Red panda intestinal organoids for the functional analysis of Lactobacillus salivarius

TL;DR

Researchers created red panda intestinal organoids to study the effects of a probiotic bacteria, Lactobacillus salivarius, on gut health and infection resistance.

Contribution

The first long-term, passagable red panda intestinal organoid system and its use to demonstrate probiotic effects of Lactobacillus salivarius P103.

Findings

Red panda intestinal organoids retain tissue-specific cell types and functions.

Lactobacillus salivarius P103 promotes mucin secretion and reduces intestinal inflammation.

The probiotic inhibits infection by Klebsiella pneumoniae 28 in organoid co-culture.

Abstract

Organoids are excellent and reproducible in vitro models for studying physiological mechanisms and modeling diseases in endangered species. However, intestinal organoids of red pandas have not yet been established. This study reports a culture system of intestinal stem cell-derived organoids of red panda that can be passaged, cryopreserved, and resuscitated in vitro. The single-cell RNA sequencing and RNA sequencing analysis showed that red panda intestinal organoids retain tissue-specific cell types and functions. In order to verify the application potential of Lactobacillus salivarius P103 as a probiotic in red pandas, these organoids were used to establish a co-culture system with L. salivarius P103. The results showed that L. salivarius P103 could promote mucin secretion, reduce intestinal inflammation, and inhibit infection induced by Klebsiella pneumoniae 28. The establishment of red panda intestinal organoids provides a long-term, reproducible model system for studying host-microbe interaction mechanisms and decreasing dependence on animal models in wildlife research.

•Established long-term, passagable, cryopreservable red panda intestinal organoids•Organoid single-cell transcriptomes retain major intestinal epithelial lineages•Lactobacillus salivarius P103 exhibits probiotic effects in red panda organoids

Established long-term, passagable, cryopreservable red panda intestinal organoids

Organoid single-cell transcriptomes retain major intestinal epithelial lineages

Lactobacillus salivarius P103 exhibits probiotic effects in red panda organoids

Endangered species microbiology; Bacteriology; Experimental models in systems biology

Figures

Establishment and characterization of red panda intestinal organoids(A) Schematic diagram of the experimental procedure for isolating intestinal crypts from the small intestine (ileum) of the red panda to culture intestinal organoids. The figure is created by Figdraw.(B) Representative pictures of intestinal organoids growth state from day 2–8 of culture in Matrigel under a light microscope. Scale bars, 100 μm(C) Representative pictures of intestinal organoids from passages 1 to 5. Scale bars, 200 μm.

scRNA-seq analysis and characterization of red panda intestinal organoid cell types(A) Schematic diagram of the scRNA-seq analysis and characterization of isolated red panda intestinal organoid cell types. The figure is created by Figdraw (ID: TPSUUdade4).(B) The 6138 cells are assigned to 14 cell clusters by Uniform Manifold Approximation and Projection (UMAP) dimensionality reduction analysis. The *X* and *Y* axes represent the 2 dimensions after dimensionality reduction by UMAP. Each dot represents a cell, and cells with similar expression patterns are clustered into the same cell cluster.(

Red panda intestinal organoids and tissue transcriptome sequencing analysis(A) Clustered gene expression heat maps in small intestinal tissue (RPST, *n* = 3) and organoids (RPIO, *n* = 4). Red indicates highly expressed genes, and blue indicates poorly expressed genes.(B) Gene expression levels of the various small intestinal epithelium cell lineages in tissues and organoids. Red indicates highly expressed genes, and blue indicates poorly expressed genes.(C) Venn diagram of genes expressed in intestinal organoids and tissues.(D) KEGG enrichment analysis of co-expressed DEGs in intestinal organ

Co-culture of *Lactobacillus salivarius* P103 and intestinal organoids(A) *L. salivarius* P103 and Red Panda intestinal organoids co-culture experimental diagram.(B) Schematic diagram of intestinal organoids and *L. salivarius* P103 co-culture system model.(C–F) Comparisons between the *L. salivarius* P103 treatment group (P103, *n* = 4) and the control group (Control, *n* = 4) for the relative mRNA expression of *MUC2*, *LGR5*, *BMI1*, and *MSIl* detected by RT-qPCR. Data are shown as mean ± SD. ∗*p* < 0.05, ∗∗*p* < 0.01, and ∗∗∗*p* < 0.001.Data are analyzed using Student’s *t* test.

Transcriptome analysis after treating red panda intestinal organoids with *L. salivarius* P103(A) Pearson’s correlation coefficient analysis of the *L. salivarius* P103-treated (P103, *n* = 4) and control (Ctrl, *n* = 4) groups. The colors from red to blue represent a high-to-low correlation.(B) Volcano plots comparing DEG levels between the P103 and control groups. Orange indicates upregulated genes, gray indicates unchanged genes, and cyan indicates downregulated genes.(C) Gene expression heatmap of the DEGs between the P103 and control groups. Red indicates highly expressed genes, and blue

Full text

Introduction

The red panda (Ailurus fulgens) is an endangered mammal endemic to the Himalaya-Hengduan Mountains.1 Due to habitat degradation and fragmentation, climate change, poaching, and other factors, red pandas are listed as an endangered species by the International Union for the Conservation of Nature (IUCN) Red List of Threatened Species, even more endangered than the giant panda (Ailuropoda melanoleuca).1^,^2^,^3^,^4^,^5 Many studies on red panda, such as those on ecology,2^,^5^,^6^,^7^,^8 genomics,9^,^10 gut microbiome,11^,^12^,^13^,^14 disease,15^,^16 and reproductive biology,17^,^18 are available and plays very important roles in their conservation.

