Molecular Characterization of the Murine Catsper4 Promoter and its Regulation by CREMτ
Sergio Federico López-Guzmán, Diego Eduardo Sánchez-Jasso, Javier Hernández-Sánchez, Norma Oviedo, Rosa Maria Bermudez-Cruz
TL;DR
This study identifies how the Catsper4 gene, important for sperm function, is regulated by a protein called CREMτ in mice.
Contribution
The first functional analysis of the Catsper4 promoter and its regulation by CREMτ in mice is presented.
Findings
The Catsper4 promoter's core region spans from -99 to +63 bp relative to the TSS.
CREMτ binds to the Catsper4 promoter at a cAMP-responsive element, regulating its transcription.
Deletions in specific promoter regions enhance transcriptional activity.
Abstract
Cation channel sperm-associated protein 4 (CATSPER4) is a subunit of the sperm-specific cation/calcium channel, CatSper, located in the principal piece of the sperm flagellum. It is expressed during the late stages of spermatogenesis, and disruption of the gene encoding this protein leads to male infertility. Mutations in Catsper4 are linked to asthenozoospermia. However, the molecular mechanisms regulating Catsper4 expression remain unclear. Here, we present a detailed molecular characterization of the Catsper4 promoter in mice, focusing on the role of the cAMP-responsive element modulator isoform τ (CREMτ) in its transcriptional regulation. Analysis of publicly available metagenomic chromatin immunoprecipitation-sequencing (ChIP-seq) data revealed the presence of activation histone marks—H3K4me3, H3K4me1, and H3K27ac—within a region corresponding to the 631 bp predicted promoter,…
Genes, proteins, chemicals, diseases, species, mutations and cell lines named across the full text — each resolved to its canonical identifier and authoritative record.
Click any figure to enlarge with its caption.
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5- —http://dx.doi.org/10.13039/501100004881Instituto Mexicano del Seguro Social
Peer Reviews
No public reviews on file for this paper yet. If you reviewed it on a platform where reviews are public (OpenReview, ICLR, NeurIPS, ICML), you can paste yours below so the community can read it here.
Videos
No videos yet. Explain this paper in a talk, walkthrough, or lecture? Add one.
Taxonomy
TopicsSperm and Testicular Function · Erythrocyte Function and Pathophysiology · Connexins and lens biology
Introduction
CatSper is a cationic calcium channel localized in four lineal domains along the principal piece of the sperm flagellum. This channel is a molecular complex consisting of four principal transmembrane subunits (CATSPER1–4) and several auxiliary subunits (CATSPERβ, γ, δ, ε, ζ, θ, τ), along with an EF-hand calcium-binding domain 9. Disruption of any of these CATSPER subunits leads to the loss of the entire CatSper channel resulting in male infertility [1–11].
Expression of Catsper genes varies throughout spermatogenesis; Catsper2 is expressed at earlier, primary spermatocyte, stages whereas Catsper1, 3, and 4 are expressed at later stages, particularly in spermatids [1, 5–9]. Human CATSPER4 comprises 10 exons spanning a 12 kb region, whereas murine Catsper4 is 15.3 kb long and contains 11 exons. Catsper4 has six transmembrane regions (TM), with a voltage sensor in the 4th TM, similar to other Catsper members [6].
Catsper4 is specifically expressed in the testis, with mRNA expression detectable from postnatal day (PD) 20 onward. It is restricted to spermatid stages 1–8 in the adult testis and encodes a 442 amino acid protein that is initially localized to the acrosome of spermatids at stages 15–16 [12].
CATSPER4 is crucial for the formation of the CatSper channel and is stabilized by interactions with CATSPERθ and CATSPERβ. CATSPERη is located near CATSPERβ and may interact with CATSPERθ. Together, these subunits contribute to the formation of the monomeric CatSper channel [3].
Mice knocked out for the Catsper4 gene have normal spermatogenesis; however, they exhibit a disruption of sperm hyperactivation caused by low calcium entry into the sperm flagella [13, 14].
Notably, mutations in the functional domains of Catsper4 were reported in patients diagnosed with nonobstructive asthenozoospermia (NOA) [15]. In addition, expression data analysis for patients with NOA revealed that CATSPER4 is significantly associated with spermatogenesis in NOA, highlighting the potential of CATSPER4 as a diagnostic biomarker [16].
Although the crucial role of Catsper4 in the CatSper channel, sperm flagellum hyperactivation, and male fertility is well established, transcriptional regulation of the Catsper4 gene, particularly the identity of its minimal promoter region, remains poorly understood.
The cAMP response element binding A isoform (CREB-A) is a ubiquitous transcription factor essential for proper development and survival. In spermatogenesis, CREB-A is mainly expressed in Sertoli cells during early stages and is considered important for the survival of germ cells [17, 18].
CREMτ is a testis-specific activator isoform of cAMP-responsive element modulator (CREM). Crem knockout mice exhibit postmeiotic cell arrest and an increase in apoptotic germ cells, leading to male infertility. In these mice, approximately 90 genes involved in spermatogenesis and fertilization, including Catsper1–4, are downregulated. Moreover, cAMP-responsive element (CRE) sites were identified in the promoters of at least 35 of these genes [19–21].
