GPX4 alleviates airway inflammation by suppressing 5-LO expression and regulating ferroptosis

TL;DR

This study shows that GPX4 reduces airway inflammation in asthma by suppressing 5-LO and preventing ferroptosis, suggesting it could be a new treatment target.

Contribution

The novel contribution is identifying GPX4's role in mitigating asthma through suppression of 5-LO and regulation of ferroptosis.

Findings

GPX4 reduces oxidative stress and ferroptosis markers in LPS-stimulated BEAS-2B cells.

GPX4 inhibits ERK phosphorylation and 5-lipoxygenase (5-LO) expression.

In asthmatic mice, GPX4 alleviates lung damage and inflammation.

Abstract

Ferroptosis has been increasingly implicated in the pathophysiology of asthma. Glutathione peroxidase 4 (GPX4), the key enzymatic suppressor of ferroptosis, has a role in asthma that remains insufficiently defined. Here, we investigated the regulatory function of GPX4 in asthma airway epithelial cells using an OVA-induced murine model in conjunction with a lipopolysaccharide (LPS)-stimulated BEAS-2B cell system. Upregulation of GPX4 markedly reduced intracellular reactive oxygen species (ROS), malondialdehyde (MDA) levels, and the accumulation of ferrous ions and other ferroptosis-related markers, while concomitantly alleviating mitochondrial abnormalities in LPS-stimulated BEAS-2B cells. GPX4 also inhibited ERK phosphorylation and downregulated 5-lipoxygenase (5-LO) expression. In OVA-induced asthmatic mice, GPX4 conferred significant protection, characterized by alleviated lung histopathological damage, reduced inflammatory responses, and attenuation of ferroptosis-associated alterations.

These findings indicate that GPX4 mitigates asthma-related pathological changes primarily through suppression of 5-LO and modulation of ferroptosis-linked oxidative injury, highlighting GPX4 as a potential therapeutic target for asthma management.

The online version contains supplementary material available at 10.1186/s12931-026-03584-8.

Figures

Effects of LPS on the viability of BEAS-2B cells. a, b Cell viability of BEAS-2B cells exposed to increasing concentrations of LPS for different durations, assessed using the CCK-8 assay. Unpaired Student’s t-test was used for two-group comparisons, and one-way ANOVA for multiple-group comparisons. Data are presented as mean ± SD. * *p* < 0.05, *p* < 0.01

GPX4 alleviates ferroptosis in LPS-treated BEAS-2B cells. a Representative transmission electron microscopy images showing mitochondrial morphology in each group. Red, black, and green arrows indicate outer membrane rupture, cristae reduction, and mitochondrial vacuolization, respectively. Scale bars: 0.5 μm (upper), 0.2 μm (lower). b mRNA expression of *FTH*, *SLC7A11*, and *ALOX15* and *GPX4* measured by RT-qPCR. c Representative fluorescence images of intracellular ROS (magnification: 100×). d Intracellular ferrous iron (Fe²⁺) levels. Data are presented as mean ± SD.* *p* < 0.05, *p* < 0.01

GPX4 reduces 5-LO expression, ERK phosphorylation, and MDA accumulation in LPS-treated BEAS-2B cells. a Western blot analysis of GPX4, 5-LO, and p-ERK. b mRNA levels of *GPX4* and *ALOX5* examined by RT-qPCR. c MDA levels across groups. Data are presented as mean ± SD.* *p* < 0.05, *p* < 0.01, * *p* < 0.001, *p* < 0.0001

GPX4 attenuates airway inflammation and epithelial injury in OVA-induced asthmatic mice. a Schematic diagram of the experimental protocol for the OVA-induced asthma model. b Representative H&E- and PAS-stained lung sections (original magnification: 100×, scale bar = 100 μm). c Eosinophil and neutrophil counts in bronchoalveolar lavage fluid (BALF). d Serum levels of TNF-α, and IL-6 quantified by ELISA. e Western blot analysis of GPX4, 5-LO, and p-ERK in lung tissues. f mRNA expression of* Gpx4, Alox5, Tnf, Il6* in lung tissues measured by RT-qPCR. Data are presented as mean ± SD. Data are pres

