Nanostructured propolis ointment and platelet-rich plasma as novel biotherapeutics for cutaneous wound repair in an experimental canine model
Mona N. Wafy, Elham A. Hassan, Samar Saeed, Marwa S. Khattab, Huda O. AbuBakr, Aya M. Yassin, Ashraf M. Abu-Seida
TL;DR
This study shows that combining nanostructured propolis ointment with platelet-rich plasma improves wound healing in dogs by boosting antioxidants and tissue repair.
Contribution
The novel contribution is the development and evaluation of a bio-enhanced PRP formulation with nano-propolis for wound healing.
Findings
PRP and PRP-nano-propolis reduced granulation tissue and improved collagen maturation compared to controls.
The combination of PRP and nano-propolis enhanced antioxidant activity and TNF-α expression.
PRP alone induces early cytokine activity, while propolis provides a delayed but sustained effect.
Abstract
Effective management of cutaneous wounds is challenging in clinical practice. The present study aimed to investigate the relative efficacy and explore the potential differences of nanostructured propolis ointment, platelet rich plasma (PRP) and their combination in enhancing the healing of experimentally induced cutaneous defect in dog model. The study included 6 dogs with 6 skin wounds per dog. A 3-cm full-thickness skin wounds were surgically induced on the lateral thoracic walls. Wounds were randomly allocated to six treatment groups: control, lanolin (vehicle), nano-propolis, PRP, PRP-lanolin, and PRP-nano-propolis. Wound healing progression was evaluated clinically and histologically over 20 days using wound area measurements, epithelization, granulation tissue formation, and collagen deposition. The tumor necrosis factor-alpha (TNF-α) was immunohistochemically assessed.…
Genes, proteins, chemicals, diseases, species, mutations and cell lines named across the full text — each resolved to its canonical identifier and authoritative record.
Click any figure to enlarge with its caption.
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8- —Cairo University
Peer Reviews
No public reviews on file for this paper yet. If you reviewed it on a platform where reviews are public (OpenReview, ICLR, NeurIPS, ICML), you can paste yours below so the community can read it here.
Videos
No videos yet. Explain this paper in a talk, walkthrough, or lecture? Add one.
Taxonomy
TopicsWound Healing and Treatments · Periodontal Regeneration and Treatments · Bee Products Chemical Analysis
Background
Skin is the largest body organ representing a vital role in maintaining homeostasis, serving as a physical, biological and chemical protective interface between the body and the environment [1]. Cutaneous wounds and defects resulting from burn, trauma, incision, excision or lacerative injury represent great challenge for the clinical practitioner. In 2017–2018, the United Kingdom’s National Health Service reported that an estimated 3.8 million individuals were affected by various types of wounds, with approximately £8.3 billion as incurring costs [2]. In the United States, skin injuries impacted the quality of life of 2.5% of the population and affected around 8.2 million healthcare beneficiaries in 2014, with USD $ 28.1–96.8 billion total wound-related expenditures [3].
Wound healing is a complex biological process that encompasses spatially and temporally overlapping processes including hemostasis, inflammation, proliferation, and remodeling. Diverse cellular and molecular mechanisms are included for each stage aiming at tissue repair and restoration of homeostasis. Modern advances used in wound healing and restorative therapies are directed towards speeding up the process of wound healing by accelerating re-epithelialization, enhancing collagen synthesis, promotion of angiogenesis, in association with creating unfavorable environment for bacterial proliferation, thereby reducing the risk of wound infection [4, 5]. Despite the extensive research in wound healing therapies, still there remains a critical need to investigate topical formulations that can effectively accelerate the healing process.
The use of natural product-based formulations has garnered increasing attention due to their bioactive properties, biocompatibility, and lower risk of adverse effects. Investigating the therapeutic potential of such natural formulations represents a promising avenue for developing more effective, accessible, affordable, and sustainable wound care solutions specially with the presence of significant financial burden.
Propolis is a resinous amalgam obtained by honeybees (Apis mellifera), it contains over 420 distinct chemical compounds including bioactive constituents with potent antimicrobial and antioxidant properties [6]. Propolis had been traditionally used in folk medicine for wound healing, skin regeneration, and pain relief. Recently, propolis is gaining scientific recognition for its therapeutic efficacy across different wounds, including diabetic, infectious, surgical, and burn-related injuries due to its multifaceted biological activities, including anti-inflammatory, antioxidant, antimicrobial, and tissue-regenerative effects [7, 8]. Experimental and clinical studies have demonstrated that topical application of propolis reduces wound size, promotes re-epithelialization, decreases inflammatory cell infiltration, and enhances dermal tissue repair more effectively than conventional treatments like silver sulfadiazine [9]. Its broad-spectrum antibacterial activity further contributes to its wound-healing efficacy by disrupting microbial cell membranes, inhibiting protein synthesis, and preventing biofilm formation. A major challenge limiting the widespread of pharmaceutical formulations of propolis is its poor solubility in aqueous solution [10]. Propolis is predominantly soluble in ethanol and other organic solvents [11], which may induce irritation or cytotoxicity when used in injured skin. Solubility limitation not only restricts propolis bioavailability and therapeutic efficacy but also may complicate the formulation of stable, skin-compatible delivery systems. Therefore, alternative solvents, encapsulation techniques or carriers are required for improved solubility and bioavailability of propolis in skin wound preparations.
Lanolin, a natural wax derived from wool, serves as an ideal base in topical cutaneous wound formulations. It is an effective emollient, reducing trans-epidermal water loss, maintaining a moist wound bed, retaining moisture into the skin which supports cell migration, collagen synthesis, and overall tissue repair [12]. Lanolin is a biocompatible and well-tolerated carrier that can safely carry lipophilic compounds such as propolis.
The use of nanotechnology may provide a promising alternative to overcome propolis solubility-related limitations, increasing bioavailability, controlled release which ultimately improves drug delivery and therapeutic efficacy [13–15]. Nanoparticles increase the surface area-to-volume ratio, allow better penetration through skin barriers, prolonged retention at the wound site, which potentially boost therapeutic effects [16]. The sustained release of bioactive compounds from nano-preparations maintains an effective concentration over longer periods which reduces the need for frequent re-application. Recent studies were designed to report the usefulness of nano-propolis in treating skin edema, wound healing and tissue regeneration in animal models [17]. The use of nano-propolis resulted in a significant reduction in wound size, quicker re-epithelialization, and enhanced fibroblast proliferation in diabetic rat models [18, 19]. Moreover, nano-propolis have substantial antibacterial and cytotoxic activity, making them useful against pathogens such as Staphylococcus aureus [20].
Platelet-rich plasma (PRP) is a blood-derived product enriched with platelets. It contains a broad spectrum of growth factors and fibrinogen that collectively enhance tissue regeneration and promote wound healing [21]. PRP has gained widespread clinical use in various fields, including orthopedics, ophthalmology, dentistry, and wound care. Recently, the use of PRP in dermatology has garnered considerable interest from both clinical and experimental settings [21]. PRP serves as a biologically active reservoir of growth factors essential for wound healing cascade. These include platelet-derived growth factor (PDGF), platelet-derived angiogenesis factor (PDAF), platelet-derived epidermal growth factor (PDEGF), transforming growth factor-β (TGF-β), platelet factor-4 (PF-4), insulin-like growth factor-1 (IGF-1), fibroblast growth factor (FGF), and endothelial growth factor (EGF) [22, 23]. Collectively, these factors orchestrate cellular migration, proliferation, angiogenesis, and Extracellular matrix (ECM) remodeling, thereby optimizing tissue repair and regeneration [24]. It has been reported that PRP promote re-epithelization, reduce inflammation and increased granulation tissue development, which is necessary for efficient wound closure [25].
Although the use of both propolis nanoparticles and PRP have been independently reported to enhance tissue regeneration, there is a noticeable lack of direct comparative studies evaluating their relative efficacy in a controlled experimental setting. Furthermore, the synergistic or differential mechanisms of action between a naturally derived nanomaterial like nano-propolis and a biologically active autologous preparation like PRP remain poorly understood. This gap is particularly significant given the increasing interest in combining or optimizing bioactive agents for enhanced clinical outcomes in cutaneous wound healing. We hypothesize that the semi-solid nature of lanolin may help to physically stabilize the nano-propolis particles, reducing aggregation and preserving the nano-size distribution provides a protective matrix that may extend the shelf life of the active compound.
The aim of the present study was to investigate the relative efficacy and explore the potential differences of nanostructured propolis ointment, platelet rich plasma and their combination in enhancing the healing of experimentally induced cutaneous defect in experimentally controlled dog model.
Methods
Animals
The present study was conducted on 6 clinically healthy adult (15–18 months) mongrel dogs weighing 20–22 kg. Dogs included in this study were the property of the Department of Surgery, Anesthesiology and Radiology- Faculty of Veterinary Medicine- Cairo University, which routinely utilizes dogs for educational and research purposes.
Before enrolment in the study, complete clinical and hematological examinations were made for each dog. During the study, dogs were housed individually in separate cages, fed twice daily with commercially available maintenance, dry food with unfettered access to water. All study procedures were approved by the Institutional Animal Use and Care Committee (IACUC) of Faculty of Veterinary Medicine- Cairo University (approval # VetCU 08072023705). The study protocol was approved by Scientific Committee at the Department of Surgery, Anesthesiology and Radiology- Faculty of Veterinary Medicine- Cairo University. Since the animals were not privately owned and no client-owned animals were involved, informed consent from private owners was not applicable. All experimental procedures were done in accordance with ARRIVE guidelines.