Previous in vitro studies have shown that CREB-A and CREMτ regulate the CATSPER1 promoter [22]. Furthermore, CREMτ regulates the Catsper2 promoter both in vitro and in vivo [23]. These transcription factors belong to the bZip family, characterized by a basic domain, a leucine zipper region for a CRE site motif and DNA binding. Both CREB-A and CREM contain three activation domains (Q1, Q2, and KID) that facilitate transcriptional activation. Upon homodimerization, CREB and CREM specifically recognize CRE sites within the gene promoter regions, thereby recruiting the basal transcriptional machinery [24–28].
Overall, existing data indicate that CREB-A and CREMτ could play a critical role in the transcriptional regulation of Catsper4. In this study, we functionally characterized the murine Catsper4 promoter region. Our results indicate that both CREB-A and CREMτ transactivate the Catsper4 promoter. Notably, although the proximal CRE site within the promoter does not mediate activation by CREB, CREM binds to this site, both in vitro and in vivo, thereby enhancing the transcriptional activity.
Materials and Methods
Animals
C57BL/6 mice used in this study were propagated following animal protocol 0113 − 14, approved by the Internal Committee for the Care and Use of Laboratory Animals (CICUAL). The Unit for Experimentation and Production of Laboratory Animals (UPEAL) at the Center for Research and Advanced Studies (CINVESTAV), Mexico City, Mexico, organized the breeding and schedules to deliver mice. The mice were housed in clear plastic cages under controlled temperature and a 12-hour light/12-hour dark cycle, with unrestricted access to pelleted food and water.
All surgical procedures followed the ethical guidelines prescribed by CICUAL. Mice were euthanized via cervical dislocation and their abdomen was cut open using surgical scissors. The epididymal fat was pulled to expose the testes, which were then carefully extracted. The tunica albuginea was separated with a scalpel, and the testes were washed with cold 1X phosphate-buffered saline (PBS).
Chromatin-Immunoprecipitation (ChIP-seq) Data Analysis
ChIP-seq data obtained from the National Center for Biotechnology Information (NCBI) gene expression omnibus database (Table 1) were extracted in bedGRAPH format and visualized using the Integrated Genome Browser. The data were aligned to the mouse reference genome (mm9).
Table 1. ChIP-seq data obtained from the NCBI GEOHistone markCell stageAccess numberH3K4me3SpermatocytesGSM1202706SpermatidsGSM1202707H3K27acSpermatocytesGSM1202714SpermatidsGSM1202715H3K4me1SpermatocytesGSM1202711SpermatidsGSM1202712
RNA Extraction and Reverse Transcription-Polymerase Chain Reaction (RT-PCR)
pcDNA3-Cremτ was cloned as previously described [23]. Briefly, we performed RT-PCR of total RNA extracted from testis. PCR was performed using 1U of Phusion DNA polymerase (New England Biolabs), 200 mM dNTPs, 1x buffer HF, 0.2 µM primers and 1µL cDNA. A 1134 bp fragment of the CREM open reading frame (ORF) was cloned into the pJET 2.1 blunt vector (ThermoFisher Scientific) and then subcloned at the site BamHI-XhoI into the pcDNA3 expression vector (pcDNA3-Cremτ). To clone the transcription factor Creb-A, RT-PCR was carried out using RNA extracted from mice testis. Total RNA was isolated using the TRIzol^®^ reagent (Invitrogen), following the manufacturer recommendations. cDNA was synthesized using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). PCR was performed using 1U of Phusion DNA Polymerase (New England Biolabs), 200 mM dNTPs, 1x buffer HF, 0.2 µM primers (Table 2), and 1µL cDNA. Subsequently, the 996 bp fragment of the Creb-A ORF was cloned into the pJET 2.1 blunt vector, and then subcloned at the site HindIII-XhoI into the pcDNA6 expression vector to create pcDNA6-Creb-A. The putative transcription factor candidates were verified via sequencing with the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems).
Cloning of pProEX-1-Cremτ and Protein Purification
PCR was performed with 1U of NebTaqPol (NEB), 1X ThermoPol Buffer, 200 mM dNTPs, 0.2 µM of each primer (Table 2), and 50 ng of pcDNA3-Cremτ. The resulting 1135 bp fragment was cloned in pJET1.2 and then subcloned at the EcoRI-XhoI site into the pProEx-1 vector, with an N-terminal His-6-tag. The clones were confirmed via sequencing.
