Deficient mitochondrial tRNA modifications arising from TRMU mutation led to the liver-specific failure

TL;DR

This study shows how mutations in TRMU cause liver failure by disrupting mitochondrial tRNA modifications, leading to specific metabolic issues in zebrafish livers.

Contribution

The study reveals the tissue-specific mechanism of liver failure caused by TRMU mutations through mitochondrial tRNA modification deficiencies.

Findings

TRMU deficiency leads to reduced τm5s2U modifications in mitochondrial tRNAs, causing liver-specific metabolic failures.

Liver tissues show more severe tRNA instability and aminoacylation defects compared to other tissues in trmu KO zebrafish.

Liver-specific electron flow preferences through complex I contribute to hepatic steatosis and enlargement in trmuKO zebrafish.

Abstract

Posttranscriptional nucleotide modifications of tRNAs play the critical roles in their structure and function. Deficient τm5s2U modifications of mitochondrial tRNAGlu, tRNAGln and tRNALys arising from TRMU mutations primarily manifest the liver failure. However, mechanisms of tissue specificity in TRMU-induced deficiencies remain largely elusive. In this report, we demonstrated that the loss of τm5s2U in mitochondrial tRNAs due to TRMU-deficiency caused the tissue-specific manifestation that contributed to pathogenesis of liver failures in the zebrafish. A wide range level of τm5s2U in tRNALys, tRNAGlu, and tRNAGln occurred across the zebrafish brain, muscle, eye, liver and ovum tissues. Striking differences in tissue-specific effects of conformation, stability and aminoacylation of tRNAGlu, tRNALys and tRNAGln were observed among five tissues of trmu KO zebrafish. Notably, livers are vulnerable to the loss of τm5s2U of tRNAs, evidenced by more severe failures in these tRNA metabolisms including conformation, instability and aminoacylation in liver than those in other four tissues of trmuKO zebrafish. These aberrant tRNA metabolisms altered the assembly, stability, and activities of complexes I, III and IV, especially pronounced in the liver of trmuKO zebrafish. Notably, livers displayed the highest ratios in the levels and activities of complex I to complex II in across five tissues, indicating the liver-specific electron flow preferences through complex I to coenzyme Q to complex III. These tissue-specific complex I deficiencies manifested the liver failures including hepatic steatosis and enlargement. Our findings provide new insights into the mechanism of liver-specific defects arising from the aberrant nucleotide modification of mitochondrial tRNAs.

Figures

Full text

Posttranscriptional modifications of tRNA affect all aspects of tRNA structure and function, including the proper processing, stability, folding and decoding properties of tRNAs, fidelity and efficiency of translation (1, 2, 3). In human, 18 types of nucleotide modifications are present in the 137 positions of 22 mitochondrial tRNA molecules, encoded by mitochondrial DNA (mtDNA) (4, 5, 6). Of these, the nucleotides at position 34 (wobble position of anticodon) of tRNAs are more prone to be modified than those at other positions of tRNAs (5, 6, 7, 8). These nucleotide modifications, synthesized by tRNA modifying enzymes including TRMU, GTPBP3, MTO1 and NSUN3, play critical roles in the biogenesis of oxidative phosphorylation (OXPHOS) complexes (9, 10, 11, 12, 13, 14, 15, 16). The assembly of OXPHOS complexes necessitates the synchronization of expressing 13 mtDNA encoded subunits, 72 nucleus-encoded subunits of complexes I, II, III, IV and V, and their assemble factors, which are synthesized in cytosol and imported into mitochondria (17, 18). Complex I (NADH:ubiquinone oxidoreductase) consisting of 7 mtDNA encoding and 39 nucleus-encoding polypeptides is instrumental in the transfer the electrons from NADH through coenzyme Q to complex III (ubiquinol-cytochrome c oxidoreductase), while complex II (succinate dehydrogenase) comprising 4 nucleus-encoding subunits, provides an alternative entry point for electrons from FADH2, bypassing complex I and directly transferring to ubiquinone then to complex III. This dual entry system ensures a continuous flow of electrons, maintaining the efficiency of electron transport chain (ETC) (17, 18). The tissue-specific variations in ETC composition and regulation in the different tissues or organs in animals reflect the specific OXPHOS capacity during development, physiological adaptation, and pathology (19, 20, 21). The understanding mechanism underlying tissue-specific composition and regulations of ETC has implications for the treating tissue-specific mitochondrial diseases and developing targeted therapies.

The deficient modifications at U34 of mitochondrial tRNAs have been linked to an array of human diseases (22, 23, 24, 25, 26). Mutations in TRMU responsible for the synthesis of 5-taurinomethyl-2-thiouridine (τm^5^s^2^U) in mitochondrial tRNA^Glu^, tRNA^Gln^, tRNA^Lys^ cause the acute infantile liver failure as a primary clinical presentation, or other less common presentations such as deafness and Leigh syndrome (24, 25, 26, 27, 28, 29, 30). We hypothesized that TRMU deficiency led to the liver-specific effects on ETC composition and regulations for the development of liver failure. In this study, we investigated the mechanism underlying the tissue-specific manifestation of TRMU deficiency using the brain, muscle, eye and liver from WT and trmu^ko^ (MT) zebrafish. We examined if the TRMU deficiency-induced liver-specific manifestation resulted from the tissue-specific effects of aberrant tRNA metabolisms, including the 2-thiouridine modification at position U34, conformations, steady-state levels and aminoacylation in the five tissues of WT and MT zebrafish. These aberrant tRNA metabolism impaired the synthesis of 13 mtDNA-encoding subunits of OXPHOS complexes, thereby impacting the biogenesis of OXPHOS complexes. The tissue-specific effects of TRMU deficiency on the stability and activities of OXPHOS complexes across the tissues of WT and MT zebrafish were assessed by blue native polyacrylamide gel electrophoresis (BN-PAGE), in-gel activity and SDH/COX staining assays. Notably, the livers of MT zebrafish revealed more severe defects of complexes I, III and IV than those in other four tissues. Strikingly, undetectable SDH staining reflecting the activity of complex II in both WT and MT zebrafish suggested the liver-specific ETC composition in zebrafish, especially distinct contribution of complexes I to electron flow.