GPX4 mitigates ferroptosis progression in OVA-induced asthmatic mice. a MDA content in lung tissues. b Levels of ferrous iron (Fe²⁺). c mRNA expression of *Gpx4, Fth1, Slc7a11, and Alox15* in lung tissues. Data are presented as mean ± SD. (n = 3–5). * *p* < 0.05, *p* < 0.01, * *p* < 0.001, *p* < 0.0001

Full text

Introduction

Asthma is a chronic inflammatory airway disease that affects approximately 339 million individuals worldwide and poses a substantial global health burden [1]. Its hallmark pathophysiological features include persistent airway inflammation, airway hyperresponsiveness, reversible airflow limitation, and varying degrees of airway remodeling [2]. Asthma can be triggered by a broad range of stimuli, including allergens (LPS and OVA), respiratory viruses (RV and RSV), bacterial colonization, ambient air pollutants, tobacco smoke exposure, and various occupational irritants [3]. Current clinical management primarily relies on combination therapy with long-acting β₂-adrenergic agonists (LABAs) and inhaled corticosteroids (ICS), with leukotriene receptor antagonists (LTRAs) used as adjunctive treatment [4]. Although current pharmacologic treatments effectively alleviate symptoms, they do not fundamentally modify the disease course [5]. Therefore, elucidating the molecular mechanisms driving asthma is essential for the development of targeted and more effective therapeutic strategies.

Ferroptosis is an iron-dependent form of regulated cell death characterized by the accumulation of lipid peroxides generated through iron overload and ROS [6]. Increasing evidence has implicated ferroptosis in the pathophysiology of asthma. Hallmarks of ferroptosis—including excessive lipid peroxidation and iron accumulation—have been observed in both house dust mite (HDM) and ovalbumin (OVA)-induced murine asthma models [7, 8]. 5-Lipoxygenase (5-LO, encoded by ALOX5) is an enzyme responsible for catalyzing the metabolism of polyunsaturated fatty acids and plays a central role in bronchoconstriction and inflammatory regulation, thereby contributing critically to the pathogenesis of asthma [9]. As the rate-limiting enzyme in leukotriene biosynthesis, 5-LO not only amplifies airway inflammatory responses but also functions as a key molecular mediator linking inflammation with ferroptosis. Recent studies have demonstrated that 5-LO promotes ferroptotic cell death through the AMPK/mTOR pathway, whereas pharmacological or genetic inhibition of 5-LO markedly suppresses ferroptosis [10–12]. In asthma, excessive 5-LO activity leads to overproduction of ROS and accumulation of ferrous ions [13, 14], thereby disrupting airway redox homeostasis [15],enhancing peroxidation of polyunsaturated fatty acids in epithelial membranes, and ultimately triggering ferroptotic injury. The resulting epithelial damage promotes cytokine release, immune-cell infiltration, airway smooth muscle contraction and proliferation, and the development of airway remodeling [16].

Glutathione peroxidase 4 (GPX4) is the central enzymatic suppressor of ferroptosis. By reducing lipid hydroperoxides to their corresponding alcohols using glutathione (GSH) as an electron donor, GPX4 maintains membrane integrity and prevents lipid-peroxide-driven cell death [17]. In contrast, depletion of GSH or excessive lipid peroxides leads to inactivation of GPX4, loss of redox balance, and ferroptosis [18]. Emerging evidence suggests a potential connection between GPX4 dysfunction and airway pathology. GPX4 deficiency has been reported to increase ERK phosphorylation in mice [19], and the xCT–GSH–GPX4 antioxidant axis is considered critical for airway epithelial protection [20]. However, the specific role and mechanistic pathways by which GPX4 regulates asthma pathogenesis remain largely undefined.

In this study, we investigated the function of GPX4 in asthma using an OVA-induced murine model and an LPS-stimulated BEAS-2B epithelial cell system. We further explored the potential involvement of the ERK/5-LO signaling axis in mediating the protective effects of GPX4. Our findings reveal that GPX4 attenuates asthma-related pathological changes by suppressing 5-LO expression and limiting ferroptosis, providing mechanistic insight into its therapeutic potential in asthma management.