The pProEX-1-Cremτ plasmid was transformed into BL21-CodonPlus competent cells, which were subsequently cultured overnight in Luria-Bertani (LB) medium, containing 100 mg/mL ampicillin. The cells were diluted 100-fold in fresh medium, grown to an A_600_ of 0.8, and induced with 0.4 mM isopropyl-ß-D-thiogalactopyranoside for 2 h. The harvested cells were centrifuged, resuspended in 12.6 mL of Lysis Buffer (40 mM KH_2_PO_4_, 0.01% NP-40, 0.1 mM EDTA, 2580 mM NaCl, 10% glycerol, 10 mM 2-mercaptoethoanol, 0.5 mM PMSF and 300 µg/mL lysozyme), incubated on ice for 30 min, and sonicated. The lysate was then clarified by centrifugation at 11,000 × g for 30 min at 4 °C. His-6-tagged proteins in the supernatant were purified using nickel agarose affinity chromatography with Ni-NTA Agarose (Qiagen), following a modified protocol [29]. The collected fractions were resolved on a 10% SDS-PAGE gel and the gel was stained with Coomassie Brilliant Blue to assess protein purity. The purified fractions were concentrated using Amicon Ultra-15 (Sigma-Aldrich) per the manufacturer’s instructions. The buffer was exchanged for Storage Buffer (20 mM MOPS pH 7, 50 mM NaCl, 1 mM EDTA, 5% glycerol) by centrifugation with Amicon Ultra-15 before the protein preparations were stored at − 80 °C.
Table 2. Primers used in this work. The asterisk () indicates the FAM position. The mutated CRE site is in cursivesReactionNameSequence (5’−3’)Product Length (bp)TemplatesTranscription factor cloningCreb-A FwdAAGCTTATGACCATGGAATCTGGAGC996Testis RNACreb-A RevCTCGAGCGATCTGATTTGTGGCAGTAAAGGCrem-EcoRI FwGCGGAATTCCGATGAGCAAATGTGGCAG1135pcDNA3-Cremτ plasmidCrem-XhoI RevCTCGAGGCAACTGTACATGCTGTAATCAGPromoter cloningCat4F/−504GGGGTACCCATTACCCTGAGCTATACACTC633Genomic DNACat4R/+129CCCAAGCTTGCGACGAGGCTCTCTACCTTAGGCat4F/−99TGGGTACCTCATTATCTGCTTAGAATGTCTGGG162Cat4R/+64CCCAAGCTTGCTTGTGTTTTTCAGACATCTTTGC571,162Sequencing constructionsRVPrimer3CTAGCAAAATAGGCTGTCCCCAGpGL4.10Luc2RevGTCCCGTCTTCGAGTGGGTAGpGL4.10CMV FwdCGCAAATGGGCGGTAGGCGTGTpcDNA6BGH RevCCTCGACTGTGCCTTCTApcDNA6MutagenesisCat4-mCRE FwdCAGGTGGAGAACATAATAACAATAACCCTGGGCCCTAAGG4361pCat4-162 plasmidCat4-mCRE RevCCTTAGGGCCCAGGGTTATTGTTATTATGTTCTCCACCTGEMSACat4-CRE-FAM FwACATCGACATCACACACCTGCatsper4 core promoterCat4-CRE FwACATCGACATCACACACCTGCat4-CRE RvCAGGTGTGTGATGTCGATGTCat4-mutCRE FAM FwACATCGAGGCGGCACACCTGCatsper4* core promoterCat4-mutCRE RvCAGGTGTCCGCCGTCGATGTC + CRE Fw*GATTGCCTGACGTCAGAGAGCT Wu et al., 1998C + CRE RvAGCTCTCTGACGTCAGGCAATCChIP qPCRCat4ChIP FwGGACACAGCAAAGATGTCTGA96Genomic DNACat4ChIP RvCGACGAGGCTCTCTACCTTATranscription factor identificationKID FwCTGAATGAACTTTCCTCTGATGTGCC351cDNAQ2 RvCTTGGGGCAAGGTCAGTCTCCTRCrem FwTACTGCTTTGCCACAAGGTG87cDNATRCrem RvTTGCGAGTTGCTTCTTCTGCGapdh FwTGCACCACCAACTGCTTAG176cDNAGapdh RvGATGCAGGGATGATGTTCTG
Molecular Cloning and Sequence Analysis
To predict the promoter region of the murine Catsper4 gene, the Eukaryotic Promoter Database (EPD, https://epd.epfl.ch//index.php) was used. Specific primers (Table 2) were designed to amplify a 631 bp fragment of the putative promoter region of the murine Catsper4 (NCBI accession NC_000070.7 mouse genome mm39 from 133,954,566 to 133,955,197), including the transcription start site (+ 1; TSS). Genomic DNA from C57BL/6 mouse testes was PCR amplified using NebTaqPol (NEB). The 631 bp fragment was then cloned into the pJET 2.1 blunt vector and subcloned into the Photinus luciferase reporter vector pGL4.10 at KpnI/HindIII sites. Potential transcription factor-binding sites were predicted using PROMO (http://alggen.lsi.upc.es/cgi-bin/promo_v3/promo/promoinit.cgi?dirDB=TF_8.3) and TF-Bind (https://tfbind.hgc.jp). CpG islands were predicted using METHPRIMER (http://www.urogene.org/methprimer/). Sequence alignment was performed using ClustalX v2.1 (http://www.clustal.org/clustal2/).
