RNA-binding protein tristetraprolin inhibits Th2 cell activation and differentiation in allergic rhinitis by promoting TRIM18 mRNA decay

TL;DR

The RNA-binding protein TTP reduces Th2 cell activity and nasal inflammation in allergic rhinitis by breaking down TRIM18 mRNA.

Contribution

This study reveals a novel mechanism by which TTP inhibits Th2 cell differentiation through TRIM18 mRNA destabilization in allergic rhinitis.

Findings

TTP overexpression in AR mice reduced nasal inflammation and Th2 cytokine levels.

TTP binds to TRIM18 mRNA's 3′UTR, decreasing its stability via a Cys-139-dependent mechanism.

TRIM18 overexpression counteracts TTP's inhibitory effects on Th2 cell activation.

Abstract

Tristetraprolin (TTP), which encodes an RNA-binding protein, was identified as a biomarker in three types of IgE-driven allergic tissues. Remarkably, in the nasal mucosa of the ragweed pollen-induced AR mouse model, TTP mRNA levels were increased approximately threefold. TTP overexpression in AR mice alleviated nasal inflammation and epithelial barrier damage, accompanied by reduced frequency of nasal spray and nasal friction, eosinophils/neutrophils/macrophages/goblet cells infiltration, and Th2 cytokines interleukin (IL)-4, IL-5, and IL-13 secretion. The impact of TTP on the activation and differentiation of Th2 cells was assessed by utilizing naïve CD4 T cells isolated from mice. We found that TTP significantly suppressed Th2 activation and differentiation, as evidenced by the decreased levels of cytokines and the percentage of Th2. Transcriptomic profiling of CD4+ T cells (with/without TTP overexpression) was analyzed, and 14 down-regulated genes containing AU-rich elements (AREs) were obtained. The study concentrated on downregulated E3 ubiquitin ligase tripartite motif 18 (TRIM18) in TTP-overexpressed CD4+ T cells. Specifically, TTP protein bound to the ARE located at positions +3640 to +3644 (5′-UAUUU-3′) within the 3′UTR of mouse TRIM18, and this interaction reduces TRIM18 mRNA stability, a process that depends on the active-site residue Cys-139 within the second CCCH-type zinc finger motif of TTP. TRIM18 overexpression weakened the effects in CD4+ T cells induced by TTP overexpression. Collectively, TTP suppresses Th2 activation and differentiation in AR by modulating TRIM18 mRNA stability, highlighting their interaction as a critical pathway in allergic inflammation.

Figures

Full text

Allergic rhinitis (AR) is an immunoglobulin E (IgE)-mediated inflammatory disorder triggered by inhaled allergens, characterized by symptoms including nasal rubbing, sneezing, and nasal pruritus (1). Allergic reactions consist of two key phases: the IgE-dependent sensitization phase and the allergen-specific type 2 T helper (Th2) cytokine-driven effector phase (2, 3). A hallmark of the late-phase allergic response is the infiltration of inflammatory cells, particularly Th2 lymphocytes, into the nasal mucosal tissue (4). Pro-inflammatory cytokines secreted by Th2 cells, such as interleukin (IL)-4, IL-5, and IL-13, elicit inflammatory infiltration and drive aberrant immune responses in AR (5). AR, asthma, and atopic dermatitis are collectively classified as IgE-mediated allergic disorders, sharing the common feature of mucosal inflammation mediated by activated immune cells (6). Thus, modulating Th2 cell differentiation has emerged as a promising therapeutic strategy for AR and other IgE-associated allergic diseases.