Materials and methods

In vivo method

Animals

Specific pathogen-free (SPF) female BALB/c mice (7 weeks old, 18 ± 2 g) were obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Shanghai, China). Before experimentation, animals were acclimatized for one week under controlled conditions (20–24 °C,12 h light/dark cycle) with free access to standard chow and water. All procedures complied with the Guide for the Care and Use of Laboratory Animals and were approved by the Animal Ethics Committee of the First Affiliated Hospital of Wenzhou Medical University (Approval No.WYYYIACUCAEC2026003).

Establishment and treatment of asthma model

Mice were randomly assigned to four groups: normal control (NC), asthma model (OVA), GPX4 activator, dexamethasone phosphate (DXMS) as the positive therapeutic control. N = 3–5 per group. An OVA-induced asthma model was established as previously described with minor modifications [21]. On days 0, 7, and 14, mice were intraperitoneally injected with 200 µL of PBS(Gibco, USA) containing 20 µg OVA(SigmaAldrich, USA) and 2 mg aluminum hydroxide (SigmaAldrich, USA). From days 21 to 23, mice in the NC group were exposed to aerosolized PBS for 30 min, while the remaining groups were challenged with 1% OVA solution via nebulization for 30 min. 2 h before each nebulization, mice in the PBS and OVA groups received intraperitoneal injections of 200 µL PBS. Mice in the GPX4 activator group were administered 200 µL of PKUMDL-LC-101-D04 (10 mg/kg [22],MCE, China) dissolved in PBS, whereas the DXMS group received 200 µL of dexamethasone phosphate (2 mg/kg, MCE, China) in PBS. Model establishment was verified by the presence of characteristic asthma-related behaviors, such as nasal scratching, sneezing, and nodding respiration, after OVA challenge. 24 h after the final challenge, mice were euthanized by intraperitoneal injection of 1.25% Avertin (Laiet, Beijing, China), and bronchoalveolar lavage fluid (BALF), serum, and lung tissues were collected and stored at − 80 °C until analysis.

Bronchoalveolar lavage fluid (BALF) analysis

BALF was obtained by instilling 500 µL of ice-cold PBS into the trachea followed by three gentle aspirations. Samples were centrifuged at 1000 rpm for 15 min at 4 °C. The cell pellet was resuspended in 50 µL sterile PBS for total and differential inflammatory cell counts using a Hemavet 950 multispecies hematology analyzer (Drew Scientific, USA).

Lung histopathology

The middle lobe of the right lung was harvested, fixed in 4% paraformaldehyde, embedded in paraffin, and sectioned at 4 μm thickness. Lung sections were stained with hematoxylin and eosin (H&E) and Periodic Acid–Schiff (PAS). Histological alterations, including peribronchial/perivascular inflammatory infiltration and airway structural remodeling, were evaluated under an upright fluorescence microscope (Leica, Germany). PAS staining was used to assess mucin production and goblet cell hyperplasia.

Detection of cytokines

Serum levels of TNF-α and IL-6 were quantified using ELISA kits (Invitrogen, USA) according to the manufacturer’s protocols.

In vitro method

Cellular culture and treatment

The human bronchial epithelial cell line BEAS-2B was obtained from the Shanghai Cell Bank of the Chinese Academy of Sciences (Shanghai, China). Cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM, Gibco, USA) supplemented with 10% fetal bovine serum (FBS, Gibco, USA) and maintained at 37 °C in a humidified incubator containing 5% CO₂.

BEAS-2B cells were divided into five treatment groups

(1) NC group: treated with PBS; (2) LPS group: exposed to 1 µg/mL LPS (SigmaAldrich, USA) for 24 h [23], (3) GPX4 activator group: co-treated with 1 µg/mL LPS and 65 µM PKUMDL-LC-101-D04 for 24 h [24], (4) GPX4-OE group: transfected with GPX4-overexpression plasmids (GeneAdv, China) using Lipofectamine 3000/P3000 (Invitrogen, USA), followed by 1 µg/mL LPS exposure for 24 h; (5) GPX4-KD group: transfected with GPX4-specific siRNA (GeneAdv, China) using Lipofectamine 3000, followed by LPS stimulation as above.