Construction of Luciferase Reporter Plasmids
Constructs containing either 5′- or 3′-end deletions of the murine Catsper4 promoter were generated with primers Cat4F/−504, Cat4R/+129, Cat4F/−99, and Cat4R/+64 (Table 2). pCat4-633 served as the template for PCR amplification. The resulting fragments were cloned into the pJET 2.1 blunt vector and subcloned in the sense orientation of the luciferase gene into the KpnI and HindIII sites of the pGL4.10 vector. These plasmids were designated pCat4-568 and pCat4-163, respectively. pCat4-329 and pCat4-228 were generated using the XhoI site within pCat4-633 and pCat4-568, and the downstream HindIII site, respectively, to ligate to the new pGL4.10 vector. The sequence and cloning orientation in all the constructs were verified via automated DNA sequencing using the primers RVPrimer3 and Luc2Rev (Table 2).
Site-Directed Mutagenesis
The predicted CRE-binding site in the pCat4-228 plasmid was mutated using Cat4-mCRE Fwd and Cat4-mCRE Rv primers (Table 2), as described previously [23]. The resulting PCR product was treated with DpnI to digest the template DNA, transformed into competent E. coli DH5α cells, and subsequently confirmed via automated sequencing.
Cell Culture and Transfection
The GC-1 spg (Type B spermatogonia) cell line was cultured in DMEM (Sigma) supplemented with 10% fetal bovine serum, 5 U/mL penicillin, and 5 mg/mL streptomycin, and incubated in a humidified atmosphere with 5% CO_2_ at 37 °C. Before transfection, cells were seeded at a density of 1 × 10^5^ cells/well in a 24-well plate and allowed to reach 80% confluency. Transfections were performed using 500 ng of Catsper4 reporter plasmids with the K2^®^ Transfection System (Biontex), following the manufacturer’s instructions.
For cotransfections, a 1:1 ratio of Catsper4 promoter plasmids (250 ng) and either the CREMτ-expressing vector (pcDNA3-Cremτ, 250 ng) or the CREB-A-expressing vector (pcDNA6-Creb-A, 250 ng) was used, as indicated. pRL-CMV(0.4 ng) was included as a normalization vector. The pGL4.10-CMV vector, containing an active luciferase gene under a cytomegalovirus promoter (pCMV), served as the positive control, whereas the pGL4.10 vector alone was used as the negative control.
Luciferase Assay
Forty-eight hours post-transfection, cells were rinsed with sterile 1X PBS and lysed. Transcriptional activity was measured using the Dual-GLO Luciferase Assay System (Promega), following the manufacturer’s protocol. Relative luciferase activities were assessed using a Fluoroskan Ascent Reader (ThermoFisher Scientific). Background luciferase activity from the empty pGL4.10 vector was set as 1 unit, and the luciferase activity of constructs was normalized to the pRL-CMV activity and expressed as fold change relative to pGL4.10. Each construct was tested in three independent experiments, each performed in triplicate, and results are presented as mean ± SEM.
Immunodetection of CREMτ and CREB-A
Forty-eight hours post-transfection, GC-1 spg cells were collected for total protein extraction using RIPA solution with 1X cOmplete (Roche) and 1 mM PMSF. Protein concentration was determined using the Bradford assay (Bio-Rad). Protein extracts were resolved on a 10% SDS-PAGE gel and transferred onto a polyvinylidene difluoride membrane (Bio-Rad). The membrane was blocked with 5% ProPure milk (Amresco) in TBS-T buffer (Tris-buffered saline, 0.1% Tween 20) for 1 h. The membrane was then incubated overnight at 4 °C with primary antibodies diluted in blocking buffer: anti-CREM (Santa Cruz Biotechnology) at 1:1000, anti-His-6-Perioxidase (Roche) at 1:1000, and anti-GAPDH (Santa Cruz Biotechnology) at 1:3000. Thereafter, the membrane was incubated for 1 h with rabbit anti-mouse IgG polyclonal antibody conjugated to horseradish peroxidase (HRP) (Invitrogen) at a 1:3000 dilution. Target proteins were detected using Immobilon Forte Western HRP substrate (Millipore, Sigma).
Electrophoretic Mobility-Shift Assay (EMSA)
Purified CREMτ protein (3 µg) and 1 pmol of FAM-labeled double-stranded primers (Table 2), corresponding to the wild type (WT) or mutated CRE site in the Catsper4 promoter, were combined in a 20 µL reaction mixture prepared in 1X gel shift buffer (10 mM Tris-HCl pH 8, 50 mM NaCl, 0.5 mM DTT, 0.5 mM EDTA, 5% glycerol). The reaction was incubated for 30 min at 25 °C. For competition assays, a 100-fold excess of unlabeled double-stranded WT CRE site probe was added 15 min before the addition of labeled probe. To evaluate CREMτ binding, 1 µg of anti-CREM antibody (Santa Cruz Biotechnology) was included in supershift assays and incubated for 30 min at 25 °C, followed by the addition of the labeled probe. The resulting DNA–protein complexes were separated on a 5% nondenaturing polyacrylamide gel (74:1) in 0.5X TAE buffer at 140 V for 30 min. The complexes were visualized using a GelDoc Go Gel Imaging System (Bio-Rad).