The red panda has a relatively short and simple digestive tract, in which gut microbiota play an important role in the digestion of food.12 However, due to the lack of suitable research models and limitations related to invasive experiments, the mechanisms of host-microbe interactions remain unclear. It is one of the fastest renewing tissues, usually renewing every 2–5 days19^,^20 This process is driven by the rapid and continuous proliferation and differentiation of intestinal stem cells (ISCs) located at the base of the crypts.21^,^22 Besides, the intestinal epithelium is in continuous contact with the gut microbiota and maintains a mutualistic relationship,23 which plays a key role in the processing of indigestible foods,24 protecting intestinal barrier function, influencing the proliferation and differentiation of ISCs,25^,^26^,^27 inhibiting pathogen infection,28 regulating the immune system.21 Furthermore, gut microbiota and their metabolites interact directly and indirectly with the ISCs to regulate epithelial function, restitution, and repair.26^,^29 However, the detailed mechanisms involved in this interaction remain unknown.21^,^30 Due to limitations related to invasive work in endangered species and research models, the host-microbe interaction mechanisms in endangered species remain elusive, such as the red panda. Therefore, developing an intestinal epithelium model for the red panda is necessary.

Previous studies used immortal cell lines and animal models to investigate host-microbe interactions and understand intestinal epithelium functions. Compared with primary cells, the genotypes of immortal cell lines can undergo significant alterations, and gene pathways often change after multiple passages in vitro.31^,^32 Animal models are often too complex and differ in physiological mechanisms to directly elucidate the interactions between intestinal microbiota and epithelial cells in the target species. This is especially pronounced in specialized species such as the red and giant pandas, which are bamboo-eating specialists and harbor typical carnivorous digestive systems.12 Animal models might not accurately simulate host-microbe interactions in vivo due to differences in the digestive system and physiological mechanisms. Besides, our previous research revealed that a germ-free mouse model was unsuitable for analyzing the function of some giant panda gut microbiota.33 Therefore, it is imperative to explore in vitro models that closely resemble the structure and function of the gut in vivo to study host-microbe interactions in endangered species, such as the red panda.

Intestinal organoids are in vitro three-dimensional (3D) cellular structures derived from primary tissues, capable of self-renewal and self-organization, recapitulating the structure and function of the intestines.34^,^35 A distinct advantage of intestinal organoids is the development of crypts that contain multiple intestinal epithelial cell types.25^,^31 Multiple studies suggested that intestinal organoids were excellent models for drug screening, regenerative medicine, and intestinal structural research.36^,^37^,^38 Furthermore, the co-culture of organoids and various microorganisms could simulate highly complex host-microbe interactions in vitro and facilitate studying their interaction mechanisms. Thus, intestinal organoids are robust in vitro research models for studying host-microbe interactions, such as Bacillus subtilis, Limosilactobacillus reuteri, Salmonella, and SARS-CoV-2.25^,^39^,^40^,^41 After mouse intestinal organoids were established,42 organoids from various tissues of humans, rats, and farm animals were successfully established.37^,^43^,^44^,^45^,^46^,^47^,^48^,^49 However, similar organoid models in endangered wildlife species, including the red panda, were not reported.

This study aimed to establish intestinal organoids from red panda ISCs to study the interactions between the host and Lactobacillus salivarius P103. Previous studies have shown that this strain has the potential to reduce intestinal inflammation and regulate the gut microbiota in vitro and in mouse models, demonstrating good probiotic potential (unpublished data). To further validate the preventive effects of L. salivarius P103, the pathogenic strain Klebsiella pneumoniae 28 was used in the experiments. The results suggested that the red panda intestinal organoid model was an excellent model for studying the mechanisms involved in the interactions between intestinal microbiota and intestinal epithelium in this species.

Results

Establishment and characterization of red panda intestinal organoids

Fresh crypts were embedded in Matrigel and cultured with an intestinal organoid medium, as shown in the schematic diagram (Figure 1A). Most isolated crypts differentiated within 7 days into budding organoids with a crypt-villus architecture (Figure 1B). As shown in Figure 1C, these organoids showed various morphologies through passages 1 to 5, mostly as buds or solid organoids and a few as spherical organoids.Figure 1. Establishment and characterization of red panda intestinal organoids(A) Schematic diagram of the experimental procedure for isolating intestinal crypts from the small intestine (ileum) of the red panda to culture intestinal organoids. The figure is created by Figdraw.(B) Representative pictures of intestinal organoids growth state from day 2–8 of culture in Matrigel under a light microscope. Scale bars, 100 μm(C) Representative pictures of intestinal organoids from passages 1 to 5. Scale bars, 200 μm.

scRNA-seq analysis and characterization of intestinal organoid cell types in red panda