Cell viability assay

Cell viability was assessed using a Cell Counting Kit-8 (CCK-8, Beyotime, China). BEAS-2B cells were seeded in 96-well plates at a density of 2 × 10³ cells per well and treated with various concentrations and durations of LPS. After treatment, 10 µL of CCK-8 solution was added to each well, and the plates were incubated for 1 h. Absorbance at 450 nm was measured using an iMark microplate reader (Bio-Rad, USA).

Transmission electron microscopy (TEM)

Cells were fixed with electron microscopy fixative at room temperature for 30 min and stored at 4 °C until processing. After dehydration and embedding in epoxy resin, samples were polymerized at 60 °C for 48 h. Ultrathin sections were stained with uranyl acetate and lead citrate and examined under a Hitachi HT-7700 transmission electron microscope.

ROS Measurement in BEAS-2B Cells

ROS levels were measured using a commercial ROS assay kit (Beyotime, China). Treated cells were collected, resuspended in serum-free DMEM, and examined using an EVOS FL Auto Imaging System (Thermo Fisher Scientific, USA).

Ferrous iron measurement

Fe²⁺ levels in BEAS-2B cells and lung tissue homogenates were quantified using a Ferrous Iron Colorimetric Assay Kit (Elabscience, China). Samples were lysed with the provided assay buffer and centrifuged. After reaction mixture preparation and incubation at room temperature for 10 min in the dark, the supernatant was transferred to 96-well plates, and absorbance was measured at 593 nm (iMark, Bio-Rad, USA). Fe²⁺ concentrations were calculated from standard curves.

MDA measurement

MDA levels in cells and lung tissue homogenates were measured using a Lipid Peroxidation (MDA) Assay Kit (Beyotime, China). After lysis and centrifugation, samples were mixed with the reaction solution and incubated at 95 °C for 30 min. Following cooling and centrifugation, 200 µL of the supernatant was transferred to 96-well plates, and absorbance was read at 532 nm. MDA levels were normalized to total protein concentration measured by the BCA Protein Assay Kit (Beyotime, China).

Protein extraction and western blotting

Total proteins were extracted using ice-cold RIPA lysis buffer (Beyotime, China). Protein concentrations were determined using a BCA assay. Equal amounts of protein were subjected to 10% SDS-PAGE and transferred onto 0.45-µm PVDF membranes. Membranes were blocked with 5% skim milk for 1 h at room temperature and incubated with primary antibodies (1:1000) overnight at 4 °C. After incubation with HRP-conjugated secondary antibodies (1:10000) for 1 h at room temperature, protein bands were visualized using a chemiluminescence imaging system (Servicebio, China) and quantified using ImageJ.Target protein expression was normalized to GAPDH or Vinculin and expressed relative to the control group. Graphs were generated using GraphPad Prism 9.0. Antibodies used included:5-LO (Santa Cruz, USA), ERK1/2 (HUABIO, China), p-ERK1/2 (Cell Signaling Technology, USA), Vinculin (Affinity, USA), GPX4 (Affinity, USA), and GAPDH (Affinity, USA).

Real-time quantitative polymerase chain reaction (RT-qPCR)

Total RNA was extracted from BEAS-2B cells and mouse lung tissues using RNAiso Plus (Takara, Japan). RNA purity was confirmed by A260/A280 ratio, and qualified RNA was reverse-transcribed into cDNA using a Takara reverse transcription kit. Gene expression of Il6,* Fth1*,* Slc7a11*,* Tnf*,* Gpx4*,* Alox5*,* Alox15*, Gapdh, ALOX5, ALOX15, SLC7A11, GPX4, FTH1, GAPDH was quantified by RT-qPCR. Relative expression levels were calculated using the ΔΔCt method with Gapdh as the internal reference. Primer sequences are provided in Table 1.