ChIP Assay
We previously obtained DNA–protein complexes from the testes and liver of mice (n = 3) [23]. Briefly, cells were fixed in 1% formaldehyde for 30 min at room temperature, and then formaldehyde was neutralized with glycine. After thorough washing, the cells were sonicated to fragment DNA into 200–1000 bp fragments, reserving 10% of the fragments as input. DNA–protein complexes were immunoprecipitated by incubation with 2 µg of anti-CREMτ antibody (Santa Cruz Biotechnology) or an irrelevant IgG antibody against β-catenin (Santa Cruz Biotechnology) at 4 °C, overnight. Specific immune complexes were separated using protein G agarose beads (Santa Cruz Biotechnology) and eluted with salt. The crosslinks were broken and proteins were digested with proteinase K. DNA was purified using phenol-chloroform extraction. The binding of CREMτ to the Catsper4 promoter was established via PCR and qPCR with specific primers (Table 2). IgG and liver tissue were used as negative controls. Data are presented as mean ± SEM from three independent experiments.
Statistical Analysis
Statistical analysis was performed using the GraphPad Prism 6 software (GraphPad). Significant differences were assessed using one-way analysis of variance with Dunnett post hoc test and paired Student’s t-test. Data are presented as mean ± SEM (n = 9) from three independent experiments, each conducted in triplicate. A p-value less than 0.05 was considered statistically significant.
Results
Prediction of the Murine Catsper4 Promoter
The putative Cation channel sperm-associated protein 4 (Catsper4) promoter region was predicted using the Eukaryotic Promoter Database (EPD). A 633 bp region from − 504 to + 129 relative to the transcription start site (TSS [+ 1]), was identified as the putative promoter. To assess its functionality in vivo, publicly available ChIP-seq data for histone marks in mouse germ cells at different stages were analyzed for the Catsper4 promoter (Fig. 1). The activation mark H3K4me3 was enriched near the TSS in spermatids, but not in spermatocytes, indicating that the predicted promoter is functional at the spermatid stage, when the expression of Catsper4 starts. Furthermore, enhancer-associated marks H3K4me1 and H3K27ac were enriched at both the promoter and gene body, suggesting potential regulation of the Catsper4 gene by transacting elements from distal regions, which requires further validation. These data suggest that the murine Catsper4 promoter is localized in this region. Therefore, based on these data, the region from − 504 to + 129 relative to the TSS was selected for further transcriptional analysis.
Fig. 1. The predicted Cation channel sperm-associated protein 4 (Catsper4) promoter is functional and stage-dependent in vivo. Analysis of histone-mark patterns at the mouse Catsper4 locus (coordinates: 133768000–133782000) based on available chromatin immunoprecipitation-sequencing (ChIP-seq) data from mouse germ cells. The ChIP-seq data for H3K4me3 (green), H3K27ac (blue), and H3K4me1 (red) in spermatids and spermatocytes were analyzed as described in materials and methods. Signals are represented as peaks. The gray wide line represents the Catsper4 gene whereas the black line and rectangles represent the structure of the murine Catsper4 gene. The gene direction runs from right to left; the black dashed line indicates the transcription start site. The viewing window is represented from 133,766,600 to 133,378,422
Identification of the Regulatory Elements of the Murine Catsper4 Promoter
The sequence of the putative Catsper4 promoter, encompassing the 633 bp region, was obtained from the National Center for Biotechnology Information (NCBI), and further analysis was performed to identify potential regulatory elements. The proximal promoter region of Catsper4 did not contain a TATA box, CCAAT consensus box, or a DPE site close to the TSS. Additionally, no CpG island was detected within the promoter using the METHPRIMER software. Prediction using PROMO and TF-Bind revealed several transcription factor-binding sites around the TSS, including those relevant for spermatogenesis, such as SOX, CTCF, and CRE (Fig. 2A and B).
Fig. 2. The Catsper4 core promoter spans from − 99 to + 64 relative to the transcription start site (TSS). (A) Putative Catsper4 promoter predicted with Eukaryotic Promoter Database (EPD). The sequence extracted from the mouse mm39 genome (133954566 to 133955198) is illustrated. The red arrow indicates the TSS, blue letters mark Catsper4 exon 1, and primer alignment sequences for plasmid construction are highlighted in gray. The XhoI site used for cloning is enclosed within a blue dashed box. Putative transcription factor-binding sites related to spermatogenesis are underlined with their corresponding names (see below). (B) A 633 bp region (− 504 to + 129) containing the putative Catsper4 promoter was cloned upstream of the luciferase reporter gene into a promoterless vector pGL4.10 [Luc2]. Transcription factor sites are approximately located above the Catsper4 promoter. (C) Plasmids containing the putative Catsper4 promoter or its 5′- or 3′-deleted versions, or both, were cotransfected into GC-1 spg cells with pRL-CMV as an endogenous control to normalize the data. GC-1 spg cells were harvested and lysed after 48 h for luciferase assays. The luciferase activities represent fold-change relative to the activity of the empty vector and are expressed in relative units, defined as the ratio of Photinus luciferase to Renilla luciferase activities. Data represent mean ± SEM (n = 9) of values from three independent experiments, each performed in triplicate. One-way analysis of variance with Dunnett test was used to identify significant differences (*p < 0.05, **p < 0.01, and ***p < 0.001). The cloned regions are numbered according to the TSS (+ 1), and the predicted SOX, CTCF, and CRE sites are indicated by gray, white, and black boxes, respectively. The constructs were transiently transfected into GC-1 spg cell lines
