Molecular identification with virulence gene profiles and in-vitro antifungal susceptibility of Candida species associated with subclinical mastitis in Anatolian buffaloes and dairy cows
Oğuz Kağan Türedi, Esra Şeker
TL;DR
This study identifies Candida species in subclinical mastitis in Anatolian buffaloes and dairy cows, highlighting the importance of molecular methods for accurate diagnosis and antifungal resistance.
Contribution
The study provides the first molecular evidence of the SAP1 virulence gene in C. albicans from Anatolian buffaloes with mastitis.
Findings
Non-albicans Candida species were the most frequently identified in both buffaloes and dairy cows.
C. albicans isolates from buffaloes carried the SAP1 virulence gene but lacked ALS1 and PLB1.
Antifungal susceptibility testing showed reduced susceptibility to tested agents in Candida isolates.
Abstract
Mastitis is a serious multifactorial disease of dairy animals. Etiologically, bacterial mastitogens are intensively investigated. Conversely, yeast-associated mastitis, particularly Candida species, has received comparatively less attention in buffaloes. The present study aimed to perform species-level molecular identification of Candida isolates obtained from Anatolian buffaloes and dairy cows with subclinical mastitis, to characterize the selected virulence gene profiles, and to evaluate antifungal susceptibility patterns. Milk samples were collected on an udder-quarter basis from 1188 quarters of 301 buffaloes and 1321 quarters of 332 dairy cows raised in smallholder farms. Following phenotypic yeast isolation, presumptive Candida isolates were subjected to an Internal Transcribed Spacer (ITS)-based PCR approach followed by sequence-based identification. The results were compared…
Genes, proteins, chemicals, diseases, species, mutations and cell lines named across the full text — each resolved to its canonical identifier and authoritative record.
Click any figure to enlarge with its caption.
Figure 1
Figure 2
Figure 3
Figure 4- —Afyon Kocatepe University
Peer Reviews
No public reviews on file for this paper yet. If you reviewed it on a platform where reviews are public (OpenReview, ICLR, NeurIPS, ICML), you can paste yours below so the community can read it here.
Videos
No videos yet. Explain this paper in a talk, walkthrough, or lecture? Add one.
Taxonomy
TopicsMilk Quality and Mastitis in Dairy Cows · Antifungal resistance and susceptibility · Microbial infections and disease research
Introduction
Mastitis is the most prevalent disease affecting dairy animals and continues to pose a significant challenge to animal health and welfare, while adversely impacting milk quality, milk yield, and overall herd productivity, thereby causing substantial economic losses to the dairy industry (Ariton et al. 2022; Morales-Ubaldo et al. 2023). Epidemiological studies conducted in Türkiye and globally have indicated that approximately 2–13% of mastitis cases are associated with fungal etiologies (Dworecka-Kaszak et al. 2012; Cilvez and Turkyılmaz, 2019; Hızlısoy et al. 2020; Kurt and Ekşi 2021; Yüksel Dolgun et al. 2022; Raheel et al. 2023; Miao et al. 2023). Factors contributing to the occurrence and spread of mycotic mastitis include contaminated automated or manual milking practices, prolonged and repeated use of antibiotics, and intramammary administration of contaminated antibiotics, cannulas, or syringes (Dworecka-Kaszak et al. 2012; Hamadani et al. 2013; Hızlısoy et al. 2020).
Among fungal agents implicated in mycotic mastitis, Candida spp., Aspergillus spp., Trichosporon spp., Cryptococcus spp., Penicillium spp., Rhodotorula spp., and Geotrichum candidum are most frequently reported as mastitogens (Ksouri et al. 2015; Morales-Ubaldo et al. 2023). While Candida albicans has long been considered the primary Candida species involved in mastitis, accumulating evidence suggests a growing involvement of non-albicans Candida (NAC) species, including Candida tropicalis, Candida pseudotropicalis, Candida krusei, Candida parapsilosis, Candida guilliermondii, Candida rugosa, Candida kefyr, Candida lipolytica, Candida lusitaniae, Candida sphaerica, and Candida utilis (Du et al. 2018; Yüksel Dolgun et al. 2022). This shift in species distribution underscores the need for accurate species-level identification to better understand the epidemiology and clinical relevance of yeast-associated mastitis.
Candida species are unicellular eukaryotic yeasts that reproduce primarily by budding and are characteristically non-encapsulated and non-motile (Kadosh and Mundodi 2020). Their pathogenic potential is largely mediated by a diverse array of virulence determinants that facilitate host colonization and infection, including adhesion capacity, hyphal formation, phenotypic switching, secretion of extracellular hydrolytic enzymes (proteinases, phospholipases, lipases, and esterases), and biofilm formation (Mroczyńska and Brillowska-Dąbrowska 2021; Macias-Paz et al. 2022).