Table 1. All the primers are listed belowPrimerSequence Alox5 F: GGGCTGTAGCGAGAAGCATCR: CACGGTGACATCGTAGGAGT Tnf F: CAGGCGGTGCCTATGTCTCR: CGATCACCCCGAAGTTCAGTAG Il6 F: CTGCAAGAGACTTCCATCCAGR: AGTGGTATAGACAGGTCTGTTGG Alox15 F: GGCTCCAACAACGAGGTCTACR: CCCAAGGTATTCTGACACATCC Gapdh F: AGGTCGGTGTGAACGGATTTGR: GGGGTCGTTGATGGCAACA Gpx4 F: TGTGCATCCCGCGATGATTR: CCCTGTACTTATCCAGGCAGA Slc7a11 F: GGCACCGTCATCGGATCAGR: CTCCACAGGCAGACCAGAAAA Fth1 F: CAAGTGCGCCAGAACTACCAR: ACAGATAGACGTAGGAGGCATAC ALOX5 F: ACAAGCCCTTCTACAACGACTR: AGCTGGATCTCGCCCAGTT ALOX15 F: GGGCAAGGAGACAGAACTCAAR: CAGCGGTAACAAGGGAACCT SLC7A11 F: TCTCCAAAGGAGGTTACCTGCR: AGACTCCCCTCAGTAAAGTGAC GPX4 F: GAAGCAGGAGCCAGGGAGTAR: GGTGAAGTTCCACTTGATGGC FTH1 F: CCCCCATTTGTGTGACTTCAR: GCCCGAGGCTTAGCTTTCATT GAPDH F: GGAGCGAGATCCCTCCAAAATR: GGCTGTTGTCATACTTCTCATGG

Statistical Analysis

Statistical analyses and graphing were conducted using GraphPad Prism 9.0 (San Diego, CA, USA). Data are expressed as mean ± standard deviation (SD). Comparisons between two groups were performed using unpaired Student’s t-tests, whereas comparisons among multiple groups were conducted using one-way ANOVA followed by Dunnett’s post hoc test. A p-value < 0.05 was considered statistically significant.

Results

24 h treatment with 1 µg/mL LPS significantly decreases BEAS-2B cell viability

To determine the effect of LPS on BEAS-2B cell viability, cells were exposed to increasing concentrations of LPS for different durations. As shown in Fig. 1A, 1 µg/mL LPS significantly reduced cell viability, and higher concentrations did not produce further suppression. Therefore, 1 µg/mL was selected for subsequent time-course experiments. LPS exposure for 24 h resulted in the most pronounced reduction in viability (Fig. 1B). Based on these results, 1 µg/mL LPS for 24 h was used in all subsequent experiments.

Fig. 1. Effects of LPS on the viability of BEAS-2B cells. a, b Cell viability of BEAS-2B cells exposed to increasing concentrations of LPS for different durations, assessed using the CCK-8 assay. Unpaired Student’s t-test was used for two-group comparisons, and one-way ANOVA for multiple-group comparisons. Data are presented as mean ± SD. * p < 0.05, ** p < 0.01

GPX4 alleviates LPS-induced ferroptosis in BEAS-2B cells

Mitochondrial ultrastructure was examined by transmission electron microscopy to evaluate ferroptotic changes. Compared with the NC group, both the LPS and GPX4-KD groups showed classical ferroptotic mitochondrial alterations, including cristae reduction, mitochondrial vacuolization, and membrane rupture. These abnormalities were markedly attenuated in the GPX4-OE and GPX4 activator groups (Fig. 2A). Consistently, LPS and GPX4-KD significantly decreased the mRNA expression of FTH1 and SLC7A11, while increasing ALOX15 mRNA levels. GPX4 overexpression or activation reversed these changes (Fig. 2B). ROS and intracellular Fe²⁺ levels were further assessed as key ferroptosis indicators [18]. Immunofluorescence analysis showed pronounced ROS accumulation in the LPS and GPX4-KD groups, both of which were reduced by GPX4 (Fig. 2C). Similarly, GPX4 overexpression or activation markedly attenuated the LPS-induced accumulation of intracellular ferrous iron. While the LPS and GPX4-KD groups exhibited pronounced increases to 379.72% and 373.40% of control levels, respectively, the GPX4-OE and GPX4 activator groups showed only modest elevations of 115.21% and 123.00% (Fig. 2D). Together, these results indicate that GPX4 overexpression effectively mitigates LPS-induced ferroptosis in BEAS-2B cells.