Molecular Cloning and Transcriptional Activity of the Putative Murine Catsper4 Promoter Regions
The putative Catsper4 promoter was cloned upstream of the luciferase reporter gene into the promoterless pGL4.10 reporter, resulting in the generation of the pCat4-633 construct. Additionally, deletion fragments were generated from pCat4-633 via polymerase chain reaction (PCR) and subcloned into the pGL4.10 reporter vector to identify the minimal promoter sequence of Catsper4 with transcriptional activity. These constructs were transiently transfected into GC-1 spg cells and then luciferase activities were measured. The luciferase activity assays revealed no significant difference in activity between pCat4-633 and the promoterless pGL4.10 (Fig. 2C), indicating that this region either lacks transcriptional activation sequences or contains repressive elements. Notably, deletion of 65 bp from the 3′-end (pCat4-568) resulted in a two-fold (200%) increase in transcriptional activity compared with that of the pCat4-633 and the promoterless vector pGL4.10. A further 239 bp deletion from the 5′-flank (pCat4-329) led to a 4.4 (440%)-fold increase in luciferase activity, whereas the pCat4-163 construct, which contained a 166 bp deletion, exhibited a 4.8 (480%)-fold increase compared with the activity of the putative Catsper4 promoter and the promoterless vector. These results indicated that the functional promoter of Catsper4 is located between − 504 and + 64 relative to the TSS, with a potential repressive element located in the 3′-region of the sequence. Moreover, the minimal Catsper4 promoter sequence required for basal transcriptional expression in GC-1 spg cells was found to be localized between − 99 and + 64. CREMτ and CREB-A enhance the transcriptional activity of the Catsper4 promoter
CREMτ and CREB-A Enhance the Transcriptional Activity of the Catsper4 Promoter
In silico analysis of the basal Catsper4 promoter region plus the deleted 3′-end region (− 99/+129) revealed the presence of a CRE-binding site (Fig. 2A). Furthermore, this CRE site was conserved across mice, rats, and humans, as demonstrated by the multiple sequence alignment of this region (Fig. 3A). This suggested that CREM/CREB transcription factors regulate the Catsper4 promoter. To investigate the role of this family in Catsper4 regulation, a series of plasmids were constructed and tested for transcriptional activity. A construct containing the Catsper4 basal promoter and the CRE site, referred from now as core promoter, (pCat4-228) was created, and the CRE site was mutated via site-directed mutagenesis to generate a mutant construct (pCat4-mCRE) (Fig. 3B). The promoter activity of both the constructs was then analyzed in GC-1 spg cells. To further investigate the importance of two key CREM/CREB family members in Catsper4 regulation, plasmids expressing Cremτ or Creb-A (only expressing the exons) were cotransfected with either the wild-type (WT) or mutated promoter-bearing constructs. Recombinant proteins were overexpressed in GC-1 spg cells, and the expression was confirmed via western blotting using specific antibodies (Fig. 3C and Online Resource 1a).
Fig. 3CREMτ regulates the Catsper4 promoter. (A) Sequence alignment from − 50 to + 200 region of the human, mouse, and rat Catsper4 promoters was performed using Clustal X; the putative CRE site is labeled with a black line. The TSS (+ 1) for human, mouse, and rat are indicated in red boxes. (B) Primer designed for the mutation of the CRE site in the Catsper4 promoter (C) Total protein from GC-1 spg cells transfected with the Cremτ (overexpression) construct or nontransfected (control) cells was analyzed via western blotting. In upper panels, CREM signals were detected; in lower panels, GAPDH was detected as a loading control. Transfection experiments were performed in triplicate. (D) pCat4-228 and derived mutant mCRE plasmids were transiently cotransfected with pCREMτ (pcDNA3-Cremτ) into GC-1 spg cells, and the cells were harvested for luciferase assays after 48 h. The luciferase activities represent the fold change over the activity for the pCat4-228 construct. Data indicate mean ± SEM (n = 9) of values from three independent experiments, each performed in triplicate. One-way analysis of variance with Dunnett test was used to detect significant differences (*p < 0.05, **p < 0.01, and # no difference). Significant differences were determined relative to the basal activity for pCat4-228
Overexpression of either CREMτ or CREB-A in GC-1 spg cells led to a 2.05 (205%)- and 1.40 (140%)-fold increase in the transcriptional activity of pCat4-228, respectively (Fig. 3D and Online Resource 1b). These results indicated that these transcription factors play a role in activating the murine Catsper4 promoter. Notably, mutation of the CRE site resulted in a 1.54 (154%)-fold increase in pCat4-228 promoter activity, indicating a repressive role for this site in premeiotic cells (GC-1 spg cells). Moreover, the enhanced activity of the CRE mutant was not modified when CREMτ was overexpressed probably because of the mutation of the specific CRE target site (Fig. 3D). Additionally, cotransfection with CREB-A led to a reduction in the transcriptional activity of the mutated Catsper4 promoter (Online Resource 1b). These findings indicated that CRE sites play a crucial role in the regulation of this construct.