Results

Liver-specific manifestation caused by the loss of trmu in zebrafish

To investigate the tissue-specific manifestations of trmu deficiencies, we performed histopathological analysis using H&E-stained sections of brain, muscle, eye and liver from both WT and MT zebrafish at the age of 10 months. As shown in Figures 1A and S1, there were no histologic changes on the sections of brain, muscle and eye, and no significant differences in the body length, brain weight and diameter of eyeballs between trmu^−/−^ and WT zebrafish, indicating that trmu deficiency did not cause the defects in the brain, muscle and eye. Strikingly, trmu^−/−^ zebrafish exhibited the liver dysfunction, evidenced by parenchymal collapse with steatosis on the sections of livers with (H&E)-stained analysis (Fig. 1B) and increased hepatocellular lipids using Oil Red O staining assay (Fig. 1C), as compared to WT zebrafish. The lipid accumulation translated into an increase of hepatocyte size in the trmu^−/−^ zebrafish (Fig. 1, B–D). We then evaluated trmu mutation-induced liver defects by whole-mount in situ hybridization using digoxigenin (DIG)-labeled antisense probes in the WT and MT larval. As shown in Figure 1E, MT larvae at 4 days post fertilization (dpf) and 5 dpf stages revealed marked liver enlargement, as compared to those in the WT larvae. We further analyzed the liver sizes in MT and WT larvae carrying the fabp10a-RFP transgene using whole-mount fluorescence. Marked increases in the liver size in the MT larvae were verified, as compared to those in the WT larvae (Fig. 1F). In particular, the liver sizes in 4 dpf and 5 dpf trmu^−/−^ larvae were 186.3% and 122.7%, relative to the mean values measured in WT larvae, respectively (Fig. 1, G and H). These liver defects in trmu^−/−^ zebrafish recapitulated the liver failure phenotype in the patients carrying the TRMU mutations (24, 25, 26, 27).Figure 1**Liver defects in MT zebrafish.**A and B, H&E histological sections of brain, muscle, eye (A) and liver (B) from MT and WT zebrafish at the age of 10 months. The scale bar represents 500 μm, 500 μm, 50 μm, 40 μm in brain, muscle, eye and liver, respectively. C, oil-Red staining of the liver sections of MT and WT zebrafish. The scale bar represents 40 μm. D, the relative areas of hepatocyte in MT (n = 15) and WT zebrafish (n = 15). E, whole-mount in situ hybridization against fabp10a on MT and WT larval zebrafish at various ages (2 dpf to 5 dpf). fabp10a marker was used to indicate the place of liver. F, Tg (fabp10a:DsRed,ela3l:EGFP) larvae at 4 dpf and 5 dpf shows the liver-restricted RFP expression. G, relative sizes of livers in MT (n = 41) and WT (n = 39) zebrafish at 4 dpf. H, relative sizes of livers in MT (n = 48) and WT (n = 46) zebrafish at 5 dpf. P indicates the significance, according to t test, of the difference between mutant and WT, denoted by asterisks (∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001), and nonsignificant differences by n.s. The error bars indicate standard errors (SE) of the means.

Tissues-specific thiolations in the mitochondrial tRNAs

To examine the tissue-specific nucleotide modifications in mitochondrial tRNAs, we analyzed the 2-thiouridylation levels of tRNAs across five tissues by extracting total RNAs from brain, muscle, eye, liver and ovum of MT and WT zebrafish, purifying tRNAs, qualifying the 2-thiouridine modification by the retardation of electrophoresis mobility in polyacrylamide gel containing 0.05 mg/ml ((N-acryloylamino)phenyl) mercuric chloride (APM), and hybridizing DIG-labeled probes for tRNA^Gln^, tRNA^Glu^, tRNA^Lys^, tRNA^Leu(UUR)^ and tRNA^Trp^, respectively (12, 31, 32). As shown in the Figure 2, A and B, τm^5^s^2^U levels of tRNA^Gln^ in the brain, muscle, eye, liver and ovum in WT zebrafish were 50.7%, 33.8%, 34.6%, 55.6% and 25.8%, with the average of 40%; τm^5^s^2^U levels of tRNA^Glu^ in these tissues were 93.7%, 81.9%, 88.4%, 63.3% and 49.2%, with the average of 75.3%; τm^5^s^2^U levels of tRNA^Lys^ in those tissues were 61.3%, 63.9%, 53.6%, 79.0% and 80.2%, with the average of 67.6%, respectively. Furthermore, the average modification levels of three tRNAs across all five tissues ranged from 51.8% (ovum) to 68.4% (brain), with the average of 61%. As shown in Figure 2, the MT zebrafish displayed the complete loss of 2-thiouridylation in the tRNA^Gln^, tRNA^Glu^, and tRNA^Lys^ across all five tissues. These data highlighted the tissue-specific variations in 2-thiouridylation levels among these tissues.Figure 2**Analysis of 2-thiouridine modification and conformation of mitochondrial tRNAs.**A, ((N-acryloylamino)phenyl) mercuric chloride gel electrophoresis. Various amount of total RNAs from brain, muscle, eye, liver and ovum of MT and WT zebrafish were separated by polyacrylamide gel electrophoresis that contains 0.05 mg/ml ((N-acryloylamino)phenyl) mercuric chloride, electroblotted onto a positively charged membrane, and hybridized with the DIG-labeled oligonucleotide probes specific for tRNA^Gln^, tRNA^Glu^, tRNA^Lys^ and tRNA^Trp^, respectively. The retarded bands of 2-thiolated tRNAs and nonretarded bands of tRNA without thiolation are marked by arrows. B, quantification of 2- thiolated tRNA levels of three tRNAs in five tissues of WT zebrafish. Three independent experiments were made for each tissue of zebrafish. The error bars indicate one standard error of the means. C, northern blot analysis of tRNAs under native condition. Various amount of total RNAs from brain, muscle, eye, liver and ovum of MT and WT zebrafish were electrophoresed through a native polyacrylamide gel, electroblotted and hybridized with the DIG-labeled oligonucleotide probes as tRNA^Gln^, tRNA^Glu^, tRNA^Lys^, tRNA^Leu(UUR)^, tRNA^Trp^ and tRNA^Ala^, respectively.