Fig. 2GPX4 alleviates ferroptosis in LPS-treated BEAS-2B cells. a Representative transmission electron microscopy images showing mitochondrial morphology in each group. Red, black, and green arrows indicate outer membrane rupture, cristae reduction, and mitochondrial vacuolization, respectively. Scale bars: 0.5 μm (upper), 0.2 μm (lower). b mRNA expression of FTH, SLC7A11, and ALOX15 and GPX4 measured by RT-qPCR. c Representative fluorescence images of intracellular ROS (magnification: 100×). d Intracellular ferrous iron (Fe²⁺) levels. Data are presented as mean ± SD.* p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001

GPX4 suppresses 5-LO expression in LPS-treated BEAS-2B cells

We next examined whether GPX4 regulates 5-LO expression in BEAS-2B cells. LPS treatment and GPX4 knockdown markedly increased both the mRNA and protein levels of 5-LO, whereas GPX4 overexpression or activation significantly reduced these elevations (Fig. 3A, B). Consistent with these findings, LPS and GPX4-KD enhanced ERK phosphorylation, while GPX4 overexpression or activation suppressed p-ERK levels. Measurement of MDA revealed marked increases in the LPS and GPX4-KD groups, which were substantially attenuated by GPX4 activation or overexpression. Compared with the NC group, MDA levels increased by 117.28% in the LPS group and by 100.33% in the GPX4-KD group, whereas only modest elevations of 38.29% and 59.17% were observed in the GPX4 activator and GPX4-OE groups, respectively (Fig. 3C). These results demonstrate that GPX4 inhibits LPS-induced 5-LO expression, likely through reducing lipid peroxidation and ERK phosphorylation.

Fig. 3GPX4 reduces 5-LO expression, ERK phosphorylation, and MDA accumulation in LPS-treated BEAS-2B cells. a Western blot analysis of GPX4, 5-LO, and p-ERK. b mRNA levels of GPX4 and ALOX5 examined by RT-qPCR. c MDA levels across groups. Data are presented as mean ± SD.* p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001

GPX4 attenuates OVA-induced asthma in mice

To evaluate the in vivo therapeutic potential of GPX4, mice were administered a GPX4 activator or dexamethasone prior to each OVA airway challenge (Fig. 4A). H&E and PAS staining showed that OVA exposure induced extensive peribronchial inflammatory infiltration, goblet cell hyperplasia, and mucus hypersecretion. Treatment with the GPX4 activator markedly ameliorated these pathological alterations (Fig. 4B). In BALF, eosinophil and neutrophil counts were significantly increased in the OVA group but were substantially reduced by GPX4 activation (Fig. 4C). ELISA results indicated marked increases in pro-inflammatory cytokines following OVA challenge and decreases with GPX4 activation (Fig. 4D). Western blot and RT-qPCR analyses further revealed that OVA challenge increased 5-LO expression, enhanced ERK phosphorylation, and upregulated inflammatory cytokines (Tnf, Il6), whereas GPX4 activation reversed these changes (Fig. 4E–F). In summary, GPX4 reduces airway inflammation, suppresses cytokine release, and mitigates mucus hypersecretion in OVA-induced asthma.

Fig. 4GPX4 attenuates airway inflammation and epithelial injury in OVA-induced asthmatic mice. a Schematic diagram of the experimental protocol for the OVA-induced asthma model. b Representative H&E- and PAS-stained lung sections (original magnification: 100×, scale bar = 100 μm). c Eosinophil and neutrophil counts in bronchoalveolar lavage fluid (BALF). d Serum levels of TNF-α, and IL-6 quantified by ELISA. e Western blot analysis of GPX4, 5-LO, and p-ERK in lung tissues. f mRNA expression of* Gpx4, Alox5, Tnf, Il6* in lung tissues measured by RT-qPCR. Data are presented as mean ± SD. Data are presented as mean ± SD .(n = 3-5).* p < 0.05,** p < 0.01,*** p < 0.001,**** p < 0.0001