CREMτ Binds to the Catsper4 Core Promoter In Vitro and In Vivo
Previous reports indicate that CREMτ regulates the Catsper4 promoter activity, likely by binding to specific sites within the core promoter. To investigate this further, electrophoretic mobility shift assay (EMSA) was conducted using purified bacterial recombinant CREMτ and corresponding FAM-labeled probes containing either the WT or mutated CRE site predicted in the core promoter of the murine Catsper4 gene. CREMτ bound specifically to the WT probe, as evident from the competition assays, but not to the mutated CRE probe (lanes 2, 3, and 4, respectively). In supershift assays and using BSA as a negative binding protein control, incubation with the WT CRE probe and anti-CREM antibody confirmed that this binding was mediated by CREMτ (lanes 5 and 6). A previously reported probe containing a consensus CRE site of the rat somatostatin gene [30] was used as a positive control for CREMτ binding (lanes 7 and 8) (Fig. 4). These results indicated that CREMτ binds to the core promoter of the Catsper4 gene in vitro through the predicted CRE site (+ 91 from the TSS).
Fig. 4CREMτ binds to the murine Catsper4 promoter in vitro through the predicted CRE site. EMSA was performed by incubating the FAM double-stranded oligonucleotide corresponding to the wild-type (WT) CRE site or the C + alone (lanes 1 and 7) or with the recombinant purified CREMτ protein (lanes 2, 3 5, and 8). Nonlabeled CRE probe was added in a 100-fold excess for competition (lane 3). A labelled mutated CRE probe was incubated with the purified CREMτ protein (lane 4). Supershift assay was performed with 1 µg of anti-CREM antibody (lane 5). BSA was used as a negative control for the WT CRE probe (lane 6). Finally, DNA–protein complexes were resolved by electrophoresis on a 6% nondenaturing polyacrylamide gel (n = 3)
As CREMτ specifically recognizes the predicted CRE site on the promoter of the Catsper4 in vitro, ChIP assays were carried out to evaluate the in vivo interaction of CREMτ with the Catsper4 core promoter with specific primers (Fig. 5A). Testicular or hepatic fragmented DNA chromatin was precipitated with anti-CREMτ or irrelevant anti-β Catenin (IgG) followed by PCR.
Fig. 5CREMτ binds to the murine Catsper4 promoter in vivo. ChIP assays detected enrichment in fragmented testicular chromatin immunoprecipitated with anti-CREMτ. β-catenin antibody was used as a negative isotype (IgG) control, whereas the liver chromatin was a nonspecific target binding control. Input DNA represents total chromatin. (A) Primers designed to amplify a specific Catsper4 core promoter region containing the predicted CRE site are shown and (B) ChIP-PCR products were amplified with Cat4ChIPFw and Cat4ChIP4Rv primers and separated on a 1.5% agarose gel (n = 3). (C) and (D) ChIP-qPCR detected the enrichment of DNA fragments in samples immunoprecipitated with anti-CREMτ. Data indicate mean ± SEM (n = 9) of values from three independent experiments, each performed in triplicate. Paired Student’s t-test was used to detect significant differences (*p < 0.05, **p < 0.01, and # no significance)
ChIP results for the whole testis revealed the amplification of a specific region from the Catsper4 core promoter bound to CREMτ. No signal was detected in the control β-Catenin or the liver sample (Fig. 5B). Additionally, ChIP-qPCR analysis showed increased binding of CREMτ to the Catsper4 promoter in the testis compared with that for the irrelevant IgG control (paired Student’s t-test, p < 0.05). Some degree of CREMτ binding was detected in the liver and was taken as background (Fig. 5C and D). These results illustrate that CREMτ binds in vivo to the murine Catsper4 core promoter in a tissue-specific manner, thereby supporting its role in Catsper4 promoter regulation.
Discussion
The CatSper channel, located in the principal piece of the sperm flagella, is essential for male fertility in both mice and humans [31]. The Catsper4 gene is one of the key subunits, encoding a 442 amino acid protein [6]. Mutations in functional domains of the Catsper4 gene are linked to asthenozoospermia, a condition characterized by reduced sperm motility [15]. Therefore, understanding the molecular mechanisms that control the transcriptional regulation of Catsper4 is crucial for exploring its potential correlation with male infertility. We report, for the first time, the murine Catsper4 promoter and describe the plausible mechanism for its tissue-specific expression.