Tissue-specific effects of tRNA conformations

The nucleotide modifications are critical for forming functional structure of tRNAs (33). We then assessed whether the deficient 2-thiouridine modification led to tissue-specific consequences on tRNA conformation. Total cellular RNAs from five tissues of MT and WT zebrafishes were electrophoresed through 10% polyacrylamide gel (native condition) in Tris-glycine buffer and then electroblotted onto a positively charged nylon membrane for hybridization analysis with DIG-labeled oligodeoxynucleotide probes for tRNA^Gln^, tRNA^Glu^, tRNA^Lys^, tRNA^Leu(UUR)^, tRNA^Trp^ and tRNA^Ala^, respectively. As shown in Figure 2C, electrophoretic patterns of MT zebrafish revealed two bands in tRNA^Lys^ and tRNA^Glu^, but only one band in the tRNA^Gln^, while those of WT zebrafish exhibited only one band in tRNA^Gln^ and tRNA^Glu^ but two bands in tRNA^Lys^, respectively. As shown in Figure 2C, the brain, liver and ovum of MT zebrafish exhibited slightly faster migration of tRNA^Gln^ than those in WT zebrafish, while there was no significant difference of tRNA^Gln^ from muscle and eye, between MT and WT zebrafish. Notably, the liver and ovum of trmu^−/−^ zebrafish revealed faster migration electrophoretic mobilities of tRNA^Glu^ but much lower migration of tRNA^Lys^, as compared with those in their WT counterparts. Conversely, there were no difference of electrophoretic mobility tRNA^Ala^, tRNA^Leu(UUR)^ and tRNA^Trp^ lacking 2-thiouridine modification among five tissues between trmu^−/−^ and WT zebrafish. These results demonstrated that the ablation of trmu induced distinct, tissue-specific alterations in the conformational states of the affected tRNAs.

Tissue-specific changes in the levels of mitochondrial tRNAs

To assess if the trmu mutation ablated the stability of tRNA, we subjected total RNAs from brain, muscle, eye, liver and ovum of MT and WT zebrafish to Northern blots and hybridized them with DIG-labeled oligodeoxynucleotide probes for tRNA^Gln^, tRNA^Glu^, tRNA^Lys^, tRNA^Leu(UUR)^, tRNA^Trp^ and 5S rRNA as a reference control (12, 13, 14). As shown in the Figure 3A, the brain, eye and ovum of trmu^−/−^ exhibited various decreases in the steady state levels of all five tRNAs, as compared with WT zebrafish. By contrast, the liver of trmu^−/−^ zebrafish displayed significant increases in the steady state of all five tRNAs, ranged from 178.4% (tRNA^Leu(UUR)^) to 268.0% (tRNA^Gln^) of WT zebrafish. Furthermore, elevated levels of tRNA^Gln^ and tRNA^Leu(UUR)^ but no change in levels of other tRNAs were observed in the muscle of trmu^−/−^ zebrafish as compared with those in WT zebrafish (Fig. S2A). These data indicated that trmu deletion resulted in tissue-specific effects in the stability of mitochondrial tRNAs.Figure 3**Analysis of mitochondrial tRNAs.**A, northern blot analysis of mitochondrial tRNAs under denatured condition. Five micrograms of total RNAs from brain, muscle, eye, liver and ovum of MT and WT zebrafish were electrophoresed through a denaturing polyacrylamide gel, electroblotted and hybridized with the DIG-labeled oligonucleotide probes specific for tRNA^Gln^, tRNA^Glu^, tRNA^Lys^, tRNA^Leu(UUR)^ and tRNA^Trp^, and 5S rRNA as a loading control, respectively. B, In vivo aminoacylation assays. Five micrograms of total RNAs from five tissues of MT^-^ and WT zebrafish under acid conditions were electrophoresed at 4 °C through an acid (pH 5.2) 10% polyacrylamide with 8 M urea gel, electroblotted, and hybridized with the DIG-labeled oligonucleotide probes specific for the tRNA^Lys^, tRNA^Leu(UUR)^, and tRNA^Trp^, respectively. The samples from brains of MT- and WT zebrafish were deacylated (DA) by heating for 30 min at 65 °C at pH 8.3 and electrophoresed as above.