In this context, agglutinin-like sequence (ALS), phospholipase B (PLB), and secreted aspartyl proteinase (SAP) genes of C. albicans were specifically selected for investigation due to their well-documented roles in immune evasion, tissue adhesion, and invasion. C. albicans possesses an extensive repertoire of virulence factors that enable successful colonization of host tissues, establishment of infection, and evasion of host defense mechanisms. ALS genes encode cell-surface glycoproteins involved in adhesion and tissue penetration, PLB genes encode phospholipases capable of disrupting host cell membranes, and SAP genes encode secreted aspartyl proteinases that contribute to tissue damage and modulation of host immune responses (Hube and Naglik 2001; Zhao et al. 2005; Theiss et al. 2006).
Therefore, the present study aimed to perform species-level molecular identification of Candida isolates obtained from Anatolian buffaloes and dairy cows with mastitis in Afyonkarahisar, to investigate the presence of ALS1, SAP1, and PLB1 virulence genes in isolates identified as C. albicans, and to evaluate the antifungal susceptibility patterns of the recovered Candida isolates.
Materials and methods
Sampled animals and collection of milk samples
During the investigation period between January 2021 and December 2021, milk samples were collected from 1188 udder quarters of 301 Anatolian buffaloes from 39 buffalo farms and 1321 udder quarters of 332 dairy cows from 14 dairy farms. None of the cases had received any antibiotic treatment within the preceding month. The farms were located in the city center and districts of Afyonkarahisar province, Türkiye, and included both family-owned and commercial production systems. Animals with clinical mastitis were excluded from the study.
Physical examination of all udder quarters was performed prior to milk sampling. The California Mastitis Test (CMT) solution was prepared in-house using bromocresol purple sodium salt (Sigma-Aldrich, St. Louis, MO, USA) and applied to each udder quarter. Scores were recorded as negative, trace, + 1, +2, or + 3, according to Schalm et al. (1971). Animals showing a positive CMT reaction in at least one udder quarter were considered to have subclinical mastitis. Approximately 10 mL of milk was collected aseptically from each affected udder quarter. Samples were transported to the microbiology laboratory under cold chain conditions.
Phenotypic Isolation of Candida spp
For pre-enrichment, 1 mL of each milk sample was inoculated into 9 mL of Sabouraud Dextrose Broth (SDB; Merck, Darmstadt, Germany) and incubated aerobically at 30 °C for 24 h (Silveira-Gomes et al. 2011). Following incubation, aliquots were streaked onto Sabouraud Dextrose Agar (SDA; Merck, Darmstadt, Germany) supplemented with 1% chloramphenicol and incubated at 37 °C for 24–48 h.
Suspected colonies exhibiting yeast-like morphology were considered presumptive Candida spp. and subjected to Gram staining (Arda 2015). Presumptive isolates were subcultured onto chromogenic Candida agar (CCA; Condalab, Madrid, Spain) and incubated at 37 °C for up to 72 h. Species differentiation was performed based on colony color and morphology according to the manufacturer’s instructions. Germ tube formation and chlamydospore production tests were additionally applied for phenotypic identification of C. albicans at the species level (Shepherd et al. 1980; Yücel and Kantarcıoğlu 2000). Reference strains of C. albicans ATCC 10,231 (KWIK-STIK, Hardy Diagnostics, Santa Maria, CA, USA; Cat. No. 0443P), C. tropicalis ATCC 750 (KWIK-STIK, Hardy Diagnostics, Santa Maria, CA, USA; Cat. No. 0847P), and C. krusei ATCC 6258 (Issatchenkia orientalis; KWIK-STIK, Hardy Diagnostics, Santa Maria, CA, USA; Cat. No. 0227P) were used as positive controls. All phenotypically isolated strains were preserved at − 20 °C in Trypticase Soy Broth (TSB; Aldrich, St. Louis, MO, USA) supplemented with 15% glycerol until further analysis.
Molecular Identification of Candida Isolates
Genus-level identification by PCR
Genomic DNA was extracted from all phenotypically identified isolates and reference strains using the NucleoSpin Microbial DNA extraction kit (Macherey-Nagel, Germany) according to the manufacturer’s instructions. DNA purity was assessed using a NanoDrop 8000 spectrophotometer (Thermo Fisher Scientific, USA), and samples with an A260/280 ratio between 1.8 and 2.0 were considered suitable for PCR analysis. DNA integrity was verified by agarose gel electrophoresis.