Due to the lack of specific antibodies against red panda proteins, we performed scRNA-seq to characterize the intestinal organoids cell types of passage 3 in red panda using the 10x genomics platform, as shown in the schematic diagram (Figure 2A). Cell Ranger filtration captured 6451 cells. After removing low-quality cells by standard quality control, 6138 remained for further analysis. The average reads per cell were 61355. We detected 19869 genes, with a median of 2088 genes per cell. The 6138 cells were divided into 14 clusters (Figure 2B) using the UMAP dimensionality reduction strategy for the coarse clustering.50 The clusters contained between 18 and 1128 cells (Figure 2B, and Table S1). We performed DEGs analysis for each cell cluster based on the Wilcoxon rank-sum test algorithm to identify marker genes. The clustering heatmap displays the top 4 DEGs of each cluster (Figure 2C) and the expression pattern of the highest expressed gene (Figure 2D). The results showed that the selected genes had unique expressions and could be used as cluster-specific marker genes (Figures 2C and 2D).Figure 2scRNA-seq analysis and characterization of red panda intestinal organoid cell types(A) Schematic diagram of the scRNA-seq analysis and characterization of isolated red panda intestinal organoid cell types. The figure is created by Figdraw (ID: TPSUUdade4).(B) The 6138 cells are assigned to 14 cell clusters by Uniform Manifold Approximation and Projection (UMAP) dimensionality reduction analysis. The X and Y axes represent the 2 dimensions after dimensionality reduction by UMAP. Each dot represents a cell, and cells with similar expression patterns are clustered into the same cell cluster.(C) Gene expression heatmap of the top 4 DEGs in each cell cluster. Different colors represent different cell clusters. Yellow indicates highly expressed genes, and purple indicates poorly expressed genes.(D) Violin diagram of highly expressed genes in each cell cluster.(E) The UMAP plot is annotated by cell-type marker genes. Each dot represents a cell, and cells with the same color are of the same type.(F) Petal diagram shows the number of cells per cluster.(G and H) Pseudotime trajectories of intestinal organoid cell lines.

We annotate eight intestinal epithelium-related cell types and fibroblasts using marker genes (Figure 2E). Specifically, clusters 0 and 3 were identified as stem cells (32.0%, expressing TFF1 and WNT6), clusters 1 and 10 were identified as transit-amplifying cells (15.8%, expressing SPINK1 and TRY2), clusters 2 and 4 were identified as enterocyte progenitor cells (24.3%, expressing DPEP1 and APOB), cluster 5 was identified as Paneth cells (9.0%, expressing PABPC1), clusters 6 and 7 were identified as goblet cells (10.6%, expressing TFF3 and LGALS4), cluster 8 was identified as enterocytes (3.4%, expressing DUT), cluster 9 was identified as enteroendocrine cells (2.5%, expressing ChgA), cluster 11 was identified as tuft cells (1.1%, expressing PLCG2), cluster 12 was identified as fibroblasts (1.0%, expressing DCN), but cluster 13 remained undefined (Figures 2E and 2F, and Table S1). Based on the Monocle 2 algorithm, intestinal organoid cells were constructed with a pseudotime differentiation trajectory, and the results showed that there was a branchpoint where fibroblasts separated from the developmental trajectory (Figures 2G, 2H, and S3). Intestinal stem cells, transit-amplifying cells, and Paneth cells in early development, and goblet cells, enteroendocrine cells, and other functional cells in the middle and late development (Figures 2G, 2H, and S1). Overall, the scRNA-seq results showed that the established red panda intestinal organoids had a range of intestinal epithelial cells.

Transcriptomic analysis of intestinal organoids and primary tissues

To further characterize our organoid cultures, we used RNA-seq to compare the gene expression profiles of organoids with those of primary tissues. Gene expression clustering heat maps for the tissue (n = 3) and organoids (n = 4) transcriptome data showed that the three tissue samples clustered on the same branch, and all organoids showed consistent expression patterns (Figure 3A). Genes specific to the various cell lineages in the small intestinal epithelium31^,^51 were expressed in the organoids (Figure 3B). The tissues and intestinal organoids expressed 9166 genes, including 8535 commonly expressed genes, 477 expressed only in the tissues, and 154 expressed only in the organoids (Figure 3C).Figure 3. Red panda intestinal organoids and tissue transcriptome sequencing analysis(A) Clustered gene expression heat maps in small intestinal tissue (RPST, n = 3) and organoids (RPIO, n = 4). Red indicates highly expressed genes, and blue indicates poorly expressed genes.(B) Gene expression levels of the various small intestinal epithelium cell lineages in tissues and organoids. Red indicates highly expressed genes, and blue indicates poorly expressed genes.(C) Venn diagram of genes expressed in intestinal organoids and tissues.(D) KEGG enrichment analysis of co-expressed DEGs in intestinal organoids and tissues. The numbers represent the number of genes enriched in each pathway. The red to green colors represent the high-to-low enrichment factor.(E) KEGG enrichment analysis of DEGs in tissues only. The numbers represent the number of genes enriched in each pathway. The red to green colors represent the high-to-low enrichment factor.(F) KEGG enrichment analysis of DEGs in intestinal organoids only. The numbers represent the number of genes enriched in each pathway. The red to green colors represent the high-to-low enrichment factor.