Increased aminoacylation levels of mitochondrial tRNAs

We examined the aminoacylation properties of tRNA^Lys^, tRNA^Leu(UUR)^ and tRNA^Trp^ in the brain, muscle, eye, liver and ovum of MT and WT zebrafish, by the use of electrophoresis in an acidic urea PAGE system to separate uncharged tRNA species from the corresponding charged tRNA, electroblotting and hybridizing with the specific tRNA probes as above. As shown in the Figure 3B, various aminoacylation levels of each tRNA were observed among these five tissues of WT and MT zebrafish. The average levels of tRNA^Lys^, tRNA^Leu(UUR)^ and tRNA^Trp^ aminoacylation in the brain, muscle, eye, liver and ovum of WT zebrafish were 61.47%, 66.67%, 76.93%, 70.37% and 59.47%, respectively. Notably, trmu^−/−^ zebrafish revealed significant increases of aminoacylated tRNA^Lys^ in the brain and ovum, and tRNA^Trp^ in the ovum, as compared with those of WT zebrafish (Fig. S2B). The elevated levels of aminoacylated tRNAs in mutant zebrafish may be due to some levels of stabilization by compensatory effects, elevation of misacylated tRNAs or mitochondrial ribosome pausing at their cognate codon and make the accumulation of aminoacylated tRNAs (13). However, ablation of Trmu did not yield significant effect of aminoacylation in those tRNA in other three tissues.

Transcriptome analysis of five tissues in trmu−/− and WT zebrafish

To further evaluate the tissue-specific effects of trmu deficiency on the gene expression, we performed mRNA sequencing analyses on brain, muscle, eye, liver, ovum of trmu^−/−^ and WT zebrafish at the age of 10 months. As shown in Figure 4A, the transcriptome profiling revealed marked variations in alterations of gene expression across these tissues of trmu^−/−^ zebrafish, including brain (407 up-regulated and 1648 down-regulated genes), muscle (478 up-regulated and 1677 down-regulated), eye (704 up-regulated and 625 down-regulated), liver (2014 up-regulated and 799 down-regulated), and ovum (363 up-regulated and 1498 down-regulated), as compared with those in WT zebrafish. We then performed gene set enrichment analysis, focusing on interrogated pathways related to mitochondrial function across these five tissues. The gene sets involved in mitochondrial RNA metabolism, especially those required for RNA turnover such as SUV3 (34), and 16 genes encoding the components of translation machinery (35), were more drastically downregulated in the liver than those in other tissues of MT zebrafish, as compared with those in WT zebrafish (Fig. 4, B and C). These data highlighted that the livers are exquisitely vulnerable to trmu-deficiency-induced/failures in mitochondrial RNA metabolisms.Figure 4**Transcriptome analysis of five tissues from MT and WT zebrafish.**A, volcano plots of total RNA sequencing revealed the up-regulated genes (red dots) and down-regulated genes (blue dots) among brain, muscle, eye, liver and ovum of MT and WT zebrafish (n = 3) at the age of 10 months B, gene set enrichment analysis analysis was performed on the RNA-seq data from five tissues of MT and WT zebrafish. NES: normalized enrichment score; FDR: false discovery rate. C, hierarchical clustering of the 16 genes involved in mitochondrial translation is presented as a heat map. Higher and lower expressed genes were marked in red and blue, respectively.

Liver tissue-specific defects of OXPHOS complexes

These aberrant tRNA metabolism impaired the synthesis of 13 mtDNA-encoding polypeptides that are the core subunits of OXPHOS complexes. We investigated the impact of trmu mutation on the stability and activities of the oxidative phosphorylation machinery across tissues. Mitochondrial membrane proteins extracted from both MT and WT zebrafish were separated by BN-PAGE, followed by electroblotting and hybridization with antibodies against Ndufs3 (complex I), Sdhb (complex Ⅱ), Uqcrc2 (complex Ⅲ), Cox5a (complex Ⅳ) and Atp5a1 (complex Ⅴ) (13, 14). As shown in Figure 5, A and B, four tissues but not muscle of trmu^−/−^ zebrafish exhibited the aberrant assembly of OXPHOS complexes with the various degrees, respectively. However, there were no significant changes in the levels of complexes II and V across all five tissues between WT and trmu^−/−^ zebrafish. Strikingly, the levels of complex I in the brain, eye, liver and ovum of trmu^−/−^ zebrafish were 75.7%, 52.8%, 31.6%, and 36.4%, with the average of 49.1%, as compared with those in WT zebrafish. Furthermore, the levels of complex III in the brain, eye, liver and ovum of trmu^−/−^ zebrafish were 73.6%, 94.7%, 41.6%, and 78.0%, with the average of 72%, as compared with those in WT zebrafish, respectively, while those of complex Ⅳ in the brain, eye, liver and ovum of trmu^−/−^ zebrafish were 65.8%, 102.7%, 46.5%, and 72.6%, with the average of 71.9%, as compared with those in WT zebrafish, respectively.Figure 5**Analysis of OXPHOS complexes.**A, the steady-state levels of five OXPHOS complexes by B-N gel electrophoresis. 15 micrograms of mitochondrial proteins from brain, muscle, eye, liver and ovum of MT and WT zebrafish were electrophoresed through a Blue-Native gel, electroblotted and hybridized with antibodies for Ndufs3, Sdhb, Uqcrc2, Cox5a and Atp5a1 (subunits of complex I, II, III, IV and V), respectively and corresponding Coomassie Brilliant Blue stained gel were used as a loading control. B, quantification in the levels of complexes I, II, III, IV and V in five tissues of MT and WT zebrafish. The calculations were based on three independent experiments. Graph details and symbols are explained in the legend to Figure 1.