Study design
A prospective experimental study was designed to induce cutaneous wound defects in 6 dogs. For each dog, 6 circular full thickness defects of 3 cm diameter were induced within the lateral thoracic wall using a sterilized custom-made plastic template. Cutaneous wounds were randomly allocated into one of the following groups.
- Control Group: defects were daily dressed using sterile saline solution.
- Lanolin Group: defects were daily dressed using lanolin (vehicle) for 21 days.
- Platelet rich plasma (PRP) Group: defects were subjected to single peri-lesional injection of PRP.
- Nano-propolis Group: defects were daily dressed using nano-propolis ointment prepared on lanolin carrier for 21 days.
- PRP + lanolin Group: defects were subjected to single peri-lesional injection of PRP and daily dressing with lanolin for 21 days.
- PRP-nano-propolis Group: defects were subjected to single peri-lesional injection of PRP and daily dressing with nano-propolis in lanolin carrier for 21 days.
Dogs were evaluated daily for 21 days. Wounds were photographed weekly for quantitative planimetric evaluation. Biochemical evaluation was made using wound fluid samples collected at 0, 5, 10 and 20 days. Biopsy sampling was obtained at the same evaluation times following wound fluid sampling for gene expression, histopathologic and immunohistopathologic evaluations. Dogs remained under close supervision throughout the study and post-treatment period to ensure complete wound healing and welfare. None of the dogs were euthanized or sacrificed; they were reintegrated into the teaching program for non-invasive educational purposes at Department of Surgery, Anesthesiology and Radiology- Faculty of Veterinary Medicine- Cairo University.
Preparation of nano-propolis
A commercially available propolis was purchased (Bee propolis^®^, Imtenan Company, Obour city, Egypt), the resinous material was kept in refrigerator till being extracted. A 50 gm of dried ground propolis was dissolved in 500 ml of 99% ethanol using a magnetic stirrer. The mixture was left to stir for 72 h at 25 °C. The resulting solution was then filtered using filter paper to remove any impurities. The alcoholic extract was evaporated under vacuum conditions using a rotary evaporator at 45 °C till complete dryness. The extract was kept in a refrigerator till use. Nano-propolis was prepared according to [15, 26] where a mixture of Tween 20 and Tween 80 was added dropwise and maintained on stirring and ultrasonication resulted in formation of nano-propolis, the solution was filtered with a 200 nm nano-filter
Characterization of nano propolis
- Transmission electron microscopy (TEM)
Morphological evaluation of propolis nanoparticles was made using transmission electron microscopy (TEM). A nano-propolis sample was fixed on stubs with double carbon tape and covered by a gold film during the metallization process at 10 mA for 7 min. Micrographics were taken using a transmission electron microscope (JEOL JEM-1400 plus TEM Inc., Japan).
- Zeta potential (ZP)
The zeta potentials of the propolis nanoparticles were determined by dynamic light scattering (DLS) using the Zetasizer (Nano-Sizer SZ90, Malvern Instruments, UK). Measurements were recorded three times and the mean was calculated.
- Fourier transform infrared spectroscopic analysis
Fourier transform infrared spectra (FTIR) of the propolis and propolis nanoparticles were obtained using an FTIR spectrophotometer (Jasco FT/IR 460 plus spectrometer) equipped with an attenuated total reflection (ATR) cell. Samples were homogenized with KBr, pressed into pellets, and subsequently positioned on the ATR crystal. Spectra were recorded at room temperature over the wavelength range of 500–4000 cm^−1^, with a scanning speed of 2 mm^−1^ and a resolution of 4 cm^−1^.
- X-ray diffraction (XRD) of nano-propolis
The XRD measurements for the nano-propolis were made using Philips PW1710 X-ray diffractometer at Cu Ka radiation (k = 1.54186 A°). The XRD pattern was recorded from 5° to 80° 2 H, with a step size of 0.020° 2 H and collecting 10 s per step.
Preparation of nano-propolis ointment
A 2 gm of nano-propolis was dissolved in 8 ml of NMP (N-Methyl-2-pyrrolidone) solvent, the mixture was sonicated to ensure complete dissolution. A 90 gm of lanolin was sonicated and melted in a water bath to obtain a homogenous fluid. The propolis mixture was added to the lanolin and thoroughly stirred to ensure even distribution. The nano-propolis ointment was transferred to the storage container, labelled with content and preparation date, stored in cool dry place away from sunlight to maintain stability and efficacy.
Preparation of autologous PRP
A 10 mL whole blood sample was taken from each dog in a citrate-phosphate dextrose solution and centrifuged at 1500 rpm for 10 min. Following centrifugation, three layers were obtained. The plasma layer at the top was transferred to another centrifuge tube and centrifuged again at 3000 rpm for 20 min, yielding two layers: platelet-poor plasma (PPP) at the top and platelet-rich plasma (PRP) below. The PRP was then activated by adding calcium chloride in a 1:10 ratio (0.1 ml CaCl_2_ for each 1 ml PRP) [27, 28]. A PRP sample was sent for characterization using an autohematology analyzer (Mindary Vet BC 5000, Mindray Animal Medical Technology Co., China) to ensure adequate platelet count prior to injection. Subcutaneous infiltration of a 3 ml of activated PRP were injected peri-lesional as described by Farghali et al., [27, 28].
Surgical procedures
Skin defects were induced under the effect of general anesthesia. Dogs were premedicated with 0.05 mg/kg atropine sulphate 0.1% (Atropine Sulfate^®^, El Nasr pharm. Chem. Co. Egypt) subcutaneously and 1 mg/kg xylazine HCl 2% (Xylaject^®^, ADWIA Co. Egypt) through intramuscular injection. Anesthesia was induced using 10 mg/kg ketamine HCl 5% (Ketamine^®^, Rotex Medica, Germany) intramuscularly and using sodium thiopental (Anapental^®^: Sigma-Tec, Egypt) at a dose of 25 mg/kg through a canulated cephalic vein.
Dogs were positioned on sternal recumbency where both thoracic walls were prepared for aseptic surgery. Three circular full-thickness skin wounds with a 3 cm diameter, were induced bilaterally (6 skin wounds/dog) on the lateral thoracic wall 5 cm away from the dorsal midline and with 10 cm apart [29]. The circular skin defects were induced using a scalpel and a sterile plastic template.
Skin defects were randomized and treated according to defect grouping. All defects were covered by sterile dressing, wrapped with sterile gauze, and elastic bandage. An Elizabethan collar was used around the dog’s neck to prevent the animal from licking or chewing the wound. Dogs were administered prophylactic dose of third-generation cephalosporin (Ceftriaxone^®^ 1000 mg i.m., Novartis Co., Sandoz, Switzerland) once daily for 7 post-operative days.
Objective evaluation of wound healing
Skin defects were evaluated daily to track wound healing. Defects were evaluated for inflammation, granulation tissue formation, and epithelialization. Wounds were photographed at 7, 14, and 21 days for sequential monitoring of the healing progression. Photographs were taken using a high-resolution digital camera (Oppo Reno 8T- 108 Mega pixels, Dongguan, China). The camera was placed perpendicularly at a constant distance from each wound with placement of a ruler next to the wound. Digital photographs were transferred to computer system where objective tracking of wound healing was made using a software program (Digimizer^®^ 6.4.4 image analysis software, MedCalc Software, Ostend, Belgium.).
Quantification of wound area was made by tracing wound margins using the program’s tracing tool to be expressed as cm^2^. Total wound area (cm^2^), Epithelization area (cm^2^), Granulation tissue area (cm^2^), Epithelization %, Wound size %, Wound contraction %, Healing % and non-healing % were calculated for each wound at 0, 7, 14, 21 days.
Total wound area (TWA) was defined as the total wound area measured at examination day including both epithelization and granulation area. TWA = open wound area (granulation area) + epithelization area. Where epithelization area was defined as the area of the newly formed epithelial tissue, and the granulation tissue area is defined as the open wound area [16].
Wound size % (% WS) was calculated by measuring the TWA at specific date in relation to initial wound area * 100 (% WS_(day x)_ = TWA_(day x)_ / TWA_(day zero)_ * 100)
Wound contraction % (WC %) was calculated as WC % at day (day x) = 100 - % WS (day x).
Epithelization area (EA) at day (day x) was calculated as: EA (day x) = TWA (day x) - granulation area (day x). Epithelization % at day x was calculated as: E% (day x) = Epithelization area (day x)/ TWA (day x) *100.
The % of wound healing at specific day (day x) = 100 - % of non-healing (x), and the % of non-healing at specific day ( day x)= granulation area (day x)/ TWA (day zero) * 100.
Biochemical evaluation of wound healing
Wound fluid samples were collected for measuring the total antioxidant capacity (TAC), and malondialdehyde (MDA) concentration. Biopsy samples were used for quantitative real-time polymerase chain reaction and evaluation of canine platelets derived growth factor beta (PDGF-β).
- Wound fluid preparation
Wound fluid samples were collected at 0, 5, 10 and 20 days following a previously outlined protocol [27]. Skin wounds were cleaned using sterile water before applying an occlusive dressing over the wound. After 10 min, the accumulated exudates at the dressing were collected by washing with 1 ml of saline solution. Wound fluid samples were centrifuged at 14,000 g for 10 min to remove cellular debris and particulate matter. The resulting supernatants (500 µl) were carefully collected, aliquoted, and stored at − 80 °C. The protein content of each sample was determined according to the method described by Bradford, 1976 [30].