Genus-specific ITS primers targeting conserved regions of the ITS locus were developed and applied for molecular identification of Candida isolates. Primer sequences and expected amplicon sizes used for genus-level identification and virulence gene detection are presented in Table 1. PCR amplification was carried out under standard conditions, and amplicons of the expected size (approximately 300–400 bp) were visualized by agarose gel electrophoresis.
Table 1. Primer sequences and expected amplicon sizes for genus-level identification and virulence gene detection in Candida speciesPrimerOligonucleotide Sequences (5’-3’)Product size (base pairs, bp)ReferenceITSF: CAACGGATCTCTWGGTTCTCGCA300–400Designed in this studyR: TGCTTAAGTTCAGCGGGTAKTCC ALS1 F:GACTAGTGAACCAACAAATACCAGA318(Inci et al. 2013)R:CCAGAAGAAACAGCAGGTGA SAP1 F:TGAGGCTGCTGGTGATTATG224(Correia et al. 2010)R:TGCCAACAGCTTTGAGAGAA PLB1 F:ATGATTTTGCATCATTTG751(Mukherjee et al. 2001)R:AGTATCTGGAGCTCTACC
Species-level identification and phylogenetic analysis
Isolates confirmed at the genus level were subjected to species-level identification by one-way Sanger sequencing (Microsynth, Switzerland). Species identification was performed using the BLAST algorithm through comparison with reference sequences available in public databases. Representative ITS sequences were aligned using BioEdit version 7.0.9. Phylogenetic analysis was conducted by calculating evolutionary distances using the Maximum Composite Likelihood method, and the phylogenetic tree was constructed using the Unweighted Pair Group Method with Arithmetic Mean (UPGMA). All evolutionary analyses were performed using MEGA11 software, and the robustness of the tree topology was evaluated by bootstrap analysis with 1,000 replicates. Phylogenetic analyses were conducted using 181 high-quality ITS sequences after excluding sequences with insufficient read quality or length for reliable alignment.
Detection of virulence genes in C. albicans
The presence of ALS1, SAP1, and PLB1 virulence genes was investigated in isolates identified as C. albicans using gene-specific PCR assays. Primer sequences, expected amplicon sizes, and amplification targets are provided in Table 1, and PCR amplification conditions applied for each virulence gene are summarized in Table 2. PCR reactions were performed under optimized conditions, and amplification products were analyzed by agarose gel electrophoresis.
Table 2PCR amplification conditions used for genus-level identification and virulence gene detection in Candida speciesStepNumber of CyclesTemperature ( °C DurationALS1SAP1PLB1PLB1SAP1PLB1ALS1SAP1PLB1Initial Denaturation11194 °C94 °C94 °C5 min5 min5 minDenaturation35303594 °C94 °C94 °C30 s30 s30 sAnnealing353035 48 °C54 °C50 °C30 s30 s30 sExtension35303572 °C72 °C72 °C1 min1 min1 minFinal Extension11172 °C72 °C72 °C10 min10 min10 minmin: minute; s: seconds
Antifungal susceptibility testing
Antifungal susceptibility of genotypically identified Candida isolates was determined using the Kirby–Bauer disk diffusion method on Mueller–Hinton agar supplemented with 2% glucose and 0.5 µg/mL methylene blue, in accordance with CLSI guidelines for yeasts (Brown and Traczewski 2008; CLSI 2022). Commercially available antifungal disks (Bioanalyse, Türkiye) containing caspofungin (5 µg), amphotericin B (20 µg), ketoconazole (10 µg), fluconazole (10 µg), itraconazole (10 µg), voriconazole (1 µg), and flucytosine (1 µg) were used. Inhibition zone diameters were measured after incubation and interpreted according to CLSI criteria for yeasts (CLSI 2022).
Statistical analysis
Statistical analyses were performed using IBM SPSS Statistics for Windows, Version 25.0 (IBM Corp., Armonk, NY, USA). The association between California Mastitis Test (CMT) score categories (positive, suspicious, and negative) and the presence of Candida isolates was evaluated separately for buffalo and dairy cow samples using the Pearson chi-square (χ²) test. Expected cell counts were examined to confirm the suitability of the chi-square test. A p-value < 0.05 was considered statistically significant.
Results
Isolation results
A total of 1188 udder quarter milk samples from 301 Anatolian buffaloes were examined, and Candida isolates were obtained from 93 samples (93/1188; 7.83%). In dairy cows, 1321 udder quarter milk samples from 332 lactating cows were analyzed, and Candida isolates were detected in 99 samples (99/1321; 7.49%).