We assessed the enzymatic activities of complexes I and IV using in-gel activity assays. Mitochondrial membrane proteins isolated from various tissues from both MT and WT zebrafish were separated by BN-PAGE and subsequently stained with specific substrates for the OXPHOS complexes [NADH and nitro blue tetrazolium for complex I, and 3.3′-diamidobenzidine tetrahydrochloride (DAB) and cytochrome c for complex IV] (36). As shown in Figures 6A and S3, the in-gel activities of complex I in the brain, muscle, eye, liver and ovum of MT zebrafish were 66.6%, 91.5%, 69.3%, 43.0% and 33.6%, with the average of 60.80%, while the activities of complex Ⅳ in these tissues of MT zebrafish were 76.8%, 109.8%, 98.4%, 55.6% and 73.8%, with the average of 82.88%, as compared to those in the WT zebrafish.Figure 6**The activities of OXPHOS complexes.**A, in-gel activity of complexes I and IV of five tissues from MT and WT zebrafish. The activities of complex I and IV of five tissues from MT and WT zebrafish were electrophoresed through a Blue-Native gel and measured in the presence of specific substrates of NADH and nitro blue tetrazolium for complex I, 3.3′-diamidobenzidine tetrahydrochloride and cytochrome c for complex IV, respectively. B and C, enzyme histochemistry staining for COX) and SDH in the frozen-sections of tissues from MT and WT zebrafish at the age of 10 months D, the SDH staining in the sections of the abdominal cavity containing the liver, intestine and ovum of MTand WT zebrafish. The scale bar represents 50 μm, 100 μm, 50 μm, 100 μm and 1 mm in brain, muscle, eye, liver, and abdominal cavity respectively.

We further performed the enzyme histochemistry staining for SDH (reflecting the activity of complex II) and COX (reflecting the activity of complex IV) in the frozen-sections of brain, muscle, eye and liver in the trmu^−/−^ and WT zebrafish, respectively. As shown in Figure 6B, the trmu^−/−^ zebrafish exhibited markedly reduced activities of COX in the sections of livers, mildly decreased of those in the brain but no changes of those in the muscle and eye, as compared with those in WT zebrafish. Furthermore, the SDH staining in the sections of brain, muscle and eye in the MT zebrafish were comparable with those in WT zebrafish (Fig. 6C). However, the SDH staining was not detectable in the liver sections of both MT and WT zebrafish (Fig. 6C). The absence of SDH activity in the liver was further verified by the SDH staining in the sections of the abdominal cavity containing the liver, intestine and ovum of MT and WT zebrafish (Fig. 6D). These results demonstrated that the livers of MT zebrafish revealed more severe defects in the complexes I, III and IV than those in other four tissues. The absence of SDH staining in the liver indicated the liver specific process of ETC.

Tissues specific ETC composition in zebrafish

The ETC process involved four protein complexes that transfer electrons through a membrane within mitochondria to form a gradient of protons that drives the creation of ATP (17, 18). During ETC process, complex I deliver electrons from NADH to ubiquinone (CoQ), while complex II, as the parallel to complex I in the transport chain, transfer electrons from FADH_2_ to Coenzyme Q (Fig. 7A). To test if there are the tissue-specific electron flow preferences through complexes I or II, we examined the levels and activities of complexes I and II across tissues in the WT zebrafish as described above. As shown in Figure 7, B and C, the ratios in the levels of complex I to complex II in the brain, muscle, eye, ovum and liver were 55.4%, 62.9%, 126.7%, 36.2% and 248.1%, respectively. We then measured the enzymatic activities of complex I to complex II with isolating mitochondria from these tissues of WT zebrafish by the oxidation–reduction method using 2,6-Dichloroindophenol as artificial electron acceptor (37). The activity of complexes I was determined through the oxidation of NADH by incubating 10 μg of mitochondrial proteins from various tissues in the 200 μl buffer containing β-Nicotinamide adenine dinucleotide disodium salt. The activity of complex II exclusively encoded by the nuclear DNA was measured through the oxidation of succinate by incubating 10 μg of mitochondrial proteins from various tissues in the 200 μl buffer containing succinate. As shown in Figure 7D, and the activities of complexes I and II varied widely across tissues in the WT zebrafish. As shown in 7E, the ratios of enzymatic activity of complex I to complex II in the brain, muscle, ovum and liver were 273.8%, 264.1%, 271.8% and 427.9%, respectively. These highlight the tissue-specific differences in electron flow through complexes I and II in WT zebrafish. In particular, the ETC process in the liver more prefer complex I rather than complex II, as compared with those in other tissues.Figure 7**Tissues specific electron flow in WT zebrafish.**A, the electron transport chain in mitochondria. Red dotted line represents the electron flow. B, the levels of complex I and II of brain, muscle, eye, liver and ovum. 15 micrograms of mitochondrial proteins from five tissues of zebrafish were electrophoresed through a Blue-Native gel, electroblotted and hybridized with antibodies for Ndufs3 (subunit of complex I) and Sdha (subunit of complex II), respectively. Three deposits for each tissue were derived from three independent groups of fishes at same ages. C, ratios of the levels of complex I to complex II across five tissues. D, enzymatic activities of complexes I and II. The activities of respiratory complexes were investigated by enzymatic assays on complex I and complex II in mitochondria isolated from brain, muscle, eye, liver and ovum of WT zebrafish. E, ratios of enzymatic activity of complex I to complex II in brain, muscle, ovum and liver. Three independent experiments were made for each tissue of zebrafish. Graph details and symbols are explained in the legend to Figure 5.