- Assessment of total antioxidant capacity (TAC) (mM/L)
The TAC was determined by enzymatic reaction of sample antioxidants with residual H_2_O_2_ using a colorimetric method that involves the conversion of 3,5,dichloro–2–hydroxy benzensulphonate to a colored product by using commercially available assay kits (Bio Diagnostic, Giza, Egypt). The absorbance was measured at 505 nm using UNICO-UV-2100 spectrophotometer.
- Assessment of malondialdehyde (MDA) concentration (nM/ml)
The MDA concentration was used as an index of lipid peroxidation. MDA was determined by measuring the thiobarbituric acid reactive species (Bio Diagnostic kits, Giza, Egypt). The absorbance of the resultant pink product was measured at 534 nm by UNICO-UV-2100 spectrophotometer [31].
- Biopsy sampling
Biopsy samples were obtained from separate sites from different groups and were not performed at the experimental wound areas subjected to serial photographic or planimetric evaluation. Skin wounds were rinsed with sterile normal saline solution. Under aseptic precautions, skin biopsies were obtained using an 8-mm biopsy punch at 5-, 10- and 20-days post-surgery. Biopsy samples were taken from wound margin including the defect as well as 2–3 mm of normal skin with a depth of 4 mm.
- qPCR-based quantification of TGF-β and MEPE gene expression
Total RNA was extracted from skin biopsy samples using the QIAamp RNA Mini Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions. RNA purity and concentration were assessed with a NanoDrop ND-1000 spectrophotometer. Complementary DNA (cDNA) was synthesized from the isolated RNA using reverse transcriptase (Fermentas, EU). Quantitative real-time PCR (qPCR) was conducted in a final reaction volume of 20 µl containing 1 µl of cDNA, 0.5 mM of each primer (Table 1), and iQ SYBR Green Premix (Bio-Rad 170–880, USA). Amplification and fluorescence detection were performed using a Bio-Rad iCycler thermal cycler coupled with the MyiQ real-time PCR detection system. All reactions were run in triplicate, and no-template controls were included in each assay. Relative gene expression was calculated using the 2⁻ΔΔCT method [32].
Table 1. Primer sequences of tested genes for Canis lupus familiarisTarget genesAccession no./ReferenceSequence (5’ to 3’)Product sizeGAPDH(Reference gene)Elkady et al., 2024 [33]F: 5’- ATGGGCGTGAACCATGAGAA − 3’R: 5’ CAGTGGAAGCAGGGATGATGT-3’238 bpTGF-βXM_038656896.1F: 5’- TCAAGAAAAGTCCGCACAGC − 3’R: 5’ - GCGCCAGGAATCATTGCTAT-3’170 bpMEPEElkady et al., 2024 [33]F:5’- TCTTTTCAGCGTGACTTGGGCA − 3’R:5’- AGGTGCTGGCTCTTGATTTCTTCT − 3’247 bpGAPDH: Glyceraldhyde-3-phosphate dehydrogenase, TGF-β: transforming growth factor-Beta, and MEPE: matrix extracellular phosphoglycoprotein
- Measuring the level of canine platelet-derived growth factor-beta (cPDGF-β)
The level of PDGFβ was measured using a canine platelet growth factor subunit β, PDGF-β ELISA Kit (Catalog No: BZEK1862, Chongqing Biospes Co., Ltd, China) according to the manufacturer’s instructions. The optical density of the samples was recorded at a wavelength of 450 nm using a microplate reader (ELx800TM Absorbance Readers, BioTek Instruments, Inc., Vermont, USA). Sample concentration was calculated through straight-line regression equation of the standard curve of the standard concentration and the optical density (OD) value, with the sample OD value in the equation (OD = a* Conc. + b) where OD: is the measured absorbance of a sample at a specific wavelength, Conc.: is the concentration of the substance being measured, a (Slope): is the proportionality constant that relates absorbance to concentration (determined from a calibration curve), b (Intercept): is the absorbance value when the concentration is zero (background absorbance).
Histopathologic evaluation of wound healing
Skin biopsies were fixed in 10% formalin, routinely processed, sectioned at 4 μm thickness and stained with hematoxylin and eosin (H & E) stain and Masson’s Trichrome. Examination was made using light microscope equipped with a digital camera (Olympus XC30, Tokyo, Japan).
Immunohistochemical examination
Immunohistochemical examination was made for deparaffinized biopsy tissue samples. Tumor necrosis factor alpha (TNF-α) was evaluated in wounds at 5 days post-surgery. Anti-TNF-α (1:100, Santa Cruz, USA) was added to tissue samples after antigen retrieval using citrate buffer PH 6. Universal Immuno-Detector DAB HRP Brown Detection System (Bio SB, USA) was then applied on the slides according to manufacturer protocol. The positive area % of TNF-α was measured using Image-J software in triplicates for at three different locations for each for each wound at 200 X magnification power.
Statistical analysis
Data were tabulated and presented as mean ± standard deviation. A repeated measure analysis of variance (ANOVA) was used to demonstrate significant differences among different groups at different time points. When significant differences were detected, the Bonferroni Post Hoc test was used for group comparisons. Data were considered statistically significant when the p < 0.05. Data were analyzed using Statistical Package for the Social Sciences, SPSS software program (SPSS Statistics 26, IBM Co., USA).
Results
Characterization of nano-propolis
- Transmission electron microscopy (TEM)
Morphological evaluation of propolis nanoparticles using TEM demonstrated that nano-propolis had a discrete, nearly spherical particle with a mean particle size of 50 nm (Fig. 1). This discrete particle distribution was largely attributed to the anionic carboxylic groups of the nano-propolis causing a strong electrostatic repulsion between particles.
Fig. 1. Transmission electron microscope scan of the propolis nanoparticles demonstrated a discrete distribution of nearly spherical particles of 50 nm diameter
- Zeta potential
The nano-propolis zeta potential displayed sufficiently enough negative surface charge value (− 25.6 ± 5.9 mV) that was sufficiently high to prevent nanoparticle aggregation (Fig. 2a). Zeta potential value suggests that the prepared nanoparticles are suspended steadily and widely, with no tendency to aggregate quickly. The DLS of the nano-propolis evaluated at 25 °C demonstrated that the particle size was around 70- to 75- nm in diameter (Fig. 2b).
- Fourier transform infrared spectroscopy (FTIR)
The spectrum of the propolis was visualized at 3359 cm^− 1^ (Fig. 2c) which could be attributed to the hydrogen bond O–H stretching of the phenol compounds. Absorptions were recorded at 1645, 1507 and 1450 cm^− 1^ which could be attributed to the carbonyl C= O stretching vibration of flavonoids and lipids found in the propolis, bands at 1367 cm^− 1^ due to the C–O–H stretching vibration, band at 1160 cm^− 1^ corresponding to the alkenes C =C bond and band at 1100 cm^− 1^ attributed to the stretching of aromatic ether C–OC bond.
The FTIR spectrum of propolis demonstrated a peak at 3334 cm^− 1^ corresponding to the O–H stretching vibration, a peak at 2925 cm^− 1^ attributed to the C-H stretching vibration, absorptions at 1651 and 1454 cm ^− 1^ due to the carbonyl C =O asymmetric and symmetric stretching (Fig. 2c). In propolis nanoparticles, there was an obvious shift of the peaks corresponding to O-H stretching toward lower wavenumbers in comparison with propolis from 3359 cm^− 1^ to 3334 cm^− 1^. This significant shift of the peaks corresponding to C=O stretching toward higher wavenumbers in comparison with the propolis from 1645 cm^− 1^ to 1651 cm^− 1^ and from 1450 cm^− 1^ to 1454 cm^− 1^ respectively. The shift is accompanied by a decrease in the intensity of these bands which could be attributed to the formation of the propolis nanoparticles. In addition, a new band at 1958 cm^− 1^ was detected in the propolis nanoparticles and was not recorded in the row propolis. Also, the peak at 1507 cm^− 1^ of the row propolis disappeared in the nano-propolis spectrum. The changes within the FTIR absorption bands of the nano-propolis confirm the successful formation of propolis nanoparticles.
- XRD of nano propolis
The XRD pattern of nano-propolis demonstrated an amorphous state, weak crystalline structure (Fig. 2d) which could be correlated to the presence of a wide variety of chemical components within the propolis.
Fig. 2. Zetapotential with zetasizer peak (a), dynamic light scattering (DLS) (b), fourier transform infrared spectra (FTIR)spectrum (c), and X-ray diffraction (XRD) (d) patterns of the propolis nanomaterials
Evaluation of autologous PRP
The mean platelet count of the prepared autologous PRP samples was 755 × 10^3^ platelet/µL (range 600 × 10^3^ − 940 × 10^3^ platelet/µL) indicating adequate platelet count in the prepared PRP.
Objective evaluation of wound healing
Planimetric evaluation of total wound area confirmed an initial similar wound size across all groups. There was a significant main effect of time for total wound area and % of wound size (p < 0.001) where significant reduction in wound area was recorded with the progression of time at different groups. Total wound area and % of wound size were significantly decreased in all groups at all time intervals (p < 0.001). A sharp decrease in wound area was recorded at day 7 compared to the initial wound area indicating an early phase of rapid wound contraction followed by a slow phase of wound healing (day 14 and day 21). Total wound area and % of wound size did not change significantly among different groups at different time points (p = 0.216, p = 0.089) respectively.
