukey’s post-test

Discussion

Despite the advances in the knowledge about the mechanisms related to the pathogenesis of OA, current treatment options are not effective in preventing disease progression, and pharmacological treatments are mostly limited to symptom control [36]. Inflammation of the synovial membrane (synovitis) of joints affected by OA is directly associated with joint dysfunction and damage, resulting in continued activation of resident synovial cells, such as macrophages and fibroblasts [37]. Here, we investigated whether AnxA1, a well-known pro-resolving mediator, could control joint inflammation, damage, and nociception in an experimental model of OA in mice. The main findings of this study are summarized as follows: (1) Studies in AnxA1-deficient mice showed that endogenous AnxA1 is an important molecule that controls nociception and joint inflammation; (2) Mice that received the AnxA1-mimetic peptide Ac2-26 into the affected joint had reduced nociception and tissue damage, even when treatment was started at a later time point after OA induction; (3) Ac2-26 treatment downregulated MMP3 secretion in joint tissue; (4) Ac2-26 treatment reduced the number of macrophage-like and fibroblast-like synoviocytes expressing RANKL. Altogether, these results clearly show that AnxA1 plays a relevant role in controlling joint inflammation and damage in experimental OA.

Synovitis in OA joints is generally less severe than in other rheumatic diseases, such as rheumatoid arthritis, gout, or bacterial arthritis. However, it directly correlates with the progression of tissue remodeling and symptom severity in OA patients [38, 39]. Therefore, a better characterization of the inflammatory environment and of markers of synoviocyte and leukocyte activation in OA joints is essential to elucidate the mechanisms underlying the disease and to support the development of new therapeutic strategies. On the other hand, very few studies have explored if and how mediators that share pro-resolving properties could control OA pathology. Shih and colleagues demonstrated that systemic treatment with Maresin 1, a specialized pro-resolving lipid mediator, reduced joint nociception of the monosodium iodoacetate (MIA) model of OA in mice, decreasing the expression of the neurotransmitter calcitonin-gene related peptide (CGRP) and markers of macrophage activation in the dorsal root ganglia (DRG) [40]. More recently, the intra-articular injection of Maresin 1 reduced joint inflammation and mitigated the severity of tissue damage caused by the anterior cruciate ligament transection in mice [41]. In addition, Ac2-26, the same molecule we used, reduced the senescence status of TNF-stimulated chondrocytes, preventing senescence-related gene expression and NF-κB activation [42]. Here, we provided the first evidence on how the pro-resolving mediator AnxA1 or its mimetics may serve as an alternative strategy to control joint inflammation, damage, and dysfunction in OA.

AnxA1 and its active N-terminal-derived peptide Ac2-26 are potent anti-inflammatory and pro-resolving mediators that modulate inflammatory processes [31]. Their main contributions to the resolution of inflammation came from studies of neutrophilic inflammation. Essentially, AnxA1 and Ac2-26 cause neutrophil apoptosis and stimulate its clearance by enhancing its efferocytosis by macrophages [30, 43]. Furthermore, the capacity of AnxA1 to change the macrophage phenotype to M2 and Mres (resolving-like macrophages) leads to the reduction of the levels of pro-inflammatory cytokines and promotes tissue repair [31, 44, 45]. Although OA pathogenesis seems to be independent of neutrophil activation, key features of AnxA1 and Ac2-26 beyond their effect on neutrophils could explain the beneficial effects in this OA model.

The discovery of molecules to avoid chondrocyte death and cartilage and bone degradation is an important achievement for OA management. Different enzymes that cause cartilage degradation in OA joints, such as ADAMTS-4 and ADAMTS-5, which cleave aggrecan from its hyaluronic acid structure, and matrix metalloproteinases (MMPs), targeting type II collagen, further weaken the collagen network, culminating in progressive joint deterioration [46]. It has been shown that Ac2-26 downregulates ADAMTS-4 in TNF-stimulated chondrocytes, evidencing the direct effect of this molecule in cartilage cells [42]. Here, the treatment with Ac2-26 in the affected joint reduced the extension of cartilage damage and MMP3 expression in periarticular tissue even when it was started after 3 weeks of collagenase challenge, a time point when signs of cartilage and bone changes are detected (data not shown). In addition, there was a reduction in the number of macrophage-like and fibroblast-like synoviocytes expressing RANKL, a well-known molecule involved in osteoclastogenesis and bone remodeling [47]. However, it needs to be determined if Ac2-26 or other pro-resolving mediators prevent or reverse the progression of tissue damage in this model of OA.

In our study, AnxA1-deficient mice had persistent joint nociception, while the treatment with Ac2-26 in WT mice prevented it. Some works have already demonstrated the anti-nociceptive effects of endogenous AnxA1, as AnxA1-deficient mice had exacerbated nociception in an acetic acid-induced abdominal writhing model compared to WT mice [30]. In models of arthritis in mice, the systemic treatment with Ac2-26 reduced joint nociception [22, 30]. Interestingly, silencing AnxA1 in DRG [48] or intrathecal injection of Ac2-26 [49] reduced thermal and mechanical nociception, evidencing the antinociceptive effect of AnxA1 by reducing neuron activation. In this study, we propose that the Ac2-26 peptide initiates a signaling cascade in the joint cells that becomes self-sustaining, producing long-term effects even after the initial signal dissipates. This long-lasting action is a recognized characteristic of pro-resolving molecules, as observed in other inflammatory pain models, where a single dose of Ac2-26 or Maresin 1 relieves pain for several days [50, 51]. Similarly, a single treatment with angiotensin-(1–7) caused sustained macrophage reprogramming, which was associated with the resolution of pulmonary inflammation [52]. Thus, in our model, a weekly intra-articular injection of Ac2-26 may be sufficient to profoundly alter the behavior of synovial cells, inhibiting their activation and reducing tissue damage and pain-inducing factors.

While this study demonstrates statistically robust and consistent results, we acknowledge its limitations. The relatively small sample size may affect the generalizability of the findings, and the use of a single animal model may not fully recapitulate human disease complexity. Further confirmation of the therapeutic potential of Ac2-26 in osteoarthritis will require larger cohorts, complementary models, and in-depth investigation of intracellular mechanisms, followed by translational validation.

In conclusion, our results indicate that AnxA1 or Ac2-26 actively contributes to improving joint degeneration and dysfunction characteristic of OA pathology. These findings highlight the need for a deeper investigation into the underlying mechanisms and further exploration of whether the class of pro-resolving mediators holds promise for controlling OA features.

Supplementary Information

Below is the link to the electronic supplementary material.

Supplementary Material 1