Discussion

We hypothesized that mitochondrial tRNA posttranscriptional nucleotide modifications contribute to the tissue-specific variations in ETC composition and regulation in the different tissues or organs during physiological adaptation and pathology. In this study, we demonstrated that the loss of τm^5^s^2^U of tRNA^Lys^, tRNA^Glu^ and tRNA^Gln^ arising from TRMU deficiency caused the tissue-specific ETC composition and regulation that contributed to pathogenesis of liver failures in the zebrafish. We showed the striking differences in the τm^5^s^2^U levels of tRNA^Lys^, tRNA^Glu^, and tRNA^Gln^ in the brain, muscle, eye, liver and ovum tissues of zebrafish. Especially, the τm^5^s^2^U levels of average 3 tRNAs in the liver are significantly higher than the averages of those among five tissues, indicating that these tRNA nucleotide modifications play critical roles in the tissue-specific posttranscriptional regulations. The inactivation of Trum led to the structural and functional consequences of tRNA^Glu^, tRNA^Lys^ and tRNA^Gln^, including the structure folding, stability and aminoacylation in across five tissues of zebrafish. Here, electrophoretic patterns of tRNA^Glu^ revealed two bands I the MT zebrafish but only one band in the MT zebrafish, while two bands of tRNA^Lys^ in the MT zebrafish migrated much slower than those in in the MT zebrafish. This is likely that the inactivation of Trum led these tRNAs to be less hypomodified but not to be mutated. The hypomodification is therefore probably responsible for allowing an alternative folding (resulting in two bands) for tRNA^Glu^ and tRNA^Lys^, but not for tRNA^Gln^ (38). In particular, the livers of trmu^−/−^ zebrafish exhibited more severe failures in these tRNA metabolisms including electrophoretic mobility changes and increased steady state levels of tRNA^Gln^, tRNA^Glu^ and tRNA^Lys^ than those in other four tissues. The tissue-specific effects of trmu deficiency on mitochondrial tRNA metabolism were further supported by marked difference of altered gene expression on the brain, muscle, eye, liver, ovum of trmu^−/−^ and WT zebrafish using mRNA sequencing analyses. In particular, the genes required for mitochondrial RNA turnover such as SUV3 (34) were more drastically downregulated in the liver than those in other tissues of MT zebrafish. These highlight that the livers are vulnerable to aberrant mitochondrial tRNA metabolism related to the loss of trmu function.

The impaired synthesis of 13 mtDNA-encoding polypeptides arising from aberrant tRNA metabolism resulted in the imbalances between the increased levels of de novo protein synthesis and decreased folding capacity for the mtDNA- and nucleus-encoded OXPHOS components (13, 39, 40). The specific oxidative phosphorylation capacities of cells or tissues depend on their metabolic and energetic demands (21, 41). Here, trmu deficiency led to aberrant assembly and instability of complexes I, III and IV with various degrees but no significant change in the complexes II and V across five tissues of zebrafish. Tissue specific effects of Trmu deficiencies on OXPHOS complexes were further evidenced by reducing activities of complex I and IV in the brain, liver and ovum with various degrees, only complex I in the eye but not muscle of trmu^−/−^ zebrafish. Strikingly, the liver of trmu^−/−^ zebrafish displayed profound defects in the stability and activities of complexes I, III and IV, verified by markedly reduced COX staining reflecting complex IV activity. However, the SDH staining was not changed in the brain, eye and muscle, but not detectable in the liver between MT and WT zebrafish, implying extremely low activity of complex II in liver. Mitochondria in the liver are more specialized for the various reactions of anabolic and catabolic metabolism and differ in specific composition and regulation of OXPHOS from those in other tissues (41, 42, 43, 44). The highest ratios in the levels and activities of complex I to complex II in liver among five tissues indicated the liver-specific electron flow preferences through complex I to coenzyme Q to complex III. It is very likely the complex II does not play the important role in the electron transfer in ETC of liver mitochondria. Therefore, livers appear to be vulnerable to tissue-specific defects in ETC composition and regulation arising from the loss of trmu function. These impaired OXPHOS arising from the trmu^−/−^ mutation caused the liver-specific failure. The loss of TRMU led to the liver dysfunction, evidenced by parenchymal collapse with steatosis and increased hepatocellular lipids. The resultant lipid accumulations consequently caused marked increases of hepatocyte sizes and liver enlargement in the trmu^−/−^ zebrafish. These liver defects in trmu^−/−^ zebrafish recapitulated the liver failure phenotype in the patients carrying the TRMU mutations (24, 25, 26, 27). These data demonstrated that TRMU deficiency-induced deficient synthesis of τm^5^s^2^U of tRNA^Lys^, tRNA^Glu^ and tRNA^Gln^ caused the tissue-specific ETC composition and regulation that contributed to pathogenesis of liver failures in the zebrafish. Thus, our findings provide new insights into the mechanism of liver-specific defects arising from the aberrant nucleotide modification of mitochondrial tRNAs.