CCCH-zinc finger proteins are intimately involved in mRNA metabolism, specifically in the degradation of cytokine mRNAs, and have crucial roles in the regulation of cytokine production, immune cell activation, immune homeostasis, and antiviral innate immune responses (7). Tristetraprolin (TTP, also known as ZFP36) is an RNA-binding protein (RBP) belonging to the highly conserved family of Zinc-finger proteins (8). TTP mediates the decay of labile mRNAs by recognizing conserved cis-regulatory AU-rich elements (AREs) in their 3′UTRs, a function structurally supported by its two tandem CCCH-type zinc-finger motifs (9). For instance, TTP accelerates the degradation of cAMP-response element-binding protein (CREB) binding protein (CREBBP) mRNA via binding to its 3′UTR AREs, thereby regulating ischemia-reperfusion-induced pulmonary inflammation and lung injury (10). Conversely, TTP also exerts a stabilizing effect on the cystic fibrosis transmembrane conductance regulator (CFTR) through its ARE-binding activity (11). Mutation of any zinc-coordinating residue in either zinc finger abrogates TTP's RNA-binding capacity and its ability to promote mRNA decay (12). Notably, TTP knock-in mice harboring a cysteine-to-arginine mutation in the first zinc finger develop severe inflammatory syndromes (13), indicating that TTP's inflammatory regulatory function is tightly linked to its RNA-binding activity (14). TTP has the potential to mitigate inflammatory responses by inducing the mRNA decay of pro-inflammatory cytokines such as TNF-α and CXCL2 (15, 16), thus serving as a mechanistic target for anti-inflammatory agents and being implicated in various immunological diseases, for example, resolving acute inflammation during sepsis by downregulating CD38 expression (17). TTP is ubiquitously expressed across tissues but maintains extremely low basal levels; upon stimulation, however, its mRNA and protein expression are rapidly upregulated (18). TTP exhibits cell-type-specific expression patterns and exerts critical functions in immune-competent cells, such as dermal fibroblasts (key producers of inflammatory mediators in psoriasis) (19). It has been demonstrated that TTP downregulates the expression of Th2-type cytokines (including IL-5 and IL-13) in lymphoid cells (20). Despite these insights, the specific function and molecular mechanism of TTP in AR, particularly its regulation of Th2-mediated type 2 inflammation, remain poorly characterized. Thus, the present study aimed to clarify the role of TTP in AR, with a focus on its association with Th2-driven inflammation.

As mentioned above, TTP is recognized as a crucial post-transcriptional regulator of inflammation. For example, TTP-mediated glyoxalase II (GLO2) mRNA decay regulates inflammatory phenotypes in innate immune cells, a process that is abrogated by mutation of TTP-binding sites or overexpression of GLO2 in vivo (21). Therefore, in the present study, we first identified mRNAs controlled by TTP in CD4^+^ T cells isolated from AR mice, which will indeed help to understand the underlying mechanisms in AR. TRIM18 (also known as Midline 1) is an E3 ubiquitin ligase of the tripartite motif (TRIM) subfamily of RING-containing proteins (22). TRIM18 plays a crucial role in modulating the efficiency of the translation machinery with possible implications in various immune diseases (23). TRIM18 knockout mice exhibit reduced numbers of total T cells and CD4+ T cells in the central nervous system due to inhibited T cell migration, which is associated with an inactive mTOR signaling pathway (24). Additionally, TRIM18 modulates proinflammatory responses through the regulation of NF-κB, JNK, and p38 signaling pathways (25). Knockdown of TRIM18 decreases the levels of Th2-type cytokines (IL-5 and IL-13) by enhancing protein phosphatase 2A (PP2A) activity, thereby attenuating allergen- and rhinovirus-induced allergic airway inflammation (26). However, the functional role of TRIM18 in AR remains unreported, and whether the TTP-TRIM18 axis contributes to AR pathogenesis requires further investigation.

In the present study, our findings demonstrated that upregulating TTP expression via TTP administration in ragweed pollen (RW)-sensitized AR mice attenuated allergic inflammation and nasal symptoms, while suppressing Th2 cell differentiation. Further mechanistic investigations revealed that the anti-inflammatory effects of TTP were mediated by targeting TRIM18 mRNA. Specifically, TTP protein binds to the ARE located at positions +3640 to +3644 within the 3′UTR of mouse TRIM18. This interaction reduces TRIM18 mRNA stability, a process that depends on the active site Cys-139 within the second CCCH-type zinc finger motif of TTP. Collectively, our results uncover a novel regulatory role of the TTP-TRIM18 axis in AR pathogenesis, thereby providing a promising candidate target for the development of AR therapeutics.