The GO and KEGG enrichment analyses showed that the 8535 shared genes were involved in nutrient digestion and metabolism (Figures 3D, S2A, and Tables S2 and S3). The genes expressed only in the tissues (n = 477) were involved in immune pathways, and the nervous and blood systems. Their functions included T and B cell functions, hematopoietic cell lineage, and regulation of nervous system development (Figures 3E, S2B, and Tables S4 and S5), proving that the organoids did not include cells of the nervous and blood systems. The genes expressed only in the organoids (n = 154) were involved in metabolism, stem cell signaling pathways, arachidonic acid metabolism, wnt signaling pathway, PI3K-Akt signaling pathway, and Hippo signaling pathway (Figures 3F, S2C, and Tables S6 and S7). These results indicated that the intestinal organoids at least partially recapitulated intestinal functions.

The effect of L. salivarius P103 on intestinal organoids based on RT-qPCR

In the small intestine, the Paneth and goblet cells are the most abundant cell types in the ileum,25 and lactic acid bacteria are more abundant in the small intestine than in the colon.28 Therefore, based on a previous model,52 a co-culture system of ileum-derived organoids and L. salivarius P103 was employed, as shown in the schematic diagram (Figures 4A and 4B). The results showed that L. salivarius P103 significantly increased the mRNA expression of MUC2 in the organoids (Figure 4C). There was no significant difference in the mRNA expression level of the active ISC marker (LGR5) (Figure 4D), but the expression of the quiescent ISC markers (BMI1 and MSI1) was significantly increased (Figures 4E and 4F).Figure 4. Co-culture of Lactobacillus salivarius P103 and intestinal organoids(A) L. salivarius P103 and Red Panda intestinal organoids co-culture experimental diagram.(B) Schematic diagram of intestinal organoids and L. salivarius P103 co-culture system model.(C–F) Comparisons between the L. salivarius P103 treatment group (P103, n = 4) and the control group (Control, n = 4) for the relative mRNA expression of MUC2, LGR5, BMI1, and MSIl detected by RT-qPCR. Data are shown as mean ± SD. ∗p < 0.05, ∗∗p < 0.01, and ∗∗∗p < 0.001.Data are analyzed using Student’s t test.

Transcriptome analysis of red panda intestinal organoids after treatment with L. salivarius P103

Based on RT-qPCR analysis, L. salivarius P103 treatment had a regulatory effect on the red panda intestinal organoids (Figure 4). We performed RNA-seq experiments using organoids treated with L. salivarius P103 for 48 h to understand this regulatory effect better. We obtained 53.30 G of clean reads whose GC content ranged from 47.81% to 48.76% (Table S8). Pearson’s correlation coefficient analysis between samples based on their gene expression found differences between the P103 and control groups (Figure 5A). The clustering of the four biological replicates in each group was highly reproducible, consistent with principal component analysis (Figures 5A and S3A).Figure 5. Transcriptome analysis after treating red panda intestinal organoids with L. salivarius P103(A) Pearson’s correlation coefficient analysis of the L. salivarius P103-treated (P103, n = 4) and control (Ctrl, n = 4) groups. The colors from red to blue represent a high-to-low correlation.(B) Volcano plots comparing DEG levels between the P103 and control groups. Orange indicates upregulated genes, gray indicates unchanged genes, and cyan indicates downregulated genes.(C) Gene expression heatmap of the DEGs between the P103 and control groups. Red indicates highly expressed genes, and blue indicates poorly expressed genes.(D) GO enrichment analysis of DEGs between the P103 and control groups. The numbers represent the number of genes enriched in each term. The red to green colors represent the high-to-low enrichment factor.(E) KEGG enrichment analysis of DEGs between the P103 and control groups. The numbers represent the number of genes enriched in each pathway. The red to green colors represent the high-to-low enrichment factor.(F) Comparison of DEGs expression between the P103 and control groups. Data are shown as mean ± SD. ∗p < 0.05, ∗∗p < 0.01, and ∗∗∗p < 0.001. Data are analyzed using Student’s t test.

Compared with the control group, we identified 2573 DEGs in the P103 group, of which 723 were significantly upregulated, and 1850 were significantly downregulated (Figures 5B and S3B). Cluster analysis of the DEGs showed that the P103 and control groups were significantly and differently clustered (Figure 5C). The GO terms enrichment analysis results showed that the DEGs between the P103 and control groups were enriched in tissue morphogenesis, tissue development, muscle structure development, signaling receptor binding, external encapsulating structure, and more (Figure 5D and Table S9). The KEGG pathway enrichment analysis indicated that these were mainly related to metabolism and inflammation, including protein digestion and absorption, cytokine-cytokine receptor interaction, PI3K-Akt signaling pathway, tryptophan metabolism, TNF signaling pathway, and more (Figure 5E and Table S10). The DEGs analysis showed that OLFM4, Reg3g, and FCGBP were highly upregulated genes in the P103 group (Figure 5F). These genes play an important role in protecting the intestinal mucosal barrier and maintaining intestinal health. Furthermore, we found that inflammation-related genes, including EDNRB, NKX2-3, CTSL, and LBH, were significantly downregulated in the P103 group (Figure 5F).