Epithelization area was significantly changed among different groups (p = 0.012) and different time points (p = 0.001). There was a main effect of time on epithelialization at all four-time intervals (p < 0.001). Epithelization area was significantly different among Lanolin and PRP (P = 0.000), Lanolin and PRP-nano-propolis (p = 0.017), PRP-Lanolin and PRP (p = 0.011).
Granulation tissue area was significantly changed among different groups (p < 0.001). There was a significant main effect time for granulation area (p < 0.001). Pairwise comparisons of granulation area at different evaluation times revealed a significant difference between all-time intervals (p < 0.001). Granulation tissue was absent in all wounds at the start of the experiment then a sharp increase in granulation tissue formation was recorded at day 7 across all groups suggesting an active phase of wound healing. A steep decline in granulation tissue was recorded on day 14. By the day 21, granulation was almost absent in all groups indicating that wounds were transitioning to later healing (epithelialization and tissue remodeling). Granulation area was significantly differed between the PRP and control (p = 0.001), PRP and Lanolin (p = 0.000) and PRP and nano-propolis (p = 0.035) groups. While granulation area did not change significantly among other groups.
Wound closure progressed naturally over time; there was a significant main effect of time on wound contraction (p < 0.001). Wound contraction % was significantly changed among 0, 7, 14, 21 days (p < 0.001). All treatments are effective in promoting wound closure, where wound contraction % did not change significantly among different groups (p = 0.089). By day 21, all wounds are nearly healed (~ 80% closure) in all groups.
Wound healing % was significantly differed among different groups over time (p = 0.028) and time had a significant main effect on % of healing (p < 0.001). At 7, 14 days, significant increase in wound healing % was recorded in PRP group compared to all other groups (p < 0.05). At 21 days, PRP, Nano-propolis and PRP-nano-propolis groups had significantly increased wound healing % compared to other groups. Consequently, the non-healing % was significantly differed among all groups and all time points (p < 0.001). Significant decrease in wound non-healing % was recorded in PRP, Nano-propolis and PRP-nano-propolis group compared to all other groups (p < 0.05).
The estimated marginal means of planimetric parameters used for objective evaluation of wound healing is demonstrated in Fig. 3; Table 2.
Fig. 3. Objective evaluation of wound healing of different groups at different evaluation times
Table 2. Objective planimetric evaluation of wound healing (mean ± SD) of different groups at different evaluation timesEvaluation criteriaGroupDay 0Day 7Day 14Day 21Total wound area (cm^2^)Control6.6 ± 0.9 ^A, a^4.8 ± 0.6 ^B, a^2.2 ± 0.4 ^C, b^1.8 ± 0.2 ^C, b^Lanolin6.0 ± 1.2 ^A, a^5.0 ± 1.0 ^B, a^1.8 ± 0.3 ^C, b^1.4 ± 0.3 ^C, b^Nano-propolis6.2 ± 0.6 ^A, a^5.3 ± 0.3 ^B, a^1.7 ± 0.2 ^C, b^1.3 ± 0.1 ^C, b^PRP6.4 ± 1.0 ^A, a^4.1 ± 1.0 ^B, a^1.7 ± 0.2 ^C, b^1.5 ± 0.2 ^C, b^PRP-Lanolin6.7 ± 0.9 ^A, a^4.5 ± 0.7 ^B, a^1.7 ± 0.3 ^C, b^1.5 ± 0.2 ^C, b^PRP- Nano-propolis6.7 ± 0.9 ^A, a^5.3 ± 1.0 ^B, a^1.6 ± 0.2 ^C, b^1.3 ± 0.3 ^C, b^Wound size %Control100.0 ^A, a^72.7 ± 11.8 ^B, a^33.7 ± 7.7 ^C, a^27.9 ± 6.8 ^C, a^Lanolin100.0 ^A, a^83.4 ± 15.8 ^B, a^30.8 ± 8.8 ^C, a^25.0 ± 7.5 ^C, a^Nano-propolis100.0 ^A, a^84.7 ± 7.7 ^B, a^27.7 ± 2.4 ^C, a^20.5 ± 2.7 ^C, b^PRP100.0 ^A, a^65.0 ± 12.0 ^B, a^27.5 ± 3.7 ^C, a^23.2 ± 3.6 ^C, b^PRP-Lanolin100.0 ^A, a^74.8 ± 17.6 ^B, a^29.02 ± 7.6 ^C, a^25.0 ± 5.8 ^C, a^PRP- Nano-propolis100.0 ^A, a^78.5 ± 11.9 ^B, a^23.8 ± 3.7 ^C, a^19.0 ± 3.8 ^C, b^Epithelization area (cm2)Control0.0 ^A, a^0.4 ± 0.2 ^B, a^1.2 ± 0.4 ^C, a^1.4 ± 0.4 ^C, a^Lanolin0.0 ^A, a^0.3 ± 0.2 ^B, a^1.0 ± 0.1 ^C, a^1.0 ± 0.5 ^C, b^Nano-propolis0.0 ^A, a^0.7 ± 0.2 ^B, b^1.2 ± 0.1 ^C, a^1.2 ± 0.1 ^C, a^PRP0.0 ^A, a^1.1 ± 0.2 ^B, b^1.3 ± 0.2 ^C, a^1.4 ± 0.1 ^C, a^PRP-Lanolin0.0 ^A, a^0.6 ± 0.3 ^B, c^1.1 ± 0.2 ^C, a^1.1 ± 0.2 ^C, b^PRP- Nano-propolis0.0 ^A, a^1.0 ± 0.2 ^B, b^1.1 ± 0.1 ^C, a^1.2 ± 0.2 ^C, a^Epithelization %Control0.0 ^A, a^6.1 ± 3.2 ^B, a^19.1 ± 7.8 ^C, a^22.4 ± 8.7 ^C, a^Lanolin0.0 ^A, a^5.1 ± 2.8 ^B, a^17.1 ± 3.8 ^C, a^18.0 ± 8.5 ^C, b^Nano-propolis0.0 ^A, a^11.8 ± 3.7 ^B, b^19.5 ± 2.2 ^C, a^19.5 ± 2.4 ^C, b^PRP0.0 ^A, a^17.0 ± 3.4 ^B, c^21.1 ± 5.0 ^C, a^22.9 ± 3.6 ^C, a^PRP-Lanolin0.0 ^A, a^10.0 ± 4.5 ^B, b^18.2 ± 4.1 ^C, a^18.8 ± 4.9 ^C, b^PRP- Nano-propolis0.0 ^A, a^15.3 ± 4.2 ^B, c^16.8 ± 2.4 ^C, a^18.1 ± 3.3 ^C, b^Granulation tissue (cm^2^)Control0.0 ^A, a^4.4 ± 0.6 ^A, b^1.0 ± 0.3 ^A, c^0.4 ± 0.2 ^A, c^Lanolin0.0 ^A, a^4.7 ± 1.0 ^A, b^0.8 ± 0.3 ^A, c^0.4 ± 0.2 ^A, c^Nano-propolis0.0 ^A, a^4.6 ± 0.4 ^A, b^0.5 ± 0.2 ^B, c^0.1 ± 0.0 ^B, d^PRP0.0 ^A, a^3.1 ± 0.8 ^A, b^0.4 ± 0.2 ^B, c^0.0 ± 0.0 ^B, d^PRP-Lanolin0.0 ^A, a^3.9 ± 0.7 ^A, b^0.6 ± 0.2 ^A, c^0.4 ± 0.1 ^A, c^PRP- Nano-propolis0.0 ^A, a^4.3 ± 1.1 ^A, b^0.5 ± 0.1 ^B, c^0.1 ± 0.0 ^B, d^Wound contraction %Control0.0 ^A, a^27.3 ± 11.8 ^B, b^66.3 ± 7.7 ^B, c^72.1 ± 6.8 ^B, c^Lanolin0.0 ^A, a^16.6 ± 15.8 ^B, b^69.2 ± 8.8 ^B, c^75.0 ± 7.5 ^B, c^Nano-propolis0.0 ^A, a^15.3 ± 7.7 ^B, b^72.3 ± 2.4 ^B, c^79.5 ± 2.8 ^B, c^PRP0.0 ^A, a^35.0 ± 12.0 ^B, b^72.5 ± 3.7 ^B, c^76.8 ± 3.6 ^B, c^PRP-Lanolin0.0 ^A, a^25.2 ± 17.6 ^B, b^71.0 ± 7.6 ^B, c^75.0 ± 5.8 ^B, c^PRP- Nano-propolis0.0 ^A, a^21.5 ± 12.0 ^B, b^76.2 ± 3.7 ^B, c^81.0 ± 3.8 ^B, c^% of healingControl0.0 ^A, a^33.4 ± 10.6 ^B, b^85.4 ± 4.6 ^B, c^94.5 ± 3.0 ^B, d^Lanolin0.0 ^A, a^21.6 ± 17.9 ^B, b^86.3 ± 6.8 ^B, c^93.0 ± 2.2 ^B, d^Nano-propolis0.0 ^A, a^27.1 ± 8.2 ^B, b^91.8 ± 2.2 ^B, c^99.0 ± 0.6 ^C, d^PRP0.0 ^A, a^52.0 ± 10.3 ^C, b^93.6 ± 2.2 ^C, c^99.7 ± 0.2 ^C, d^PRP-Lanolin0.0 ^A, a^35.2 ± 16.4 ^B, b^89.2 ± 4.3 ^B, c^93.9 ± 1.8 ^B, d^PRP- Nano-propolis0.0 ^A, a^36.8 ± 13.0 ^B, b^93.0 ± 2.0 ^B, c^99.1 ± 0.6 ^C, d^% of non-healingControl100.0 ^A, a^66.6 ± 10.6 ^B, b^14.6 ± 4.6 ^B, c^5.5 ± 3.0 ^B, d^Lanolin100.0 ^A, a^78.4 ± 17.9 ^B, b^13.7 ± 6.8 ^B, c^7.0 ± 2.2 ^B, d^Nano-propolis100.0 ^A, a^72.9 ± 8.2 ^B, b^8.2 ± 2.2 ^B, c^1.0 ± 0.6 ^C, d^PRP100.0 ^A, a^48.0 ± 10.3 ^C, b^6.4 ± 2.2 ^C, c^0.3 ± 0.2 ^C, d^PRP-Lanolin100.0 ^A, a^64.8 ± 16.4 ^B, b^10.8 ± 4.3 ^B, c^6.1 ± 1.8 ^B, d^PRP- Nano-propolis100.0 ^A, a^63.2 ± 13.0 ^B, b^7.0 ± 2.0 ^B, c^0.9 ± 0.6 ^C, d^
For each parameter, different superscript uppercase letters within the same column indicate statistically significant differences among different groups, different superscript lowercase letters within the same row indicate statistically significant differences among different time points (Bonferroni post hoc test, p < 0.05).