Results

TTP expression increased in response to IgE-mediated inflammation, especially in allergic rhinitis

IgE-mediated allergic diseases, including allergic asthma, allergic rhinitis, and atopic dermatitis, commonly co-occur with similar pathogenic mechanisms (27). First, we collected transcriptome data of IgE-mediated diseases, then analyzed DEGs in each dataset by comparing the disease tissues and corresponding normal tissues (Fig. 1A). Among these, allergic rhinitis induced the most extensive transcriptomic changes, with 1194 DEGs. Using the RRA algorithm, we further analyzed upregulated genes across the three diseases, calculating a comprehensive score for each gene to assess significance. A scatter plot highlighted four genes (shown as red plots) consistently upregulated with high ranks, suggesting their key roles in IgE-mediated allergic reactions. One of them, the TTP gene (RRA score = 0.03 and Frequency = 4), attracted our attention due to encoding a classical RNA-binding protein (Fig. 1B). TTP played a pivotal role in maintaining the transcriptome associated with immunological responses and inflammatory diseases through post-transcriptional regulation (14). Based on the current data, TTP was also the only gene encoding a CCCH-ZF-type protein that was upregulated in the nasal mucosal tissues of the allergic rhinitis model (Fig. 1C). Additionally, the mouse TTP protein shows high evolutionary conservation, particularly within the CCCH-ZF repeats (Fig. 1D).Figure 1**The highly expressed TTP was identified as a crucial factor in response to the IgE-mediated inflammatory syndrome.**A, the robust rank aggregation (RRA) algorithm integrated upregulated genes (Log_2_Foldchange>1 and p < 0.05) from three datasets of three IgE-mediated inflammatory syndromes (allergic rhinitis, asthma, and atopic dermatitis) and their corresponding normal samples. B, the ranking graph displayed the genes that were upregulated in at least two datasets. Among them, the genes corresponding to the red dots (Frequency = 3) showed a significant increase in all three disease datasets, including TTP. C, intersection of the genes encoding CCCH-ZF (zinc finger)-type proteins with the genes upregulated in the nasal mucosa of patients with allergic rhinitis. D, the assessment of evolutionary conservation of amino acid positions, especially two CCCH-ZF repeat regions, in the mouse TTP protein. Conservation scores ranged from 1 to 9, where one was the most highly variable, five was of intermediate conservation, and nine was the most highly conserved position. E, experimental scheme of ragweed pollen (RW)-induced AR model, divided into the sensitization stage (0 and 7 days) and the stimulation stage (14–17 days). The control mice were treated with PBS instead of RW (N = 6 per group). F, relative RNA expressions of TTP in nasal tissues of RW-induced AR mice and control mice. G, compare the frequencies of sneezing and nose-rubbing within 10 min between control mice and AR mice after 14 days. H, immunofluorescence staining of TTP protein (red) and CD4 protein (green) was performed in normal and RW nasal tissues. DAPI (blue) was used for nuclear staining (Scale bar = 50 μm). I, quantitative analyses of CD4^+^ T cell percentages and TTP fluorescence intensity in nasal mucosal tissues from sham and AR model mice. Data are shown as means ± SD (N = 6), Student's t test was used for statistical analysis of control mice and AR mice.