Epigenetic modifications, including DNA methylation, remodeling of chromatin, and histone modifications, are essential for sperm development as they regulate the expression of genes involved in the development of the male reproductive system, sperm production, and maturation [32, 33]. Histone modification patterns change dynamically during spermatogenesis. Low levels of the repression mark H3K4me1 and moderate levels of the activation mark H3K4me3 are present in spermatids [34]. Furthermore, approximately 5000 promoters and enhancers are modified by the H3K4me3 mark at the round spermatid stage. Also, H3K27ac levels increase at this stage and 76% of this mark correlates with H3K4me3 [35]. This suggests an important role of these epigenetic marks in the regulation of haploid genes, such as Catsper4. Given that many genes are epigenetically regulated during spermatogenesis, we first examined the chromatin landscape around the region of the murine Catsper4 gene throughout spermatogenesis. Analysis of the available ChIP-seq-metadata for diverse transcriptional-related histone marks showed that the Catsper4 promoter region is active at the spermatid stage but not in spermatocytes. H3K4me3 is highly enriched at the transcription start site (TSS) and its role in promoting transcriptional initiation has been widely documented [36]. This enrichment is observed in the predicted promoter of the murine Catsper4 gene. H3K27ac and H3K4me1, which are related to active enhancers and enhancer priming [reviewed in 31], are found surrounding the TSS and in the gene body of the Catsper4 gene, respectively. These patterns are consistent with those in the spermatid stage, whereas no peaks for these epigenetic signatures were detected in spermatocytes. This is consistent with the previously reported expression pattern for the Catsper4 gene [37]. A putative 633 bp promoter, which includes exon 1, was identified using the Eukaryotic Promoter Database (EPD). Notably, exon 1 apparently plays an important role in the transcriptional regulation of the murine Catsper1 and Catsper2 genes [23, 38]. Furthermore, this putative promoter aligns with the previously identified region of the activation-related histone marks. Analysis of the Catsper4 gene putative promoter revealed the absence of consensus promoter elements, such as TATA, CCAAT, and DPE. In addition, no CpG island was detected, consistent with the reported promoter analysis of the Catsper1 and Catsper2 murine genes, which also lack these transcription elements and are classified as TATAless promoters. Although the Catsper2 gene promoter was predicted to contain a CpG island, whole-genome-bisulfite-sequencing results ruled out its relevance. The transcriptional activity analysis of the putative promoter constructs revealed that the core promoter of Catsper4 consists of a 163 bp region from − 99 to + 64. Unlike the minimal promoters of Catsper1 (− 287 to + 107) and Catsper2 (− 54 to + 189), the Catsper4 core promoter does not contain exon 1, making it the shortest among all the characterized Catsper gene promoters [23, 38].
Transcription factors are essential for gene expression, and the binding sites for promoter regulation are often conserved across species [39, 40]. SOX, CTCF, and CRE sites were predicted on the murine Catsper4 gene promoter. The CTCF and CRE sites are located near the TSS of the Catsper4 promoter and are conserved among humans, rats, and mice. A previous study in haploid germ cells found that CRE sites are located over an approximately 150 bp region around the TSS, with 40% of these sites being half-CRE wherein only half of the bases of the CRE consensus site are present [41]. This is the case for the predicted CRE site on the Catsper4 gene promoter, which is a half-CRE at + 91 with respect to TSS. Deletion of the region containing the CRE site activated the murine Catsper4 promoter, suggesting that these transcription factors may play a regulatory role in Catsper4 expression. A similar observation was made for the murine Catsper2 promoter, wherein deletion of the CRE site (+ 152) increased the transcriptional activity [23]. Repressor isoforms of CREM, such as CREMα and CREMβ, are expressed in premeiotic stages such as spermatogonia, and probably in GC-1 spg cells (Online Resource 2) [42], and thus, deletion of the CRE site may increase the transcriptional activity by removing their repressive effect.
CREMτ, the activator isoform of CREM, regulates the expression of several genes, including Catsper1 and Catsper2, during spermatogenesis [22, 23, 43, 44]. Overexpression of CREMτ enhanced the transcriptional activity of the wild type Catsper4 promoter, but no increase was observed for the promoter when the CRE site was mutated. These results suggest that during the early stages of spermatogenesis, such as in spermatogonia (e.g., GC-1spg cells), repressor isoforms of CREM may bind to the CRE site within the Catsper4 promoter. In later stages, such as in spermatids, the activator isoform CREMτ likely displaces these repressors, thereby promoting Catsper4 gene expression.
EMSA results confirmed the specific binding of CREMτ to the Catsper4 promoter through the predicted CRE site. Notably, CREMτ also binds to the core promoter of the Catsper4 gene in vivo, as evident from ChIP assays. The role of CREMτ in the regulation of Catsper1 and Catsper2 has been previously reported [22, 23]. Our results strongly suggest that CREM proteins, especially CREMτ, regulate the Catsper4 gene promoter, highlighting the importance of these transcription factors in the regulation of the Catsper gene family.
The molecular mechanisms characterized in this study may contribute to cell-specific regulation throughout spermatogenesis, as both CREMτ and Catsper4 are expressed in postmeiotic stages. However, further research is required to validate this hypothesis, as no cell line with postmeiotic germ cell characteristics is currently available.
Conclusions
This study provides the first evidence for transcriptional regulation of the Catsper4 gene in a murine model and spermatogonia cells. Our results indicate that the Catsper4 gene promoter is epigenetically regulated via histone modifications. We also show that CREMτ increases the transcriptional activity of the minimal Catsper4 gene promoter. Finally, we show that CREMτ binds the predicted CRE in vitro and to the core promoter in vivo as well, indicating direct activation of the Catsper4 gene expression by CREMτ.
Supplementary Information
Below is the link to the electronic supplementary material.Supplementary Material 1(PNG 138 KB)Supplementary Material 2Supplementary Material 3
The reference list from the paper itself. Each links out to its DOI / PubMed record.