Biochemical evaluation
- Total antioxidant capacity (TAC)
At baseline, TAC values ranged from 1.26 to 1.87 mM/L, with no statistically significant differences among different groups (p > 0.05). At 5 days, a significant reduction in TAC was observed in all PRP-treated groups (p < 0.001), especially in the PRP group (0.42 ± 0.02), which showed the lowest value. This decline may indicate a rapid consumption of antioxidants during the acute inflammatory phase, where oxidative stress is typically high. Conversely, the control (1.95 ± 0.07) and Lanolin (1.73 ± 0.12) groups retained higher TAC levels, possibly reflecting an endogenous, short-lived compensatory antioxidant response to acute oxidative stress during the early inflammatory phase of wound healing, rather than an indication of improved redox balance.
At 10 days, significant differences emerged among all groups (p < 0.001). The control group (0.17 ± 0.006) exhibited the lowest TAC, indicating minimal antioxidant defence during this phase. In contrast, Lanolin (1.44 ± 0.08) showed comparatively higher values, potentially reflecting a stabilizing antioxidant effect. PRP alone (0.11 ± 0.00) dropped to baseline-like levels, further supporting the notion of its active involvement in modulating oxidative bursts during tissue regeneration. The nano-propolis (0.55 ± 0.06), PRP-nano-propolis (0.77 ± 0.18), and PRP-Lanolin (0.75 ± 0.15) groups maintained moderate TAC levels, suggesting effective yet controlled antioxidant action.
By 20 days, all groups demonstrated a general decline in TAC. The PRP group (0.30 ± 0.02) continued to exhibit a significantly lower TAC, implying ongoing utilization of antioxidant defense. Nano-propolis (0.38 ± 0.02), PRP-Lanolin (0.39 ± 0.02), and PRP-nano-propolis (0.34 ± 0.07) maintained similar TAC values, suggesting a sustained yet attenuated antioxidant activity supportive of tissue remodeling (p < 0.05) (Table 3).
Assessment of malondialdehyde (MDA)
Assessment of the oxidative stress status and lipid peroxidation demonstrated a baseline MDA level ranging between 31.16 and 32.00 nM/ml, with no statistically significant differences, confirming comparable baseline oxidative states.
At 5 days, control group exhibited significant increase in MDA (37.32 ± 1.69), indicating increased oxidative stress typically associated with the inflammatory phase of wound healing (p < 0.05). In contrast, all treated groups showed significantly reduced MDA levels, suggesting an early antioxidant effect. The PRP-nano-propolis combination demonstrated the most substantial reduction (10.02 ± 1.91), followed by PRP (14.77 ± 1.26, and lanolin- and nano-propolis-treated groups (~ 19.0 nM/ml). The PRP-Lanolin group (20.30 ± 1.91) also showed a clear antioxidative effect. These findings suggest that PRP, particularly when combined with Propolis, rapidly attenuates oxidative stress following injury.
At 10 days, the downward trend in MDA levels continued, with the PRP (2.15 ± 0.15), PRP-Lanolin (3.73 ± 0.52), maintaining significantly lower oxidative markers compared to control (5.47 ± 0.25), while the PRP-nano-propolis was (6.26 ± 1.15) groups, the lanolin group was (11.14 ± 1.61), and the nano- Propolis was (7.47 ± 0.84) combinations (p < 0.05).
At 20 days, MDA levels reached their lowest in all PRP-containing groups. The PRP-nano-propolis and PRP-Lanolin groups showed the lowest levels of lipid peroxidation (0.20 ± 0.04 and 0.32 ± 0.046, respectively), significantly lower than all other groups, including PRP alone (0.84 ± 0.06) (p < 0.05). This suggests that combining PRP with either nano-propolis or lanolin enhances its antioxidant capacity. The nano-propolis group also maintained a low MDA level (2.07 ± 0.23), while the lanolin group showed a higher final level (5.41 ± 0.87) (Table 3).
Gene expression analysis
- Matrix extracellular phosphoglycoprotein (MEPE)
The expression of (MEPE) demonstrated a baseline normalized MEPE levels (1.00 ± 0.00) across different groups. By time, divergent expression patterns were observed among different groups. At 5 days, the MEPE expression was significantly elevated only in the PRP group (13.45 ± 1.75), indicating a strong stimulatory effect of PRP on early extracellular matrix activity. In contrast, the nano-propolis group showed a significant downregulation of MEPE (0.18 ± 0.03), suggesting a less pronounced early response in matrix remodeling. Lanolin, PRP-Lanolin, and PRP-nano-propolis groups exhibited MEPE levels statistically comparable to control, indicating a more gradual onset of activity.
At 10 days, the PRP-nano-propolis combination showed the highest MEPE expression (4.39 ± 0.14), significantly surpassing all other treatments suggesting a potential synergistic effect between PRP and Nano-propolis, promoting sustained matrix remodeling activity. The PRP-Lanolin group also maintained elevated expression (1.51 ± 0.04), comparable to PRP alone (1.52 ± 0.58), while Lanolin and Nano-propolis alone demonstrated lower levels.
At 20 days, PRP and PRP-nano-propolis continued to show significantly elevated MEPE levels (4.21 ± 0.30 and 3.39 ± 0.35, respectively), indicating prolonged stimulation of matrix remodeling and tissue regeneration. In contrast, MEPE expression in the Lanolin and Nano-propolis groups declined to near-baseline values (0.13 ± 0.02 and 0.37 ± 0.03, respectively), suggesting a more transient or limited effect.
- Transforming growth factor beta (TGF-β)
Assessment of TGF-β expression levels was quantified to evaluate the regenerative potential of different groups. At baseline (Day 0), all groups exhibited uniform TGF-β expression levels (1.00 ± 0.00), confirming standardized starting conditions across treatments. At 5 days, significant variation emerged. The PRP group exhibited a dramatic increase in TGF-β expression (8.49 ± 0.13-fold), that could be linked to the rapid release of platelet-derived growth factors, which are known to promote early fibroblast recruitment, extracellular matrix deposition, and wound contraction. The PRP-nano-propolis group showed moderate upregulation (1.51 ± 0.04-fold), while the control, lanolin, and PRP-lanolin groups showed similarly modest increases (1.88 ± 0.03, 1.88 ± 0.03, and 1.26 ± 0.08 folds, respectively). Interestingly, the nano-propolis group alone displayed a marked suppression of TGF-β (0.10 ± 0.01fold), which may reflect an early anti-inflammatory effect or delayed activation phase. At 10 days, the expression dynamics shifted substantially. The nano-propolis group showed a sharp surge in TGF-β expression levels (5.11 ± 0.42-fold), indicating a delayed but robust stimulatory effect. The PRP group continued to exhibit elevated levels (9.62 ± 0.21-fold), maintaining peak activation of reparative pathways. Notably, the PRP-nano-propolis group also demonstrated high TGF-β expression levels (5.56 ± 0.32-fold), indicating synergistic activation. In contrast, the control and lanolin groups showed a significant down regulation in TGF-β levels (0.51 ± 0.17 and 0.11 ± 0.01 folds, respectively), consistent with the waning of the inflammatory phase and limited reparative signalling. The PRP-lanolin group maintained significant moderate expression (1.56 ± 0.03-fold), suggesting partial enhancement (P < 0.05). By 20 days, the PRP-nano-propolis group exhibited the highest expression of TGF-β (9.30 ± 0.24-fold), surpassing even the PRP group (7.13 ± 0.29-fold), indicating prolonged and enhanced tissue repair and remodelling activation. Nano-propolis alone maintained elevated TGF-β (7.13 ± 0.33-fold), further supporting its role in later-phase wound healing. In contrast, TGF-β expression levels in the control, lanolin, and PRP-lanolin groups decreased further to (0.32 ± 0.18, 0.18 ± 0.07, and 0.12 ± 0.02 folds, respectively), reflecting a decline in reparative signalling and possibly delayed or incomplete wound resolution (P < 0.05) (Table 3).