L. salivarius P103 alleviates red panda intestinal organoids infection induced by K. pneumoniae 28

To further verify the effects of L. salivarius P103 on intestinal organoids, we cultured the organoids with L. salivarius P103 for 24 h, followed by adding K. pneumoniae 28 for 24 h, as shown in Figure 6A. The RNA-seq analysis found high within-group similarity and large between-group differences in gene expression (Figure 6B). The expression level of MUC2 and ZO-1 in the KP28 group was significantly reduced (Figures 6C and 6D), indicating impaired intestinal barrier function, but functional validation was not performed. Compared to the P103 and P-KP groups, the expression of genes involved in inflammation (CTSL, LBH, EDNRB, and NKX2-3) was significantly upregulated in the KP28 group (Figure 6E). The expression of these genes in the P103 and P-KP groups was similar (Figure 6E). Compared to the KP28 group, the expression of mucin and antimicrobial peptide-related genes (MUC2, REG3G, OLFM4, and TFF3) in the P103 and P-KP groups was upregulated (Figure 6F). These results further confirmed that L. salivarius P103 may induce the secretion of mucins by intestinal epithelial cells to resist pathogen infection and reduce intestinal inflammation.Figure 6L. salivarius P103 alleviates infection induced by Klebsiella pneumoniae 28 in red panda intestinal organoids(A) Experimental design diagram.(B) Principal component analysis outcomes for the four experimental groups. Different colors represent different experimental groups.(C) RT-qPCR analysis of the relative mRNA expression of Muc2 in the K. pneumoniae 28 infection and control groups. Data are analyzed using Student’s t test and are shown as mean ± SD. ∗p < 0.05.(D) The mRNA expression of Z O -1 in the K. pneumoniae 28 infection and control groups. Data are analyzed using Student’s t test and are shown as mean ± SD. ∗∗∗p < 0.001.(E) The mRNA expression of genes associated with inflammation. Data are analyzed using one-way ANOVA and are shown as mean ± SD. ∗p < 0.05, ∗∗p < 0.01, and ∗∗∗p < 0.001.(F) The mRNA expression of genes related to intestinal epithelium mucin and antibacterial secretion. Data are analyzed using one-way ANOVA and are shown as mean ± SD. ∗p < 0.05, ∗∗p < 0.01, and ∗∗∗p < 0.001.

Discussion

In this study, we successfully established and characterized red panda ileum-derived organoids. Then, we used these organoids and L. salivarius P103 to establish a co-culture model and found that L. salivarius P103 exhibited great potential for use as a probiotic for red pandas.

The successful establishment of the red panda intestinal organoids model

In this study, we observed that the established red panda intestinal organoids were dominated by buds or solid organoids, similar in morphology to those previously reported in murine and porcine models.42^,^53 The intestinal organoids were successfully cultured, expanded in vitro over at least 6 passages, remained unchanged in morphology and growth rate, and were stable in culture for more than 6 months. Besides, red panda intestinal organoids could be passaged, cryopreserved, and resuscitated, following a protocol reported for human intestinal organoids.54

The intestinal organoids consisted of various cell types. We used scRNA-seq to characterize the intestinal epithelial cell types in the intestinal organoids, including ISCs, enterocytes, and Paneth, goblet, and enteroendocrine cells (Figure 2E). The cell types identified in the red panda intestinal organoids were largely consistent with those detected by scRNA-seq in human, mouse, and pig intestinal epithelium or organoids.45^,^55 Some studies did not detect Paneth cells in rats and rhesus monkeys, suggesting that other cells might be taking their place and fulfilling their anti-microbial function.55^,^56 However, consistent with humans and mice, we identified a group of Paneth cells in the red panda intestinal organoids (Figure 2E). Interestingly, we have identified 1.0% (64/6138) of the cells in the intestinal organoids as fibroblasts (Figures 2E and 2F). Similarly, Stao et al.42 demonstrated the presence of non-epithelial cells in mouse intestinal organoids, and Zhao et al.57 detected myofibroblasts in chicken intestinal organoids established through crypt isolation. The fibroblasts probably grew in the Matrigel after tissue digestion.

We used RNA-seq to compare gene expression in organoids and tissues and found that a set of genes expressed in organoids closely resembled those in the tissues, a characteristic reported in other organoids.31 The 8535 genes co-expressed in the organoids and tissues were mainly involved in digestive and metabolic processes (Figure 3F), proving that the organoids had the digestive and absorption functions of intestinal tissues. Remarkably, the genes expressed only in the tissues were mainly involved in immune pathways and the nervous and blood systems (Figure 3E). This is mainly because tissues in vivo have capillaries, immune cells, and nerve cells, while organoids do not.31^,^58 Overall, the established intestinal organoids could simulate the physiological structure and function of intestinal epithelium in vitro, and have great potential to reduce or replace the dependence on animal models when studying the intestinal epithelium in this species.