To study the involvement of TTP in AR, we established a murine model of RW-specific AR within 17 days, as shown in Figure 1E. Nasal mucosa tissues from RW-specific AR mice or PBS-treated control mice were used to assess the levels of TTP. Consistent with the transcriptome analysis, the TTP mRNA level was increased in the nasal mucosa of RW-induced AR mice (Fig. 1F). Compared with PBS-treated control mice, RW-challenged mice showed a significant increase in the frequency of sneezing and rubbing, which suggested that the RW challenge induces immediate-type AR (Fig. 1G). Immunostaining with anti-TTP and anti-CD4 antibodies was performed to characterize TTP expression and distribution in infiltrating cells. As shown in Figure 1H, TTP was expressed in CD4-positive T cells but was not restricted to these cells. Quantitative analysis revealed that CD4-positive T cells were recruited to the nasal mucosa in AR mice, and the fluorescence intensity of TTP in CD4-positive T cells was significantly higher in AR mice than in non-allergic controls (Fig. 1I). These data suggested that TTP was a biomarker of IgE-mediated inflammatory syndrome, with its upregulation in AR potentially contributing to T cell regulation.

TTP alleviated nasal allergic symptoms and improved epithelial barrier function of RW-induced AR mice

To investigate the role of TTP in AR, mice were intranasally administered TTP-overexpressed lentivirus 2 h before RW challenge on day 14 (Fig. 2A). Enhanced TTP mRNA expression was further confirmed by real-time PCR (Fig. 2B). We performed the TTP-CD4 double immunofluorescence staining of the nasal mucosa from lentivirus-infected AR mice. These results showed that TTP overexpression did not alter T cell recruitment but significantly increased TTP levels within T cells, confirming T cells as a key target of the lentivirus in vivo (Fig. S1, A–C). Compared to AR mice without virus infection or those infected with a control lentivirus, AR mice with TTP overexpression exhibited less frequent sneezing and nasal rubbing (Fig. 2, C and D). The elevated TSLP level (a key regulatory factor for the pathogenic mechanisms of AR) in nasal lavage solution had dropped by about half following TTP overexpression (Fig. 2E). Another important marker, histamine, had a similar change with TSLP, and TTP overexpression exhibited an obvious decline in histamine levels (Fig. 2F). The impact of TTP overexpression on pathologic changes was analyzed as indicated in Figure 2G. Upon examination of the nasal tissues, there was a significantly increase in the thickness of the nasal mucosa in the AR group compared to the control group. Importantly, the thickness of the nasal mucosa significantly decreased following TTP overexpression.Figure 2**TTP overexpression alleviated epithelial barrier dysfunction and nasal symptoms in AR mice.**A, experimental scheme of RW-induced AR mice with or without TTP overexpression by intravenous injection of lentiviral vectors (Lv-NC or Lv-TTP). B, Relative RNA expressions of TTP mRNA in collected nasal tissues from control mice, AR mice, AR mice with Lv-NC infection, or AR mice with Lv-TTP infection. C and D, fluctuation in the number of sneezes and nasal rubbings after TTP overexpression in AR mice. E, The nasal irrigation solution samples: the level of Thymic Stromal Lymphopoietin (TSLP, pg/ml). F, the serum samples: the concentration of histamine level (μmol/L). G, hematoxylin and eosin (H&E)-stained nasal mucosa tissue sections, showing normal and swollen nasal mucosa epithelial tissues (black arrows) and statistics on the thickness of nasal mucosa (Scale bar = 100 μm). Dashed lines indicate the boundary between the epithelial layer and lamina propria. Data are shown as means ± SD (N = 6). One-way analysis of variance (ANOVA) was used for statistical analysis of control mice, AR mice, and AR mice transduced with control vectors or TTP overexpression vectors.

The PAS staining analysis revealed an increased number of goblet cells and inflammatory cell infiltration in the mucosal area of AR mice, whereas lower numbers were found in mice intravenously injected with TTP overexpression lentivirus (Fig. 3, A and B). Total cell counts and numbers of eosinophils, neutrophils, macrophages, and lymphocytes in the nasal tissues were individually calculated and closely compared between the groups. In the RW-induced AR group, the number of these cells increased significantly compared to the control group. Moreover, overexpression of TTP reduced the number of infiltrating eosinophils (Fig. 3, C–G). All these data indicate that histological changes and the severity of nasal symptoms were suppressed when TTP was overexpressed.Figure 3**TTP overexpression reduced the hyperplasia of goblet cells and immune cells in AR mice.**A and B, periodic Acid-Schiff (PAS) stained nasal mucosa tissue sections, showing the number of PAS-positive goblet cell dysplasia (Scale bar = 50 μm and 100 μm). The typical positive cells in the 400× images were clearly labeled with uniform black arrows, and representative regions in the 200× images were marked with black rectangles. The number of infiltrated immune cells, including total BAL cells (C), eosinophils (D), neutrophils (E), macrophages (F), and lymphocytes (G), was analyzed from the nasal lavage fluid. Data are shown as means ± SD (N = 6). One-way ANOVA was used for statistical analysis of control mice, AR mice, and AR mice transducted with control vectors or TTP overexpression vectors.