Association between CMT score and Candida Isolation
Pearson’s chi-square test demonstrated a statistically significant association between CMT score categories and Candida isolation in Anatolian buffaloes (χ² = 60.64, df = 4, p < 0.001). A similar significant association was observed in dairy cows (χ² = 65.82, df = 3, p < 0.001). Detailed distribution of Candida isolates according to CMT score categories is presented in Table 3.
Table 3. Distribution of Candida isolates according to CMT score categories in Anatolian buffaloes and dairy cowsCMT ScoreBuffalo Quarters (n)Candida (+) (n)Isolation Rate (%)Cow Quarters (n)Candida (+) (n)Isolation Rate (%)+ 34924.08000.00+ 219584.1018942.11+ 115053.332073818.35Suspicious550305.453924210.71Negative2444819.70533152.81Total1188937.831321997.49
Based on chromogenic Candida agar (CCA) colony morphology, among the 93 Candida-suspected isolates recovered from Anatolian buffaloes, two (2/93; 2.15%) produced pale green, smooth colonies and were presumptively identified as C. albicans. Seventy-four (74/93; 79.57%) produced pink colonies and four (4/93; 4.30%) produced light pink colonies, both morphotypes being presumptively identified as C. krusei. One isolate (1/93; 1.07%) produced a whitish colony and was presumptively identified as C. glabrata. The remaining 12 isolates (12/93; 12.90%) produced cream/white colonies that could not be reliably differentiated at the species level based solely on chromogenic characteristics. Among the 99 Candida-suspected isolates recovered from dairy cows, one isolate (1/99; 1.01%) produced green-blue, matte colonies and was presumptively identified as C. tropicalis. Fifty-four isolates (54/99; 54.55%) produced pink colonies and two (2/99; 2.02%) produced light pink colonies, both morphotypes being presumptively identified as C. krusei. The remaining 42 isolates (42/99; 42.42%) produced cream/white colonies without distinctive chromogenic differentiation.
The results obtained by CCA were compared with sequencing-based identification. CCA correctly identified 131 of 138 isolates recovered from both buffalo and cow samples, yielding an overall concordance rate of 94.93%. A comparison of identification methods is presented in Table 4.
Table 4. Comparison of chromogenic Candida agar and sequencing results for identification of Candida isolatesAnatolian Buffalo IsolatesDairy Cow IsolatesNumber of IsolatesColony Color on CCASequencing ResultNumber of IsolatesColony Color on CCASequencing Result74Pink P. kudriavzevii (C. krusei)54Pink P. kudriavzevii (C. krusei)4Light Pink S. xylopsoci (C. xylopsoci)2Light Pink C. xylopsoci 11Cream/White K. marxianus (C. kefyr)39Cream/White K. marxianus (C. kefyr)1Cream/White C. rugosa 2Cream/White C. xylopsoci 1Whitish C. glabrata 1Cream/White C. parapsilosis 2Pale Green C. albicans 1Green-Blue C. rugosa
In phenotypic identification, germ tube formation and chlamydospore production were observed in 2 of the 93 Candida-suspected isolates obtained from buffalo milk samples. Both isolates were confirmed as C. albicans by sequence analysis. C. albicans was not detected among the cow-derived isolates by sequencing. Genus-specific PCR amplification using newly designed ITS primers targeting conserved regions of the ITS locus yielded specific amplicons of approximately 300–400 bp in all 93 buffalo-derived and all 99 cow-derived isolates. Representative gel electrophoresis results are shown in Figs. 1 and 2.
Fig. 1. Agarose gel electrophoresis of Candida isolates obtained from Anatolian buffaloes. M: DNA marker (100 bp); M1-M12: Candida isolates (300–400 bp)
Fig. 2. Agarose gel electrophoresis of Candida isolates obtained from dairy cows. M: DNA marker (100 bp); A: C. albicans ATCC 10,231; K: C. krusei ATCC 6258; T: C. tropicalis ATCC 750; N: negative control (sterile distilled water); i1-i15: Candida isolates (300–400 bp)
Species-level identification results of Candida isolates
Species-level identification based on one-way Sanger sequencing revealed that the most frequently isolated species from both Anatolian buffaloes and dairy cows were Pichia kudriavzevii (C. krusei) and Kluyveromyces marxianus (C. kefyr). Two isolates obtained from buffalo milk samples were identified as C. albicans, whereas C. albicans was not detected among isolates recovered from dairy cows.
Overall, 190 of the 192 (190/192; 98.96%) isolates recovered from both host species were classified as non-albicans Candida species. The distribution and isolation rates of Candida species identified in buffalo and cow samples are summarized in Table 5.