The applications of the intestinal organoids

We assessed the ability of L. salivarius P103 to act as a probiotic in red pandas using a co-culture system with the organoids. The results showed that L. salivarius P103 promoted the secretion of MUC2 and FCGBP, increased the expression of ISCs marker genes, and downregulated inflammatory gene expression when no pathogens infected the organoids (Figures 4 and 5). FCGBP and MUC2 are the main components of the mucous secreted by goblet cells, which play an important role in resisting pathogen invasion and protecting the integrity of the intestinal barrier.59^,^60 Consistent with these results, simultaneous treatment of the intestinal organoids with B. subtilis or L. acidophilus significantly increased MUC2 expression.25^,^61

L. salivarius P103 treatment increased the mRNA expression of quiescent ISCs markers (BMI1, MSI1) (Figures 4E and 4F). Quiescent ISCs play a greater role in epithelial repair than in basal homeostasis and can repair associated damage when the number of active ISCs is reduced or when these cells are damaged.52^,^62 Our results were consistent with other studies. For example, Hou et al.25 found that B. subtilis promoted the differentiation of ISCs into secretory cells, and Wu et al.52 found that L. reuteri D8 stimulated the growth of mouse intestinal organoids in vitro and accelerated the self-renewal of ISCs to repair damaged intestinal mucosa.

Our study also found that REG3G, Fcgbp, and OLFM4 antibacterial-related genes were significantly upregulated in the P103 group (Figure 5F). REG3G is highly expressed in the small intestine to enhance the host’s defense by inhibiting epithelial inflammation and bacterial colonization.63 OLFM4 is a secreted glycoprotein that plays an important role in preventing bacterial infection, reducing inflammation, and enhancing innate immunity.64 Moreover, inflammation-related genes were significantly downregulated in the P103 group, including EDNRB, NKX2-3, CTSL and LBH (Figure 5F). Studies have shown that CTSL was positively correlated with pro-inflammatory factors and played an important role in inflammation regulation.65 EDNRB and NKX2-3 are associated with intestinal mucosal inflammation, and studies have shown that probiotic treatment downregulated their mRNA expression and played an anti-inflammatory role.66^,^67 Collectively, these results suggest that L. salivarius P103 could exert a protective effect by upregulating antibacterial-related genes and downregulating inflammation-related genes.

Furthermore, L. salivarius P103 can prevent pathogenic infection (Figure 6). K. pneumoniae is a common potentially pathogenic bacterium in red pandas that leads to intestinal diseases such as intestinal inflammation.68 We found that infection with K. pneumoniae 28 inhibited MUC2 and ZO-1 expression and upregulated the expression of genes involved in inflammation, including EDNRB, NKX2-3, CTSL, and LBH (Figures 6C–6E). ZO-1 is critical for intestinal mucosal repair, and its downregulation could increase intestinal tight junction permeability.69 Consequently, K. pneumoniae 28 infection damages the intestinal barrier and induces inflammation, although functional validation was not performed. However, we found that pretreatment with L. salivarius P103 led to the secretion of mucins that inhibited K. pneumoniae 28 infection by upregulating the expression of MUC2, REG3G, OLFM4, and TFF3 (Figure 6F). L. salivarius P103 stimulated the intestinal secretion of MUC2 and TFF3, which constitute the first line of the mucosal barrier. The antibacterial-related factors REG3G and OLFM4 inhibited the growth of K. pneumoniae 28 to protect the intestinal health of the host. Moreover, pretreatment with L. salivarius P103 inhibited the expression of EDNRB, NKX2-3, CTSL, and LBH induced by K. pneumoniae 28 (Figure 6E), thereby inhibiting the inflammatory response. Collectively, these results suggest that L. salivarius P103 could downregulate inflammation-related genes, upregulate antibacterial-related genes, and may promote mucin secretion to inhibit K. pneumoniae 28 infection.

Conclusions

This study successfully established and characterized red panda intestinal stem cell-derived organoids, recapitulating the organ-specific multicell composition and functional structure of intestinal epithelium. We used these organoids and L. salivarius P103 to establish a co-culture model and found that L. salivarius P103 exhibited great potential as a probiotic for red pandas. We also demonstrated that the red panda intestinal organoids could be used as models for studying host-microbe interactions in vitro.

Limitations of the study

Although this study successfully established red panda intestinal organoid models, the culture system employed relies on commercial media and therefore requires further optimization of culture conditions. In addition, functional assays for intestinal barrier integrity were not performed in this study, and the antimicrobial activity of the related genes has not been experimentally confirmed. Therefore, their precise mechanisms and potential effects require further investigation in future studies. Notably, the co-culture model used here limits direct interactions between Lactobacillus salivarius P103 and the intestinal villi; future research should establish more physiologically relevant co-culture systems, such as apical-out organoids, lumenal microinjection, or organoid-derived Transwell monolayers.

Resource availability

Lead contact

Further information and requests for resources should be directed to and will be fulfilled by the lead contact, Xiaoyan Su (xyansu@126.com).

Materials availability

All data are provided in the main and supplementary information. Intestinal organoids are available upon request.

Data and code availability

• •The RNA-seq and scRNA-seq datasets have been submitted to the NCBI SRA database with accession numbers PRJNA1070805 and PRJNA1071801, respectively.
• •No custom code was developed and used in this study.
• •Any additional information required to reanalyze the data reported in this article is available from the lead contact upon request.

Acknowledgments

We thank Ying Yao, Feiping Li, and other staff at the Chengdu Research Base of Giant Panda Breeding for assistance with the experiment.