Experimental procedures

Experimental fish and maintenance

AB WT and derived trmu^KO^ strains (12), and liver-specific transgenic Tg (fabp10a:DsRed, ela3l:EGFP) zebrafish (Danio rerio) were used for this investigation. This animal protocols used in this investigation were approved by the Zhejiang University Institutional Animal Care and Use Committee. All fish were kept in recirculating water at 28 °C and fed with commercial pellets at a daily ration of 0.7% of their body weight according to standard protocols (45). Embryos were reared at 28.5 °C according to standard protocols. Embryos were staged by dpf (46).

Mitochondrial tRNA analysis

Total RNAs were isolated from various tissues of WT and MT zebrafish using Totally RNA Kit (Ambion, Inc) as detailed elsewhere (12, 13, 14). For tRNA thiolation assay, the presence of thiouridine modification in the tRNAs was examined by the retardation of electrophoretic mobility a polyacrylamide gel that contains 0.05 mg/ml APM (11, 32, 47). Various amount of total RNAs were separated by polyacrylamide gel electrophoresis, blotted onto positively charged nylon membrane (Millipore) and hybridized with the specific DIG-oligodeoxynucleotide probes at the 3′ termini, as detailed elsewhere (12). Oligonucleotide probes for tRNA^Lys^, tRNA^Glu^, tRNA^Gln^ and tRNA^Trp^ were detailed previously (Table S1) (12). APM gel electrophoresis and quantification of 2-thiouridine modification in tRNAs were conducted as detailed (12).

For tRNA Northern blot analysis, 5 μg of total RNAs were electrophoresed through a 10% polyacrylamide gel without (native gel) or with (denature gel) 8 M urea in a Tris-borate-EDTA buffer (after heating the sample at 65 °C for 10 min), and then electroblotted onto a positively charged nylon membrane for hybridization analysis with DIG-labeled oligodeoxynucleotide probes specific for tRNA^Lys^, tRNA^Glu^, tRNA^Gln^, tRNA^Trp^, tRNA^Leu(UUR)^, tRNA^Ala^ and 5S rRNA (Table S1). The hybridization and quantification of density in each band were performed as detailed previously (12, 48).

For tRNA aminoacylation analysis, total RNAs were isolated under acid conditions, and 5 μg of total RNAs were electrophoresed at 4 °C through an acid (pH 5.2) 10% polyacrylamide/8 M urea gel to separate the charged and uncharged tRNA as detailed elsewhere (48, 49). To further distinguish nonaminoacylated tRNA from aminoacylated tRNA, total RNAs were treated with being heated for 30 min at 65 °C (pH 8.3) and then run in parallel. The gels were then electroblotted as described above. Oligonucleotide probes for tRNA^Lys^, tRNA^Leu(UUR)^, and tRNA^Trp^ were detailed previously (Table S1) (12, 13, 14). Quantification of density in each band was performed as detailed previously (48).

RNA sequencing analysis

Total RNA was extracted from various tissues of MT and WT zebrafish at the age of 10 months by using TRIzol Reagent (Takara) as described above. RNA-seq libraries construction and sequencing were performed by the LC Sciences. Briefly, 1 μg RNA per sample was used as input materials to prepare the libraries following the standard procedures of NEBNext UltraTM RNA Library Prep Kit for Illumina (NEB). Clustering of the index-coded samples was performed on a cBot Cluster Generation System using TruSeq PE Cluster Kit v3-cBot-HS (Illumina) according to the manufacturer's instructions. After cluster generation, the library preparations were sequenced on an Illumina platform and 150 bp paired-end reads were generated. The filtered reads were aligned to the zebrafish reference genome (Ensembl release 97) by using TopHat (version 2.1.0; https://ccb.jhu.edu/software/tophat/downloads). After the alignment analysis, the BAM files of each individual alignment were used to analyze genes differential expression by using Cufflinks (version 2.2.1; https://cole-trapnell-lab.github.io/cufflinks). Genes with a p-value <0.05 and |log2 (fold change)|>2 were assigned as differentially expressed.

Isolation of mitochondria from zebrafish tissues

Mitochondria were isolated from various tissues of MT and WT zebrafish, as detailed previously (50). Briefly, fresh tissues were isolated, washed with ice cold phosphate-buffered saline (PBS) buffer, homogenized in IB Cell buffer (225 mM mannitol, 75 mM sucrose, 30 mM Tris/HCl pH 7.4) and centrifuged at 1000×g for 5 min at 4 °C twice. The supernatants were collected and centrifuged at 12,000×g for 15 min at 4 °C. The supernatants were discarded, and the resultant pellets (which is mitochondria) were stored at −80 °C for later use.

Blue native polyacrylamide gel electrophoresis and in-gel activity assays

BN-PAGE was performed by isolating mitochondrial proteins from various tissues of MT and WT zebrafish, as detailed elsewhere (36, 50, 51). Mitochondrial pellets isolated from various tissues were resuspended in 10 mg/ml proteins in lysis buffer (20 mM Tris pH 7.4, 0.1 mM EDTA, 50 mM NaCl, 10% glycerol and 2% n-Dodecyl-β-D-Maltopyranoside) on ice for 20 min. After centrifugation at 12,000×g for 15 min at 4 °C, the supernatants were mixed with loading dye (5% Coomassie Brilliant Blue G-250 and 50% glycerol). 15 micrograms of mitochondrial proteins were separated on 3 to 11% BN-PAGE gel electrophoresis, and then electroblotted onto a 0.45 μm PVDF membrane (Sigma). The primary antibodies used for this investigation were Ndufs3, Sdhb, Uqcrc2, Cox5a and Atp5a1 (Table S2). Peroxidase AffiniPure goat anti-rabbit IgG (Jackson) were used as secondary antibodies and protein signals were detected using the ECL system (CWBIO).