Table 5. Distribution and isolation rates of Candida species in Anatolian buffaloes and dairy cowsCandida spp.Anatolian buffaloDairy cow n % n %P. kudriavzevii (C. krusei)7479.595454.54K. marxianus (C. kefyr)1111.823939.4S. xylopsoci (C. xylopsoci)44.344.04 C. albicans 22.15-- C. glabrata 11.07-- C. parapsilosis --11.01 C. rugosa 11.0711.01Total9310099100
Phylogenetic analysis results
Phylogenetic analysis was conducted using 181 ITS nucleotide sequences obtained in this study. Evolutionary distances were calculated using the Maximum Composite Likelihood method, and the phylogenetic tree was constructed using the Unweighted Pair Group Method with Arithmetic Mean (UPGMA) (Sneath and Sokal 1973). All evolutionary analyses and tree construction procedures were performed using MEGA11 software (Tamura et al. 2021). The resulting phylogenetic tree illustrating the clustering of Candida species identified from Anatolian buffaloes and dairy cows is presented in Fig. 3.
Fig. 3. Phylogenetic relationships of Candida species identified from Anatolian buffaloes and dairy cows. M: Buffalo; C: Cow. C. rugosa (pink), K. marxianus (C. kefyr) (red), C. albicans (blue), P. kudriavzevii (C. krusei) (yellow), S. xylopsoci (C. xylopsoci) (green), and C. parapsilosis (gray) are highlighted in color
Virulence gene detection results
PCR-based screening of virulence-associated genes demonstrated that both C. albicans isolates recovered from Anatolian buffaloes carried the SAP1 gene, whereas ALS1 and PLB1 genes were not detected in these isolates. Representative PCR amplification results are shown in Fig. 4.
Fig. 4PCR amplification of SAP1, ALS1, and PLB1 virulence genes in C. albicans isolates. M: DNA ladder (100 bp); lanes 128–130: C. albicans isolates; N: negative control (sterile distilled water)
Antifungal susceptibility results
All Candida species isolated from Anatolian buffaloes were resistant to flucytosine. High resistance rates were also observed against itraconazole (98.9%; n = 92), amphotericin B (88.2%; n = 82), caspofungin (86.0%; n = 80), and fluconazole (83.9%; n = 78). The antifungal susceptibility profiles of isolates recovered from buffaloes are presented in Table 6.
Table 6. Antifungal resistance profiles of Candida species isolated from Anatolian buffaloes S: Susceptible; I: Intermediate; R: ResistantSpeciesFluconazole(10 µg)% (n)Voriconazole(1 µg)% (n)Caspofungin(5 µg)% (n)Itraconazole(10 µg)% (n)Ketoconazole(10 µg)% (n)Amphotericin B(20 µg)% (n)Flucytosine(1 µg)% (n)SIRSIRSIRSIRSIRSIRSIRP. kudriavzevii (n = 74)0(0)0(0)100(74)90.5(67)6.8(5)2.7(2)2.7(2)2.7(2)94.6(70)0(0)0(0)100(74)93.2(69)6.8(5)0(0)5.4(4)2.7(2)91.9(68)0(0)0(0)100(74)K. marxianus (n = 11)90.9(10)9.1(1)0(0)90.9(10)0(0)9.1(1)81.8(9)0(0)18.2(2)0(0)0(0)100(11)81.8(9)9.1(1)9.1(1)9.1(1)18.2(2)72.7(8)0(0)0(0)100(11) S. xylopsoci (n = 4)0(0)0(0)100(4)100(4)0(0)0(0)0(0)0(0)100(4)0(0)0(0)100(4)75(3)25(1)0(0)0(0)0(0)100(4)0(0)0(0)100(4) C. albicans (n = 2)100(2)0(0)0(0)100(2)0(0)0(0)0(0)0(0)100(2)0(0)50(1)50(1)100(2)0(0)0(0)0(0)100(2)0(0)0(0)0(0)100(2) C. glabrata (n = 1)0(0)100(1)0(0)0(0)100(1)0(0)0(0)0(0)100(1)0(0)0(0)100(1)0(0)100(1)0(0)0(0)0(0)100(1)0(0)0(0)100(1) C. rugosa (n = 1)0(0)100(1)0(0)100(1)0(0)0(0)0(0)0(0)100(1)0(0)0(0)100(1)100(1)0(0)0(0)0(0)0(0)100(1)0(0)0(0)100(1)Total (%)(n = 93)12.9(12)3.2(3)83.9(78)90.3(84)6.5(6)3.2(3)11.9(11)2.1(2)86(80)0(0)1.1(1)98.9(92)90.3(84)8.6(8)1.1(1)5.3(5)6.5(6)88.2(82)0(0)0(0)100(93)
Among the 99 isolates recovered from dairy cows, resistance to itraconazole and flucytosine was detected in all isolates. Resistance was observed in 96 isolates (97.0%) against amphotericin B, 75 isolates (75.8%) against caspofungin, and 63 isolates (63.6%) against fluconazole. The antifungal susceptibility profiles of cow-derived isolates are summarized in Table 7.