This work was supported by the 10.13039/501100018542Natural Science Foundation of Sichuan Province (2024ZYD0132), the Scientific and Technological Projects within the Chengdu Park City Construction Administration Bureau (202503KY0006, 202503KY0003), the Chengdu Research Base of Giant Panda Breeding (2021CPB-B10), and the 10.13039/501100010821Chengdu Giant Panda Breeding Research Foundation (2017-11).

Author contributions

The project was conceived and supervised by W.Z., X.S., Y.D., Q.G., J.X., Q.Z., J.Z., X.L., R.H., S.Y., X.Y., and L.L. performed the experiments, prepared figures and tables, and conducted data analysis. The first draft of the article was written by W.Z. and Q.G., and all authors commented on previous versions of the article. All authors contributed critically to the ideas and drafts and gave final approval for publication.

Declaration of interests

The authors declare that there is no conflict of interest with any person or institution on the subject matter or materials discussed in this article.

STAR★Methods

Key resources table

REAGENT or RESOURCESOURCEIDENTIFIERBacterial strainsLactobacillus salivarius P103This paper–Klebsiella pneumoniae 28This paper–Critical commercial assaysPrimary Tissue Storage SolutionbioGenousK601005Antibiotic-AntimycoticGibco45240–062MatrigelCorning356231Human intestinal organoids growth mediumstemcell06010Deposited dataRNA sequence dataThis paperPRJNA1070805scRNA sequence dataThis paperPRJNA1071801Software and algorithmsR Version 4.0R software–GraphPad Prism Version 9.5.1GraphPad Prism–Monocle2–https://cole-trapnell-lab.github.io/monocle-release/docs/

Experimental model and study participant details

Ethical approval

All sampling procedures were non-invasive. All animal experiments were approved by the Institutional Animal Care and Use Committee (IACUC) at Chengdu Research Base of Giant Panda Breeding, which includes some regulations on animal ethics, animal welfare, and wildlife conservation. Additionally, all methods were performed in accordance with the national standard guidelines for the ethical review of laboratory animal welfare of the People’s Republic of China (GB/T 35892-2018).

Method details

Intestinal organoid isolation and culture

Intestinal tissue (ileum) was obtained during pathological dissection, washed 4–5 times with cold PBS to remove intestinal contents, transferred to a Primary Tissue Storage Solution (bioGenous, China) for preservation at 4°C–8°C, and transported immediately to the laboratory. Intestinal crypt isolation and organoids culture were performed as previously reported with appropriate modifications.36^,^42^,^47^,^70 Briefly, the ileum tissue was washed with cold PBS containing 5% Antibiotic-Antimycotic (Gibco, UK) and opened longitudinally. The fatty tissue and villi were removed with a scalpel. The cleaned ileum tissue was cut into 1–3 mm^2^ pieces, transferred to a centrifugal tube, an appropriate amount of Tissue Digestion Solution (bioGenous, China) was added, and the samples were digested for 30–50 min at 37°C in a water bath. Digestion was terminated by adding fetal calf serum. The suspension was passed through a 100 μm cell filter, and the ileal crypts were isolated and purified by centrifugation. The crypts were then suspended in Matrigel (Gibco, UK), and 50 μL drops of the suspension were added to wells in a 24-well plate. Human intestinal organoids growth medium (600 μL; stemcell, Canada) was added to each well and was refreshed every 2–3 days.

Establishment of bacteria and intestinal organoids co-cultures systems

The establishment of L. salivarius P103 and intestinal organoids co-culture systems largely followed published procedures.52^,^71 The organoids were cultured for 5 days under physiological conditions to form budding structures. Subsequently, they were co-cultured with L. salivarius P103 (1 × 10^6^ CFU) for 48 h to detect its effect on the intestinal organoids (P103 group). To verify the inhibition of L. salivarius P103 on pathogenic bacteria, intestinal organoids were pretreated with L. salivarius P103 (1 × 10^6^ CFU) for 24 h. Subsequently, the intestinal organoids were infected by K. pneumoniae 28 (1 × 10^6^ CFU) for 24 h (P-KP group). Alternatively, the intestinal organoids were infected directly with K. pneumoniae 28 (1 × 10^6^ CFU) for 24 h (KP28 group).

RNA extraction and quantitative PCR

Total RNA was extracted from intestinal organoids by RNeasy Mini Kit (Qiagen, Germany), according to the manufacturer’s protocol. RNA was reverse transcribed using PrimeScript RT reagent Kit with gDNA Eraser (TaKaRa, Japan), according to the manufacturer’s protocol. The real-time PCR reaction was performed using TB Green Premix Ex Taq II (TaKaRa, Japan) on a CFX96 Real-Time PCR Detection System (Bio-Rad, US). The relative mRNA expression levels were calculated using the 2^-ΔΔCt^ method, with GAPDH as a housekeeping gene. The target gene primers used in this study are listed in the table below.Primer sequences used for q-PCRTarget nameForwardReverseReferenceBMI1AGATGGACTGACAAATGCTGGAGGGCTAGGCAGACAGGAAGAGGT–MSI1GCGCTGATGTAACTGCTGACCTCAACTCCCAGCCGCACAG–MUC2ATCAGTGTGAGCACGAGCCCACAGCGAGCAGTTTGCGTAATA–LGR5CACTCGTCTTGCTCAACTCCCTACAGTCCCACATAGTCTCCAGGTCT–GAPDHAACTGCTTGGCTCCTCTGTTCTGGGTGGCGGTGATYizhen et al.72