- Platelet-Derived Growth Factor beta (PDGF-β)
Estimation of PDGF-β demonstrated no significant differences across different groups at baseline where PDGF-β levels ranged from 12.07 to 16.80 pg/ml, indicating comparable physiological conditions prior to treatment initiation. At 5 days, an initial increase in PDGF-β levels was recorded in all groups, reflecting early activation of the wound healing cascade. The PRP group (80.05 ± 8.75) and PRP-nano-propolis group (80.43 ± 7.17) showed significantly higher levels compared to all other treatments (p < 0.001), suggesting a robust early response driven by PRP’s rich growth factor content. The PRP-lanolin group also showed a substantial increase (74.90 ± 6.78), though slightly lower than PRP alone or with nano-propolis. In contrast, the control, lanolin, and nano-propolis groups exhibited more modest elevations (ranging from 34.30 to 40.77 pg/ml), with no significant difference among them.
At 10 days, the increasing trend continued and became more pronounced. The PRP (123.10 ± 8.61) and PRP-nano-propolis (118.67 ± 2.83) groups exhibited peak PDGF-β expression, indicating a sustained and potent stimulatory effect through the proliferative phase of healing (p < 0.05). The PRP-lanolin group (105.07 ± 7.17) also maintained high levels, although significantly lower than PRP alone or in combination with nano-propolis. Notably, the nano-propolis group (33.77 ± 2.93) showed a modest but significant increase compared to control (28.88 ± 1.34), suggesting some independent growth factor-modulating capacity, likely related to its known bioactive components (p < 0.05).
At 20 days, PDGF-β levels remained elevated in the PRP-based groups, supporting their role in driving tissue remodeling and late-stage wound healing. The PRP group maintained the highest PDGF-β level (174.47 ± 7.56), followed by PRP-nano-propolis (165.97 ± 11.76) and PRP-Lanolin (144.40 ± 6.06). These levels were significantly higher than those observed in the control and lanolin groups, which showed a return to near-baseline levels (13.52–15.27 pg/ml), indicating cessation of the reparative signalling. The nano-propolis group maintained slightly elevated levels (17.43 ± 2.63ᵃ), though not statistically different from the untreated control (p < 0.05) (Table 3).
Table 3. Biochemical evaluation of wound healing (mean ± SD) of different groups at different evaluation timesParameterGroupDay 0Day 5Day 10Day 20Total antioxidant capacity (TAC) (mM/L)Control1.26 ± 0.32 ^A, a^1.95 ± 0.07 ^A, a^0.17 ± 0.006 ^C, c^1.36 ± 0.07 ^A, b^Lanolin1.57 ± 0.16 ^A, a^1.73 ± 0.12 ^A, a^1.44 ± 0.08 ^A, a^0.47 ± 0.10 ^B, c^Nano-propolis1.87 ± 0.40 ^A, a^0.82 ± 0.04 ^B, b^0.55 ± 0.06 ^B, b^0.38 ± 0.02 ^B, b^PRP1.62 ± 0.19 ^A, a^0.42 ± 0.02 ^C, c^0.11 ± 0.00 ^C, c^0.30 ± 0.02 ^B, c^PRP-Lanolin1.77 ± 0.45 ^A, a^0.84 ± 0.13 ^B, b^0.75 ± 0.15 ^B, b^0.39 ± 0.02 ^B, b^PRP- nano-propolis1.33 ± 0.11 ^A, a^0.94 ± 0.12 ^B, b^0.77 ± 0.18 ^B, b^0.34 ± 0.07 ^B, b^Malondialdehyde (MDA)(nM/ml)Control31.67 ± 1.93 ^A, a^37.32 ± 1.69 ^A, a^5.47 ± 0.25 ^A, b^2.27 ± 0.10 ^A, c^Lanolin32.00 ± 0.13 ^A, a^19.00 ± 2.82 ^B, b^11.14 ± 1.61 ^B, a^5.41 ± 0.87 ^B, b^Nano-propolis31.90 ± 1.45 ^A, a^19.43 ± 2.20 ^B, b^7.47 ± 0.84 ^C, a^2.07 ± 0.23 ^C, c^PRP31.90 ± 4.68 ^A, a^14.77 ± 1.26 ^C, b^2.15 ± 0.15 ^D, b^0.84 ± 0.06 ^D, c^PRP-Lanolin31.96 ± 1.39 ^A, a^20.30 ± 1.91 ^B, b^3.73 ± 0.52 ^D, b^0.32 ± 0.046 ^D, c^PRP- nano-propolis31.16 ± 1.25 ^A, a^10.02 ± 1.91 ^D, c^6.26 ± 1.15 ^C, a^0.20 ± 0.04 ^D, c^Matrix extracellular phosphoglycoprotein (MEPE) (fold change)CT1.00 ± 0.00 ^A, a^1.51 ± 0.04 ^A, a^0.33 ± 0.02 ^A, b^0.16 ± 0.02 ^A, c^Lanolin1.00 ± 0.00 ^A, a^1.48 ± 0.21 ^A, a^0.80 ± 0.19 ^B, a^0.13 ± 0.02 ^A, c^Nano-propolis1.00 ± 0.00 ^A, a^0.18 ± 0.03 ^B, b^0.30 ± 0.02 ^A, b^0.37 ± 0.03 ^B, b^PRP1.00 ± 0.00 ^A, a^13.45 ± 1.75 ^C, c^1.52 ± 0.58 ^C, b^4.21 ± 0.30 ^C, b^PRP-Lanolin1.00 ± 0.00 ^A, a^1.65 ± 0.18 ^A, a^1.51 ± 0.04 ^C, a^1.17 ± 0.14 ^B, a^PRP-nano-propolis1.00 ± 0.00 ^A, a^1.34 ± 0.08 ^A, a^4.39 ± 0.14 ^D, c^3.39 ± 0.35 ^C, c^Transforming growth factor beta (TGFβ) (fold change)CT1.00 ± 0.00 ^A, a^1.88 ± 0.03 ^B, a^0.51 ± 0.17 ^C, b^0.32 ± 0.18 ^C, b^Lanolin1.00 ± 0.00 ^A, a^1.88 ± 0.03 ^B, a^0.11 ± 0.01 ^D, b^0.18 ± 0.07 ^C, b^Nano-propolis1.00 ± 0.00 ^A, a^0.10 ± 0.01 ^D, c^5.11 ± 0.42 ^B, c^7.13 ± 0.33 ^B, b^PRP1.00 ± 0.00 ^A, a^8.49 ± 0.13 ^A, b^9.62 ± 0.21 ^A, c^7.13 ± 0.29 ^B, b^PRP-Lanolin1.00 ± 0.00 ^A, a^1.26 ± 0.08 ^C, a^1.56 ± 0.03 ^C, a^0.12 ± 0.02 ^D, c^PRP-nano-propolis1.00 ± 0.00 ^A, a^1.51 ± 0.04 ^B, a^5.56 ± 0.32 ^B, b^9.30 ± 0.24 ^A, b^Platelets –Derived Growth Factor beta (PDGFβ) (pg/ml)CT14.27 ± 1.55 ^A, a^37.84 ± 2.45 ^A, a^28.88 ± 1.34 ^A, a^13.52 ± 1.26 ^A, a^Lanolin16.23 ± 2.15 ^A, a^34.30 ± 2.11 ^A, a^29.49 ± 0.84 ^A, a^15.27 ± 1.16 ^A, a^Nano-propolis16.80 ± 1.73 ^A, a^40.77 ± 7.37 ^A, a^33.77 ± 2.93 ^B, a^17.43 ± 2.63 ^A, a^PRP15.40 ± 2.62 ^A, a^80.05 ± 8.75 ^C, b^123.10 ± 8.61 ^C, c^174.47 ± 7.56 ^C, c^PRP-Lanolin15.37 ± 1.24 ^A, a^74.90 ± 6.78 ^B, b^105.07 ± 7.17 ^B, b^144.40 ± 6.06 ^B, b^PRP-nano-propolis12.07 ± 1.46 ^A, a^80.43 ± 7.17 ^C, b^118.67 ± 2.83 ^C, c^165.97 ± 11.76 ^B, b^
For each parameter, different superscript uppercase letters within the same column indicate statistically significant differences among different groups, different superscript lowercase letters within the same row indicate statistically significant differences among different time points (Bonferroni post hoc test, p < 0.05).
Histopathologic examination
Histopathologic evaluation of biopsy samples examined at 5 days demonstrated edema and polymorphonuclear leukocytes infiltration with cast formation at the top of all skin wounds. At 10 days, inflammation was subsided with hyperplasia of the epithelium at the periphery of the wound and re-epithelization of wounds in Lanolin, PRP, and PRP- Nano-propolis groups. Granulation tissue was formed and organized specially in control, PRP and Lanolin groups. At 20 days, the epithelium bridged wounds in all groups, granulation tissue was well arranged and organized in PRP, lanolin, PRP-lanolin and PRP-nano-propolis groups. Control group exhibited less organized granulation tissue despite epidermal continuity (Fig. 4).