Table 7. Antifungal resistance profiles of Candida species isolated from dairy cowsSpeciesFluconazole(10 µg)% (n)Voriconazole(1 µg)% (n)Caspofungin(5 µg)% (n)Itraconazole(10 µg)% (n)Ketoconazole(10 µg)% (n)Amphotericin B(20 µg)% (n)Flucytosine(1 µg)% (n)SIRSIRSIRSIRSIRSIRSIRP. kudriavzevii (n = 54)0(0)0(0)100(54)92.6(50)5.6(3)1.8(1)0(0)1.8(1)98.2(53)0(0)0(0)100(54)100(54)0(0)0(0)0(0)1.8(1)98.2(53)0(0)0(0)100(54)K. marxianus (n = 39)89.8(35)0(0)10.2(4)89.8(35)5.1(2)5.1(2)7.7(3)48.7(19)43.6(17)0(0)0(0)100(39)92.3(36)7.7(3)0(0)2.6(1)0(0)97.4(38)0(0)0(0)100(39) S. xylopsoci (n = 4)0(0)0(0)100(4)100(4)0(0)0(0)0(0)0(0)100(4)0(0)0(0)100(4)100(4)0(0)0(0)0(0)0(0)100(4)0(0)0(0)100(4)C. parapsilosis (n = 1)100(1)0(0)0(0)100(1)0(0)0(0)100(1)0(0)0(0)0(0)0(0)100(1)0(0)100(0)0(0)100(1)0(0)0(0)0(0)0(0)100(1) C. rugosa (n = 1)0(0)0(0)100(1)100(1)0(0)0(0)0(0)0(0)100(1)0(0)0(0)100(1)100(1)0(0)0(0)0(0)0(0)100(1)0(0)0(0)100(1)Total (%)(n = 99)36.4(36)0(0)63.6(63)92(91)5(5)3(3)4(4)20.2(20)75.8(75)0(0)0(0)100(99)97(96)3(3)0(0)2(2)1(1)97(96)0(0)0(0)100(99) S: Susceptible; I: Intermediate; R: Resistant
Discussion
This study provides a comprehensive molecular overview of Candida spp. associated with subclinical mastitis in Anatolian buffaloes and dairy cows, integrating phenotypic screening, ITS-based PCR confirmation, sequence-based species identification, phylogenetic analysis, virulence gene profiling in C. albicans, and antifungal susceptibility testing. The comparable isolation rates observed in buffaloes (7.83%) and dairy cows (7.49%) indicate that yeast-associated intramammary infections occur in both host species under field conditions and underscore the importance of including mycotic agents in subclinical mastitis investigations, particularly in regions where mastitis control programs predominantly target bacterial pathogens (Dworecka-Kaszak et al. 2012; Cilvez and Turkyılmaz, 2019; Yüksel Dolgun et al. 2022; Raheel et al. 2023; Miao et al. 2023).
Studies on Candida isolation from milk samples of buffaloes with subclinical mastitis are relatively limited compared with dairy cows, and available reports demonstrate considerable heterogeneity in species distribution. Several studies have described C. albicans as a predominant buffalo isolate, reporting proportions around one-third of isolates (Moshref 2004; Mohamed et al. 2022), whereas others have documented markedly lower rates (Şeker and Özenç 2011). In addition to C. albicans, buffalo-associated non-albicans Candida (NAC) species such as C. tropicalis, C. parapsilosis, C. krusei, and C. rugosa have been repeatedly reported (Moshref 2004; Şeker and Özenç 2011; Khalaf et al. 2021; Hassan et al. 2023). Consistent with previous reports, the present study identified a predominance of NAC species in buffaloes, with only two C. albicans isolates confirmed by sequencing. Beyond descriptive epidemiology, the predominance of non-albicans Candida species observed in the present study may have practical relevance, given that these yeasts can differ from C. albicans in virulence-associated traits and antifungal susceptibility profiles reported in the literature.