For in-gel activity assays, samples containing 30 μg of total mitochondrial proteins were separated on 3 to 11% Bis–Tris Native PAGE gel. The native gels were prewashed in cold water and then incubated with the substrates of complex I (NADH and nitrotetrazolium) and complex IV (cytochrome c and DAB) at room temperature as described elsewhere (50). After stopping reaction with 10% acetic acid, gels were washed with water and scanned to visualize the activities of respiratory chain complexes.

Assays for the activities of OXPHOS complexes

Enzyme histochemistry analysis for SDH and COX in the frozen-sections were performed as detailed elsewhere (52, 53). Briefly, freshly dissected tissues were embedded in optimal cutting temperature compound (Tissue-Tek), frozen on dry ice, and sectioned to 10 μm. For SDH assay, samples were incubated in 5 mM phosphate buffer, pH 7.6, containing 5 mM EDTA, 1 mM potassium cyanide (KCN), 0.2 mM phenazine methosulfate, 50 mM succinic acid, 1.5 mM NBT at 37 °C for 25 min. For COX assay, samples were incubated in 5 mM phosphate buffer, pH 7.4, containing 0.1% DAB, 0.1% Cytochrome c, 0.02% catalase at 37 °C for 60 min.

The enzymatic activities of complexes I and II were assayed with isolating mitochondria from these tissues of WT zebrafish by the oxidation–reduction method using 2,6-Dichloroindophenol as artificial electron acceptor (37, 54). Briefly, the activity of complex I was determined through the oxidation of NADH by incubating 10 μg of mitochondrial proteins from various tissues in the 200 μl buffer [2.5 mg/ml, 5 mM MgCl_2_, 25 mM KH_2_PO_4_/K_2_HPO_4_ pH 7.2, 0.13 mM NADH, 0.01 mM decylubiquinone (Sigma), 0.01 mg/ml antimycin A, 2 mM KCN and 0.05 mM dichlorophenolindophenol (Sigma)]. The activity of complex II was measured through the oxidation of succinate by incubating 10 μg of mitochondrial proteins from various tissues in the 200 μl buffer [2.5 mg/ml BSA, 25 mM KH_2_PO_4_/K_2_HPO_4_ pH 7.2, 0.01 mM decylubiquinone (Sigma), 0.05 mM rotenone, 0.01 mg/ml antimycin A, 2 mM KCN and 0.05 mM dichlorophenolindophenol (Sigma)]. Reactions were pre-incubated at 37 °C for 10 min and then monitored the absorbance at 600 nm in 5 min.

Histological studies

For H&E staining, adult zebrafish were anesthetized in 0.02% MS-222. Their tissues were extracted and fixed in 10% formalin at 4 °C overnight. Samples were then dehydrated, infiltrated, embedded in paraffin, sliced into 5 μm thick by pathologic microtome (RM2016, Leica). Tissue sections were then stained by H&E Staining Kit (Beyotime, C0105S).

Oil Red O staining

Oil Red O staining was performed as described previously (55). After anesthetizing in 0.02% MS-222, the livers were extracted from MT and WT zebrafish and fixed in 10% formalin at 4 °C overnight. After washing twice with PBS, the livers were infiltrated with 50%, 80% and 100% 1,2-propylene glycol solution for 30 min each and stained with 0.3% solution of Oil Red O (Sigma) in 100% 1,2-propylene glycol for 3 h at room temperature with gentle rocking. After staining, the samples were washed twice in 80% 1,2-propylene glycol for 30 min, further washed twice with PBS and then fixed in 10% formalin overnight at 4 °C. Finally, the livers were embedded in optimal cutting temperature for frozen section using a cryostat (Leica CM 3050S). Transverse sections with size of 10 μm were obtained and visualized with microscope (DM400B, Leica).

Whole mount in situ hybridization

Whole mount in situ hybridization was performed as detailed elsewhere (56). Probes were synthesized with DIG-labeled antisense RNA probes specific to zebrafish fabp10a (forward primer: TCTCCAGAAAGCATGGCCT; reverse primer: TGAAACGCTTCAGATCTTCTTGC). Larvae from various age of post-fertilization were dechlorinated in 2 mg/ml pronase in E3 medium and fixed at 4 °C in 4% paraformaldehyde in PBS overnight, then transferred to 100% methanol for storage at −20 °C for at least 20 min before undergoing hybridization. After the hybridization procedure, larval were washed extensively in PBS with 0.1% Tween 20, re-fixed in 4% paraformaldehyde, and then transferred to 70% glycerol. Stained larval were visualized using stereoscopic microscopes (SMZ18, Nikon) (56).

Live imaging of zebrafish larvae

Offspring of the trmu^−/−^ heterozygous Tg (fabp10a:DsRed, ela3l:EGFP) zebrafish was imaged to assess liver size (57). Four dpf and 5 dpf living larvae were transferred onto glass slides with drops of 3% methylcellulose. The livers of larvae were visualized under a stereoscopic microscope (SMZ18; Nikon).

Statistical analysis

All statistical analyses were performed using GraphPad Prism (version 8.3.0; https://www.graphpad.com/updates/prism-830-release-notes) for statistical analysis to compare outcomes using an ANOVA Test. p values of less than 0.05 were considered to be statistically significant.

Data availability

The authors declare that all relevant data of this study are available within the article or from the corresponding author (gminxin88@zju.edu.cn) upon reasonable request.

Supporting information

This article contains supporting information.

Conflict of interest

The authors declare that they have no conflicts of interest with the contents of this article.