Fig. 4. Photomicrograph of biopsy samples of different groups obtained at 5, 10, and 20 days demonstrating different stages of wound healing (H&E staining, X 200 at 5 days, X100 at 10, 20 days)
Masson trichrome staining (MTC) of collagen bundles demonstrated that control and lanolin groups had disorganized collagen bundles with variation of color and breaks in parallel fibers. However, the collagen bundles were organized and had parallel wavy fibers with consistent blue color in PRP group. In nano-propolis group, the collagen bundles were organized, wavy, parallel with little breaks. In PRP-nano-propolis group, the collagen bundles were abundant with little breaks (Fig. 5).
Fig. 5. Photomicrograph of biopsy samples stained with Masson’s Trichrome of different groups examined at 10 days. The collagen bundles were disorganized with variation of color and infiltration in control treated wound. Collagen bundles in the lanolin group exhibited color variations and disruptions in the parallel alignment of fibers. Collagen bundles were organized and had parallel wavy fibers with consistent blue color in PRP group. Collagen bundles were organized, had parallel wavy fibers, and breaks in parallel fibers in PRP-lanolin group. Organized wavy parallel collagen bundles with little breaks in nano-propolis group. Abundant collagen bundles with little breaks in PRP-nano-propolis treated wound. MTC X 100
The mean area percent of MTC stained-collagen was significantly elevated in PRP treated wound compared to control followed by the PRP-nano-propolis group (Fig. 6).
Fig. 6. Mean area percent of MTC stained collagen in different groups at 10 days. The columns represent the mean area ± standard error. Columns bearing different lowercase letters are considered significant at P value < 0.05
Immunohistochemical examination using tumor necrosis factor alpha (TNF-α) in the leukocytes infiltrating the wound and endothelial cells lining the newly formed blood capillaries. TNF-α expression was mild in nano-propolis group, mild to moderate in control and PRP-lanolin group, moderate to severe in lanolin and PRP groups, severely expressed in PRP-nano-propolis group (Fig. 7). The mean area percent of TNF-α immunohistochemistry was significantly elevated in PRP-nano-propolis group compared to control followed by PRP group (Fig. 8).
Fig. 7TNF- alpha immunohistochemistry of skin wounds in different groups at 5 days post induction. a: TNF was mild to moderately expressed in control group, b: moderately to severely expressed in PRP treated wound, c: moderately to severely expressed in Lanolin treated wound. d: mild to moderately expressed in lanolin and PRP treated wound. e: mildly expressed in nano-propolis treated wound. f: severely expressed in nano-propolis and PRP treated wound. Immunoperoxidase X400
Fig. 8mean area percent of TNF- α immunohistochemistry in different groups at 5 days. The columns represent the mean area ± standard error. Columns bearing different lowercase letters are considered significant at P value < 0.05
Discussion
The present study demonstrated that PRP and PRP-nano-propolis treatments markedly enhance wound healing timeline, particularly in the proliferative and remodeling phases. The PRP-nano-propolis combination was especially effective in sustaining wound healing till 20 days, suggesting that nano-propolis may prolong or stabilize PRP’s regenerative signaling. These findings align with the known antioxidant, anti-inflammatory, and pro-regenerative properties of propolis [20, 34]. On the other hand, lanolin and control treatments were associated with delayed wound healing, suggesting limited regenerative impact.
The obtained results revealed that PRP-based treatments (PRP, PRP-Lanolin, PRP-nano-propolis) appeared to promote epithelialization more effectively than control, lanolin, or nano-propolis alone, particularly at later time points. Lanolin and nano-propolis alone demonstrated moderate epithelialization but seem to be slightly less effective compared to PRP-related groups. Control group has the lowest epithelialization, suggesting that active treatments contribute to tissue regeneration. Owing to the presence of different growth factors such as PDGF, TGF-β, vascular endothelial growth factor (VEGF), and epidermal growth factor (EGF), cytokines, and fibrin in PRP, it stimulates angiogenesis, fibroblast proliferation, and collagen synthesis through growth factor release [35]. PRP may have a mild benefit in epithelialization but does not drastically change granulation [36].
Due to its immunomodulatory, regenerative, and antimicrobial properties, propolis is considered a promising natural agent for accelerating wound healing, reducing scar formation, and enhancing overall skin recovery particularly in conditions characterized by chronic inflammation or impaired healing, such as diabetes and burns [37, 38]. Propolis accelerates wound healing by modulating inflammation, enhancing extracellular matrix deposition, stimulating collagen type I synthesis, and promoting keratinocyte proliferation [38, 39]. It also suppresses oxidative stress through inhibition of reactive oxygen species (ROS) formation, thereby protecting cellular components such as lipids, proteins, and nucleic acids from damage [40]. Moreover, propolis upregulates transforming growth factor-β (TGF-β), which plays a crucial role in the early stages of healing. Propolis contains flavonoids, phenolic compounds, terpenes, and aromatic acids with known antimicrobial and anti-inflammatory effects [41, 42] which could be correlated with the promoted antioxidant and anti-inflammatory properties and the resulted promoted tissue regeneration reported in the current study.
Owing to its complex chemical composition and heterogeneous structure, nano-propolis presents challenges in terms of dispersion and miscibility within various solvents and formulation bases [11]. Among the different forms of raw propolis, both waxy and dewaxed variants have proven unsuitable for formulation development. In contrast, alcoholic extracts of propolis have demonstrated superior compatibility, particularly for the preparation of semisolid dosage forms. A formulated propolis-based ointment exhibits a creamy yellow appearance, a pleasant and acceptable odor, homogeneity, and a favorable spreadability profile. The formulation also displays good physicochemical stability and exhibits mild antibacterial activity against Escherichia coli and Staphylococcus aureus strains making it suitable for regular cosmetic use [20].
Morphologic characterization of the prepared nano-propolis using TEM and DLS analyses confirmed accurate particle size and stability, ensuring an effective delivery system that maintains its properties at the wound site. The FTIR analysis confirmed the presence of bioactive compounds in the propolis nanoparticles, which contributed to improved wound closure and faster re-epithelialization, as similarly reported in experimental models [19]. The preparation of propolis nano-ointment involves the strategic combination of propolis nanoparticles, N-methyl-2-pyrrolidone (NMP) solvent, and lanolin as a base, each component chosen for its unique contribution to the ointment’s therapeutic profile and stability. Propolis is a bioactive resin, its encapsulation in nanoparticles increases its solubility, stability, and bioavailability, essential for its effectiveness in cutaneous applications [20]. NMP, a solvent with exceptional polarity and capacity to dissolve bioactive compounds, was selected due to its efficacy in dispersing hydrophobic materials like propolis within ointments. NMP’s structure and high dipole moment support enhanced solubility and stability of nanoparticles in the mixture, facilitating an even distribution of propolis in the final ointment formulation [43]. Lanolin is an ideal carrier in this formulation due to its occlusive and emollient properties, which help maintain skin hydration and enhance the prolonged action of the active compounds on the skin. Lanolin’s hydrophobicity complements the nano-formulated propolis by forming a barrier that can protect wounds and enhance the penetration of the active ingredients, supporting sustained release [44]. The process of sonication ensures a homogeneous mixture by breaking down potential nanoparticle aggregates and facilitating even distribution within NMP. The combination of sonication and NMP enables complete dissolution, creating a stable ointment that leverages the therapeutic potential of nano-propolis, enhancing skin retention and bioactivity [45].
In addition to being a functional base, lanolin had an active supportive component in enhancing skin hydration, stabilization of propolis nano-formulation, and promoting healing which necessitated comparing its effect on wound healing in a separate group to exclude its therapeutic potential. Lanolin compatibility with the bioactive nano-propolis suggests its suitability for topical therapeutic formulations.
The method of preparation of nano-propolis exemplifies the potential for combining traditional bioactive materials with modern nanotechnology to create effective topical treatments, as evidenced by previous studies on similar nanoparticle-infused ointments [46]. This approach supports the therapeutic delivery of hydrophobic compounds and provides a stable, effective option for wound healing applications.
Wound healing is a dynamic and overlapping process traditionally divided into four sequential but interrelated phases. These phases including hemostasis (1–3 days), inflammation (3–20 days), proliferation and granulation tissue formation (7–40 days), and remodeling or maturation (from 40 days up to 2 years). Each phase is characterized by distinct cellular and molecular events, yet considerable temporal overlap exists among them [22].
In the current study, histopathological evaluation allowed detailed assessment of tissue architecture, cellular infiltration, re-epithelialization, and granulation tissue formation across the different experimental groups, thus offering critical insight into the quality and stage of tissue repair. Hemostasis occurs soon after an injury, where blood clots prevent future bleeding. Inflammation involves migration of immune cells including neutrophils and macrophages to the wound site to help in cleaning debris and preventing infection [47]. Proliferation is characterized by the production of granulation tissue, angiogenesis and re-epithelialization, which are critical for wound closure. Remodeling is the restructuring of collagen fibers to reinforce the new tissue and restore full skin functionality [48]. During the inflammatory phase of wound healing, substantial quantities of ROS are generated by infiltrating inflammatory cells. These include radical species such as superoxide anion (O₂⁻) and hydroxyl radical (•OH), as well as non-radical but reactive oxygen intermediates like hydrogen peroxide (H_2_O_2_), hypochlorous acid (HOCl), and hypothiocyanous acid (HOSCN), which can generate radicals in the cellular environment [49]. To counteract the damaging effects of oxidative stress and preserve redox homeostasis-essential for the survival and function of proliferating and migrating cells-various ROS-detoxifying enzymes are activated. These include superoxide dismutase, glutathione peroxidase, catalase, and selenium-containing enzymes [50]. Furthermore, neutrophils recruited to the wound site release myeloperoxidase, which catalyses the conversion of H_2_O_2_ into highly reactive oxidants such as HOCl and HOSCN, contributing both to microbial clearance and tissue damage [49].