GPX4 relieves OVA-induced ferroptosis in mice

To determine whether GPX4 exerts its protective effects through ferroptosis regulation, ferroptosis-related indicators were examined in lung tissues. Consistent with our in vitro observations, OVA challenge markedly increased MDA and Fe²⁺ levels in lung tissues. Compared with the NC group, MDA levels increased by 146.83% in the OVA group and by 83.78% in the GPX4 activator group. Similarly, Fe²⁺ levels increased by 1422.95% following OVA challenge, whereas GPX4 activation limited this increase to 974.37%. In parallel, OVA exposure decreased mRNA expression of Fth1 and Slc7a11 but markedly increased Alox15, and all these alterations were substantially mitigated by GPX4 activation (Fig. 5A–C). These results support that GPX4 mitigates OVA-induced asthma at least in part by suppressing ferroptosis.

Fig. 5GPX4 mitigates ferroptosis progression in OVA-induced asthmatic mice. a MDA content in lung tissues. b Levels of ferrous iron (Fe²⁺). c mRNA expression of Gpx4, Fth1, Slc7a11, and Alox15 in lung tissues. Data are presented as mean ± SD. (n = 3–5). * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001

Discussion

Asthma is a chronic and heterogeneous airway inflammatory disorder arising from complex gene–environment interactions, and its pathogenesis remains only partially understood [25]. Globally, asthma accounted for approximately 455,000 deaths in 2019 and continues to impose a considerable economic and social burden [26–28]. Current therapeutic regimens, including glucocorticoids and β₂-agonists, primarily alleviate symptoms rather than fundamentally reversing airway pathology. Long-term glucocorticoid administration is associated with substantial systemic adverse effects [29] ,and a subset of patients exhibit steroid insensitivity [30, 31]. Thus, therapies targeting the underlying pathogenic mechanisms of asthma are urgently needed.

Accumulating evidence has implicated ferroptosis as an important contributor to asthma pathophysiology [32]. Previous studies have shown that ferroptosis is typically characterized by downregulation of ferritin heavy chain 1 (FTH1) and the cystine transporter SLC7A11, together with increased expression of lipid oxygenases such as ALOX15 [33–35]. Consistent with these reports, our study provides direct experimental evidence that ferroptosis is markedly activated in both cellular and murine asthma models. This was evidenced by increased lipid peroxidation, as indicated by elevated malondialdehyde (MDA) levels, excessive accumulation of intracellular ROS and Fe²⁺, concomitant downregulation of FTH1 and SLC7A11, and upregulation of ALOX15.

The airway epithelium functions as the first-line barrier against environmental insults, and epithelial ferroptosis has been proposed as an initiating event that compromises barrier integrity and amplifies airway inflammation [36]. Under asthmatic conditions, arachidonic acid released from damaged epithelial cells serves as a substrate for 15-lipoxygenase (15-LO), thereby promoting lipid peroxidation and ferroptosis while simultaneously enhancing MUC5AC expression and mucus hypersecretion [37–39]. Although mucus-related quantitative indices were not directly assessed in the present study, the pronounced upregulation of ALOX15, together with positive PAS staining observed in our murine models, suggests activation of this pathogenic axis, which may contribute to airway obstruction.

At the ultrastructural level, our transmission electron microscopy revealed characteristic mitochondrial damage during ferroptosis, including mitochondrial shrinkage and structural disruption [40], consistent with our observations. These mitochondrial abnormalities likely represent a major intracellular source of excessive ROS accumulation observed in our models [41]. In turn, excessive ROS generated during ferroptosis is known to activate inflammatory signaling pathways, particularly NF-κB, thereby promoting the release of pro-inflammatory cytokines [42]. In agreement with these established mechanisms, we observed significantly elevated levels of TNF-α and IL-6 in both cellular and murine asthma models, indicating a close coupling between ferroptosis-associated oxidative stress and airway inflammation. TNF-α and IL-6 play distinct complementary roles in asthma pathogenesis. TNF-α functions as a potent amplifier of airway inflammation and can directly enhance airway smooth muscle contractility, thereby contributing to airway hyperresponsiveness [43]. In contrast, IL-6 is more closely involved in the maintenance of inflammatory responses and immune regulation, promoting Th2 cell expansion and serving as a functional link between innate and adaptive immunity [44]. The clinical observations reported that mast cell activation markedly elevates IL-6 and TNF-α levels in asthmatic airways [45]. The increase in these inflammatory cytokines detected in our models reflects a highly active inflammatory state associated with asthma.