RNA sequencing and bioinformatics analysis

Total RNA was extracted from the intestinal organoids of the control, P103, KP28, and P-KP groups (n = 4 per group) using RNeasy Mini Kit (Qiagen, Germany), according to the manufacturer’s protocol. Sequencing libraries were prepared using the ABclonal mRNA-seq Lib Prep Kit (ABclonal, China), according to the manufacturer’s protocol. The PCR products were purified using the AMPure XP system and evaluated for library quality on an Agilent Bioanalyzer 4150 system. Library sequencing was performed by Applied Protein Technology (Shanghai, China) on Illumina Novaseq 6000.

Published RNA-seq data of red panda small intestinal tissue were downloaded from the NCBI short read archive (SRR20591046, SRR20591080, and SRR20591081) and compared to the intestinal organoid data.

After removing the adapter sequences and filtering out low-quality reads (average base quality score <20 or >5% Ns), the obtained clean reads were mapped to the red panda reference genome ASM200746v1_HiC (based on the draft assembly ASM200746v1, https://www.dnazoo.org/assemblies/Ailurus_fulgens) using HISAT2 software with default parameters (Version 2.1.0).73 FeatureCounts (Version 2.0.2) with default settings was used to count the reads numbers mapped to each gene.74 Differentially expressed genes (DEGs) between groups were analyzed using DESeq2.75 DEGs with |log2 (Fold Change)| > 1.5 and Padj < 0.05 were considered significant. We used the clusterProfiler R software package (Version 4.0) for Gene Ontology (GO) function enrichment and the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis.76^,^77 The GO or KEGG function was considered significantly enriched at p < 0.05.

Single-cell RNA sequencing and bioinformatics analysis

Intestinal organoid single cells analysis was performed using the 10x Genomics Chromium single cell platform. Briefly, the red panda intestinal organoids (passage 3) were collected and detached into single cell suspension by adding TrypLE for 10 min (Gibco, UK). The cell suspension was filtered through a 40 μm cell filter. Single cells were loaded onto the 10x Genomics Chromium single cell platform and libraries were constructed using the Chromium Next GEM Single Cell 3′ Reagent kit v3.1 (10x Genomics, CA), according to the manufacturer’s protocol. Library sequencing was performed by Novogene (Beijing, China) on Illumina Xplus.

Basic statistical analysis of the raw reads quality was performed using fastp. Trimmomatic software (Version 0.40) was then used to process the raw reads the Illumina pipeline generated in the FASTQ format, removing low-quality reads (average base quality score <20 or >5% Ns) and adapter sequences to produce clean reads.78^,^79 Clean reads alignment and count quantification were performed using 10x Genomics Cell Ranger software with default parameters. (Version 3.1.0). Reads with low-quality barcodes and unique molecular identifiers (UMI) were filtered out according to the Cell Ranger default algorithms, and the remainder was mapped to the red panda reference genome (https://www.dnazoo.org/assemblies/Ailurus_fulgens). Double cells were screened using the DoubletFinder package with default parameters (Version 2.0).80 The Seurat software (Version 3.1.0) was used for secondary filtering of low-quality cells. Genes expressed in more than three cells were considered validly expressed, and only cells expressing at least 200 genes were retained for further analysis. The retained cells were then subjected to dimensionality reduction, clustering, and differential expression analysis based on Uniform Manifold Approximation and Projection (UMAP) and graph-based algorithm.50^,^81 The cell type of each cell cluster was identified in the CellMarker 2.082 according to its marker genes. Based on the expression patterns of genes, the Monocle 2 software package (Version 2.8.0) with default parameters was used to perform cell trajectory analysis of intestinal organoid cell lines to simulate the dynamic changes that occur during development.

Quantification and statistical analysis

The experimental data are expressed as the mean ± SD of three independent experiments. The Student’s t test (Figures 4 and 5) and one-way ANOVA (Figure 6) compared two or multiple groups, respectively. Statistical analysis and graphing were performed using carried in GraphPad Prism (Version 9) for Windows.

Animal tissue

In this study, all intestinal tissue samples (ileum) were collected from red pandas that had died naturally without intestinal diseases at the Chengdu Research Base of Giant Panda Breeding in Chengdu, Sichuan Province, China. All animal procedures followed the enforced guidelines and regulations and were approved by the Institutional Animal Care and Use Committee (IACUC) at Chengdu Research Base of Giant Panda Breeding (202015).

Bacterial strains

L. salivarius P103 strain that screened from panda feces with good biological characteristics, evident antibacterial effect, and no drug resistant genes, was studied in the red panda intestinal organoids culture to assess its potential use as a probiotic in red pandas. Klebsiella pneumoniae 28 strain that isolated from red panda feces was used to evaluate the probiotic effect of L. salivarius P103. Before co-culture with intestinal organoids, L. salivarius P103 and K. pneumoniae 28 were activated twice in MRS Medium (Haibo Bio-Technology, China) and Luria Broth medium (Haibo Bio-Technology, China), respectively.