In dairy cows, the available literature similarly indicates wide variation in Candida species prevalence and composition across herds and regions. C. krusei has frequently been reported among the dominant isolates (Aalbæk et al. 1994; Casia dos Santos and Marin 2005; Wawron et al. 2010; Şeker 2010; Türkyılmaz and Kaynarca 2010; Zaragoza et al. 2011; Sonmez and Erbas, 2017; Du et al. 2018; Yüksel Dolgun et al. 2022), and other species including C. tropicalis, C. parapsilosis, C. kefyr, C. rugosa, and C. glabrata have also been commonly isolated (Sartori et al. 2014; Erbaş et al. 2017; Cilvez and Turkyılmaz, 2019; Toxqui-Munguia et al. 2022; Raheel et al. 2023). In contrast, C. albicans has often been detected at relatively low frequencies or not detected at all, depending on the study population and diagnostic approach (Dworecka-Kaszak et al. 2012; Du et al. 2018; Sav and Öztürk 2022; Raheel et al. 2023). C. albicans was not detected among cow-derived isolates in the present study, while NAC species constituted 190 of 192 total isolates, with P. kudriavzevii (C. krusei) and K. marxianus (C. kefyr) being the most frequently identified taxa in both animal groups (Table 5). These findings reinforce the increasingly recognized role of NAC yeasts in bovine mycotic mastitis epidemiology and emphasize that species-level identification is essential for accurate interpretation of mycological findings (Du et al. 2018; Yüksel Dolgun et al. 2022; Raheel et al. 2023).
The low isolation rate of C. albicans in this study is plausibly explained by the exclusive inclusion of subclinical cases. It has been suggested that C. albicans is more commonly associated with clinical and chronic mastitis and therefore may be recovered more frequently from clinically affected animals (Bakr et al. 2015; Eldesouky et al. 2016; Mousa et al. 2016). Accordingly, the absence of clinical or chronic mastitis in the present sampling frame may have reduced the probability of isolating C. albicans. Moreover, historical emphasis on C. albicans as the “classical” yeast pathogen may have influenced the reported distributions in earlier studies by shaping sampling strategies and identification priorities.
In addition to species distribution, the relationship between California Mastitis Test (CMT) scores and Candida isolation merits consideration. In the present study, a statistically significant association was observed between CMT score categories and Candida isolation in both Anatolian buffaloes and dairy cows (χ², p < 0.001). However, a considerable proportion of yeast-positive quarters were detected within CMT-negative or low-score categories, indicating that fungal intramammary infections may not consistently induce an inflammatory response detectable by routine field screening tests. Similar findings were reported in Anatolian buffaloes, where periods of high Candida spp. incidence were not accompanied by significant increases in CMT scores or somatic cell counts (Özenç et al. 2008). Furthermore, the diagnostic sensitivity of CMT for identifying intramammary infection in subclinical dairy cows has been shown to be limited, particularly in the absence of overt clinical signs (Kandeel et al. 2018). Collectively, these observations suggest that while CMT remains a practical indicator of mammary inflammation, it may underestimate yeast-associated subclinical mastitis and should therefore be complemented by microbiological and molecular confirmation for accurate etiological diagnosis.
A core methodological contribution of the present work is the molecular confirmation strategy. ITS regions between the 18 S, 5.8 S, and 28 S rDNA are widely used targets for fungal identification and taxonomy (Chen et al. 2001; Leaw et al. 2007; Yang et al. 2018). While many mastitis studies have relied primarily on culture-based phenotyping and commercial identification systems, molecular methods such as PCR and sequencing have been applied less consistently, despite their superior discriminatory power at species level. In the present study, commonly used universal ITS primers failed to confirm several phenotypically suspected isolates and certain control strains, necessitating the development of genus-specific ITS primers targeting conserved regions and subsequent sequencing. The successful amplification of all isolates with the optimized primers, followed by sequence-based identification, supports the value of tailored molecular tools for robust species confirmation under field conditions, particularly for NAC species that may be misclassified by phenotypic approaches alone.
In parallel with molecular diagnostics, chromogenic media are increasingly used for presumptive identification of medically and veterinary relevant Candida species. The use of commercial chromogenic agars for rapid differentiation-especially for C. albicans, C. krusei, and C. tropicalis-has expanded in recent years (Cilvez and Turkyılmaz, 2019; AL-Abedi, 2020; Yüksel Dolgun et al. 2022). In a comparative study, Cilvez and Turkyılmaz (2019) reported high agreement between chromogenic agar and sequencing for C. tropicalis and C. krusei, while noting limitations for less common species due to overlapping colony colors. Similarly, the present study observed an overall concordance of 94.9% between chromogenic agar and sequencing, supporting the utility of chromogenic media as a rapid screening tool. However, misidentification occurred for some isolates, and colony color variation among sequencing-confirmed C. krusei isolates was also noted, reinforcing that chromogenic agar results should be interpreted cautiously and confirmed by molecular methods when precise species determination is required.