The activity of 5-lipoxygenase (5-LO), a key enzyme in leukotriene biosynthesis, is regulated not only by its expression level but also by intracellular signaling pathways, among which the ERK pathway represents a critical upstream regulator [46]. In our experimental models, increased 5-LO expression was consistently observed alongside enhanced ferroptosis and inflammatory responses. Previous studies have demonstrated that ferroptosis-associated iron overload facilitates translocation of 5-LO to the nuclear membrane [47], while lipid peroxides generated during ferroptosis activate ERK signaling and induce phosphorylation of 5-LO at Ser663, thereby augmenting its catalytic activity [48]. In addition, lipid peroxidation can oxidize the intrinsic Fe²⁺ within 5-LO to a more catalytically active Fe³⁺ state, further enhancing leukotriene synthesis [49]. Enhanced 5-LO activity promotes leukotriene B₄ (LTB₄) production, which drives neutrophil and eosinophil infiltration [50–52]. Together, these alterations indicate a profound disruption of redox and iron homeostasis within the airway epithelium, establishing a vicious cycle between ferroptosis and airway inflammation, and providing a mechanistic basis for our observation that ferroptosis is accompanied by increased 5-LO expression and inflammatory production.

GPX4 is a central endogenous inhibitor of ferroptosis that utilizes glutathione synthesized via the XC⁻ system to detoxify lipid hydroperoxides and preserve membrane integrity. GPX4 not only scavenges mitochondrial ROS [41], but also limits 5-LO activity by suppressing ERK phosphorylation [53], inhibiting redox cycling of the intrinsic iron within 5-LO, and indirectly reducing the accumulation of exogenous iron by alleviating ferroptosis. Our data showed that the activation of GPX4 markedly attenuated ferroptosis-associated alterations in both cellular and animal models. Specifically, GPX4 activation alleviated LPS-induced mitochondrial injury in airway epithelial cells, as evidenced by reduced cristae disruption, mitochondrial vacuolization, and membrane rupture. Concurrently, GPX4 treatment downregulated 5-LO expression, reduced inflammatory cytokine production, and restored the expression of key ferroptosis-related proteins, including FTH1 and SLC7A11.Furthermore, GPX4 has been reported to suppress NF-κB activation and thereby attenuate inflammatory responses [54]. Consistent with this mechanism, GPX4 activation in our murine asthma model significantly reduced TNF-α and IL-6 levels, accompanied by an overall improvement in disease manifestations. Based on behavioral assessments, mice treated with the GPX4 activator exhibited markedly fewer asthma-related behaviors, such as head scratching, sneezing, and nodding respirations—following OVA challenge compared with untreated asthmatic mice. Collectively, these findings support a protective role of GPX4 in asthma by simultaneously restraining ferroptosis and dampening airway inflammation, highlighting ferroptosis inhibition as a potential therapeutic strategy for asthma.

This study has several limitations. First, we were unable to quantify GPX4-mediated regulation of 5-LO activity due to the absence of HPLC measurements of 5-HETE and 5-HPETE. Second, although our data support the involvement of the ERK/5-LO axis, direct evidence for the upstream activation mechanism remains insufficient and warrants further investigation. Third, the murine model used was an allergic asthma model, whether GPX4 exerts similar protective effects in non-allergic asthma requires validation in future studies.

Conclusion

Our findings support the notion that ferroptotic injury in bronchial epithelial cells contributes to the enhanced release of inflammatory mediators. Moreover, GPX4 ameliorates both OVA-induced airway inflammation and LPS-induced epithelial injury, at least in part by limiting ferroptotic stress and attenuating activation of the ERK/5-LO axis. These results provide mechanistic insight into how GPX4 regulates airway epithelial homeostasis and suggest its potential as a therapeutic target in asthma.

Supplementary Information

Supplementary Material 1.

Supplementary Material 2.