Platelets play an essential role in the early stages of wound healing by releasing a variety of biologically active substances from their α-granules. These include catecholamines, serotonin, calcium ions, ATP, fibrinogen, albumin, osteocalcin, osteonectin, and numerous clotting factors, all of which contribute to hemostasis and tissue regeneration [51]. Platelet-derived growth factors (PDGFs) stimulate fibroblasts to synthesize key extracellular matrix (ECM) components such as proteoglycans, glycosaminoglycans, and collagen [52]. Given that platelets are a major reservoir of regenerative factors within blood clots, their concentration at sites of injury has emerged as a promising strategy to enhance wound healing. This principle underlies the development of platelet-rich plasma (PRP) therapy- a concentrated suspension of platelets in a small volume of plasma. PRP serves as a biologically active reservoir of growth factors essential to the wound healing cascade [23]. In the obtained findings, Masson trichrome staining demonstrated that PRP was the most effective treatment for enhancing collagen deposition during wound healing. While nano-propolis and PRP together provide notable improvement, lanolin shows minimal influence on collagen synthesis.
Distinct immunomodulatory roles of each treatment have been investigated by evaluating the TNF-α dynamics at 5 days. TNF-α plays a dual, context-dependent role in wound healing. While sustained or excessive TNF-α signaling is associated with chronic inflammation and tissue degradation, a transient and tightly regulated increase during the early inflammatory phase is essential for effective wound repair. The early peak of TNF-α in the PRP–nano-propolis group reported at 5 days could reflect a controlled inflammatory activation that promotes macrophage recruitment, angiogenic signaling, and subsequent transition to the proliferative phase. This interpretation is supported by the concomitant improvements in antioxidant balance, and growth factor expression.
In the current study, biochemical analyses provided a critical tool in monitoring the progression of skin wound healing, providing quantitative insight into oxidative stress markers, growth factor dynamics, and antioxidant capacity across different experimental groups, thereby enabling a deeper understanding of treatment efficacy and underlying mechanisms.
Total antioxidant capacity reflects the cumulative effect of all antioxidants present in tissues, serving as an important marker for oxidative stress regulation during wound healing, where oxidative stress is known to impair tissue repair and prolong inflammation [53]. The findings of the current study highlighted that PRP, despite its known regenerative properties, is associated with lower TAC values, likely due to its stimulation of intense oxidative processes essential for tissue regeneration [54]. In contrast, nano-propolis and lanolin appear to exert protective antioxidant effects, possibly either by direct scavenging of free radicals or through modulation of endogenous defence mechanisms [42, 55]. The combinations of PRP with nano-propolis or lanolin demonstrated intermediate TAC values, suggesting a potential balancing effect between pro-regenerative and antioxidative roles [56]. The findings underscore the complex interplay between wound healing treatments and oxidative stress modulation. While PRP drives regeneration through high metabolic activity [36, 57], nano-propolis, and lanolin provide adjunctive antioxidant support, potentially minimizing oxidative damage and improving the healing outcome [26, 42].
Assessment of lipid peroxidation through estimation of tissue malondialdehyde (MDA) revealed that elevated MDA levels indicate increased oxidative stress, which can impair tissue regeneration and delay healing [53]. The results demonstrated that skin wounds incorporating PRP, particularly when combined with nano-propolis or lanolin, effectively mitigate oxidative stress during wound healing. Reducing MDA levels is critical, as oxidative stress can delay healing by damaging cell membranes, proteins, and DNA [58]. The potent antioxidant response observed with PRP-nano-propolis, and PRP-Lanolin likely supports enhanced tissue regeneration, reduced inflammation, and improved healing outcomes. These findings further support the therapeutic potential of bio-enhanced PRP formulations in managing oxidative damage during cutaneous wound repair in agreement with previous studies [27, 36].
The matrix extracellular phosphoglycoprotein (MEPE) is one of the “matricellular protein” related to SIBLING family (small integrin-binding ligand, N-linked glycoproteins family) [59]. Though they can attach to structural ECM elements like collagen fibrils or basement membrane, matricellular proteins are released into the extracellular matrix and are thought to have no role in their mechanical activities [60]. In addition, it is strictly controlled to fine-tune its roles during tissue healing and maintenance [61]. In the adult homeostatic tissues, their expression levels drastically decline. Nonetheless, as tissue damage, inflammation, and during healing, the expression of certain matricellular proteins is triggered [62].
The expression of MEPE collectively demonstrated superior regenerative potential of PRP, particularly when combined with nano-propolis. The sustained upregulation of MEPE in the PRP and PRP-nano-propolis groups indicates enhanced extracellular matrix synthesis and possibly accelerated wound healing [8, 63]. The synergistic effect observed with PRP-nano-propolis suggests that nano-propolis may augment the biological activity of PRP, potentially through its antimicrobial and anti-inflammatory properties, creating a favorable environment for tissue repair [63]. MEPE as one of the SIBLING proteins can signal to cells directly by binding to integrins and other cell surface proteins, and can also influence cell activity indirectly via modulating MMPs and complement factor H. It can function as an adhesion modulator as well as an autocrine and paracrine signaling agent [64]. In contrast, lanolin and nano-propolis alone induced only modest or transient changes in MEPE expression, highlighting the need for bioactive enhancement to achieve substantial therapeutic outcomes. The PRP-Lanolin combination showed moderate efficacy, though it did not match the performance of PRP-nano-propolis, emphasizing the latter’s promise as a novel regenerative strategy in cutaneous wound management.
Transforming Growth Factor Beta (TGF-β) is a pivotal cytokine in the wound healing cascade, known for regulating inflammation, stimulating fibroblast activity, and promoting extracellular matrix deposition [65]. The obtained results confirm that PRP and PRP-nano-propolis treatments markedly enhance TGF-β expression throughout the wound healing timeline, particularly in the proliferative and remodelling phases. This in agreement with Laidding et al., 2020; where the PRP increased the expression of TGF-β in rat burn injury [66]. The PRP-nano-propolis combination was especially effective in sustaining high TGF-β levels till 20 days, suggesting that nano-propolis may prolong or stabilize PRP’s regenerative signalling. This aligns with the antioxidant, anti-inflammatory, and pro-regenerative properties of propolis [67, 68]. On the other hand, lanolin and control treatments were associated with weak or transient TGF-β expression, suggesting limited regenerative impact. This is explained by the fact that, the higher TGF-β1 expression early in the healing phase suggested that inflammatory cells were being recruited from the circulation into the injured area [69, 70]. These sequences trigger the production of collagen, angiogenesis, and granulation tissue [69].
The PDGF-β, a critical mitogen involved in the recruitment and proliferation of fibroblasts, smooth muscle cells, and other components essential for tissue repair [57]. The obtained results clearly demonstrate the superiority of PRP-containing treatments in upregulating and sustaining PDGF-β expression throughout wound healing process. The PRP-nano-propolis combination not only mirrored the performance of PRP alone but in some phases, showed additive or synergistic effects. While PRP-Lanolin also proved effective, its PDGF-β levels consistently trailed behind the other PRP-based groups, suggesting a lesser but still beneficial effect. In agreement, it has been reported that PRP treatment of excisional wound in mice increased the PDGF-β [21]. In addition, urinary PDGF-BB has been increased in dogs with UPEC (uropathogenic Escherichia coli) cystitis following intra-vesicular instillation of PRP [53]. The modest effects seen in the nano-propolis group highlight its potential as a supportive agent but also emphasize the enhanced efficacy when combined with platelet-derived products. Lanolin, despite being a widely used topical agent, showed limited ability to stimulate or maintain PDGF-β production, aligning with its primarily emollient rather than bioactive properties [71].
A potential limitation of the current study may include the use of multiple treatment modalities within the same animal. While cutaneous wound healing is predominantly regulated by local paracrine and autocrine mechanisms, and the systemic dissemination of topically applied agents (particularly nanomaterials and PRP-derived products) is considered negligible. Minor systemic influences cannot be completely excluded; however, any such effect would be expected to be uniform across wounds and therefore unlikely to confound the comparative outcomes between treatment groups.
Conclusions
In conclusion, the findings of the current study underscore the potent regenerative capacity of PRP, especially when combined with nano-propolis, to promote cutaneous wound healing. Combining PRP and nano-propolis holds significant promise for accelerating and enhancing cutaneous wound healing by combining the anti-inflammatory and growth factor-mediated pathways.
Based on the promising outcomes and the advantages to obtain histopathologic, and immunohistopathologic, incorporating gene and protein expression analyses in the experimental setting, future studies should prioritize large-scale clinical studies with extended follow-up periods. These studies are essential to comprehensively assess the effects of PRP and nano-propolis on both early-stage wound healing and long-term tissue remodelling. Additionally, investigating the therapeutic potential of these treatments across diverse wound models including diabetic, infected, and burn wounds, which will be crucial to determine their efficacy in various pathological contexts.