To explore pathogenic potential beyond species identification, virulence-associated gene profiles were examined in C. albicans isolates. Virulence determinants of C. albicans, including adhesins and secreted hydrolytic enzymes, facilitate tissue invasion, enhance adhesion to host cells, and may contribute to antifungal resistance and persistence (Eldesouky et al. 2016; Talapko et al. 2021). SAP1, PLB1, and ALS1 genes have been associated with virulence in human clinical isolates (Shrief et al. 2019; Lim et al. 2021), while evidence from mastitis-associated isolates remains limited (Eldesouky et al. 2016; Mousa et al. 2016; AL-Abidy et al., 2019; Sav and Öztürk 2022). In the present study, both buffalo-derived C. albicans isolates carried SAP1, while ALS1 and PLB1 were not detected. Although this pattern may be influenced by the limited number of isolates, the detection of SAP1 provides molecular support for virulence potential in buffalo-associated isolates and represents, to the best of our knowledge, the first molecular evidence of SAP1 carriage in C. albicans isolates originating from Anatolian buffaloes with mastitis. Although interpretation is constrained by the limited number of C. albicans isolates, the detection of SAP1 in subclinical mastitis-derived isolates suggests that virulence-associated traits may contribute to persistence within the mammary gland even in the absence of overt clinical inflammation.
Antifungal susceptibility testing revealed substantial resistance across isolates from both host species, highlighting a practical challenge in the management of mycotic mastitis. Resistance profiles of mastitis-associated Candida species vary by geography, host population, and methodology (Milanov et al. 2014; Du et al. 2018). Studies from Türkiye have also reported high resistance levels among bovine mastitis isolates (Demir 2016; Erbaş et al. 2017; Sonmez and Erbas 2017; Yüksel Dolgun et al. 2022). Currently, buffalo-derived isolates were resistant to flucytosine and showed high resistance to several azoles and echinocandins, whereas susceptibility was highest to voriconazole. Cow-derived isolates exhibited similar resistance trends, with the highest susceptibility observed for ketoconazole and voriconazole. At species level, the universal fluconazole resistance in C. krusei isolates aligns with the intrinsic resistance widely recognized for this species. It should be emphasized that the antifungal agents evaluated in this study were assessed solely for in vitro susceptibility profiling. Therefore, any clinical application in lactating food-producing animals requires careful consideration of regulatory approval status, maximum residue limits (MRLs), and established withdrawal periods. These findings should be interpreted in the context of the subclinical nature of the sampled cases, regional antimicrobial usage practices, and the predominance of NAC species, all of which may influence both species distribution and antifungal resistance profiles (Miao et al. 2023; Raheel et al. 2023; Morales-Ubaldo et al. 2023).
In conclusion, the predominance of NAC species, the molecular evidence of SAP1 carriage in buffalo-derived C. albicans isolates, and the high antifungal resistance levels observed collectively emphasize the need for accurate species-level identification and informed antifungal decision-making in mastitis management, with potential relevance to veterinary public health within a One Health framework.
Conclusion
The current work concluded that Candida isolates were confirmed in 7.83% and 7.49% of the tested milk samples of buffaloes and dairy cows, respectively. The comparable isolation rates observed between host species indicate that yeast-associated intramammary infections should be considered in both buffalo and cattle populations, particularly in regions where mastitis surveillance and control strategies primarily target bacterial pathogens.
Non-albicans Candida species predominated in both animal groups, with Pichia kudriavzevii (C. krusei) and Kluyveromyces marxianus (C. kefyr) being the most frequently identified taxa. This distribution supports the growing recognition of non-albicans Candida species as significant etiological agents of subclinical mastitis and highlights the limited diagnostic value of assuming C. albicans as the principal yeast pathogen.
The application of newly designed genus-specific ITS primers enabled reliable molecular confirmation of all phenotypically suspected isolates and addressed limitations encountered with universal ITS primer sets. Chromogenic agar showed high overall concordance with sequencing results; however, reduced accuracy for certain species underscores the need for molecular confirmation for precise species-level identification.
Virulence gene analysis demonstrated the presence of the SAP1 gene in both C. albicans isolates recovered from buffalo milk, whereas ALS1 and PLB1 were not detected. Although based on a limited number of isolates, this finding may represent the first molecular evidence of SAP1 carriage in buffalo-derived C. albicans isolates from Türkiye.
Antifungal susceptibility testing revealed high resistance rates to flucytosine, itraconazole, amphotericin B, and caspofungin in isolates from both host species, while ketoconazole and voriconazole exhibited the highest in vitro activity. These findings emphasize the importance of species-level identification and susceptibility-guided interpretation when evaluating yeast-associated mastitis.
Overall, the results provide region-specific epidemiological data and support the integration of molecular diagnostics into routine mastitis investigations, contributing to improved herd health management and more accurate etiological diagnosis.