Overexpression of TTP suppressed Th2 cell differentiation and Th2-type inflammatory responses both in vitro and in vivo

Given the high co-expression of TTP and CD4, a T-cell marker, in nasal mucosal samples, we further hypothesized that TTP participates in the T-cell-mediated immune system, mainly Th2 inflammatory responses. Thus, we isolated splenocytes from four groups of mice: control mice, AR mice, AR mice infected with control vector lentivirus, and AR mice infected with TTP overexpression lentivirus (Fig. 4A). Firstly, the levels of Th2 cytokines, including IL-4, IL-5, and IL-13, were analyzed in cell supernatant by ELISA. Notably, upon TTP overexpression, the levels of these cytokines almost reverted to those of PBS-treated mice (Fig. 4B). The percentage of Th2 cells was increased in RW-induced AR mice, and TTP overexpression in AR mice decreased the proportion of Th2 cells, suggesting that TTP may participate in Th2 activation (Fig. 4C).Figure 4**TTP suppressed T helper 2 (Th2)-type inflammation in AR mice.**A, schematics of splenocytes isolation from AR-mice and the differentiation of splenic naive CD4+ T cells model in vitro. B, the levels of Interleukin (IL)-4, IL-5, and IL-13, which belong to the Th2 cytokine family, were measured by ELISA assays in the cell supernatant. The cell supernatant was collected from mononuclear cells of the spleen that had been treated with ionomycin and phorbol 12-myristate 13-acetate (PMA) for 6 h. C, after treatment with ionomycin, PMA, and GolgiPlug, the cells with the double stain of anti-CD4 and anti-IL-4-APC were detected by flow cytometry to analyze the percentage of Th2 cells. Data are shown as means ± SD (N = 3 or 6). One-way analysis of variance (ANOVA) was used for statistical analysis of control mice, AR mice, and AR mice transduced with control vectors or TTP overexpression vectors.

To elucidate the role of TTP in Th2 cell differentiation, we first isolated CD4+ T cells from healthy mice and induced their differentiation in vitro. The cells were treated with a combination of IL-4 and anti-IFN-γ, which act synergistically, for 72 h (Fig. 5A). The flow cytometry analysis results indicated that approximately 15% of CD4+ T cells differentiate into CD4^+^IL4^+^ Th2 subtype (Fig. 5B). Importantly, we found the upregulated TTP mRNA and protein levels in differentiated Th2 cells compared to splenic naive CD4+ T cells (Fig. 5C). The differentiated Th2 cells were successfully infected with TTP-overexpressed lentivirus (Fig. 5D). Overexpression of TTP significantly decreased the level of IL-5 (Fig. 5E) and the percentage of Th2 cells (Fig. 5F).Figure 5**TTP overexpression inhibited Th2 differentiation in vitro.**A, schematics of naive CD4+ isolation, activation, and Th2 differentiation. B, a representative flow cytometric plot and the percentage of Th2 cells was detected using flow cytometry. C, the protein and mRNA expression of TTP in CD4+ T cells. D, the protein and mRNA expression of TTP in Th2 cells after virus infection. E, the levels of IL-5 were detected using real-time PCR and ELISA, respectively, in Th2 cells after virus infection. F, the percentage of Th2 cells was detected using flow cytometry in Th2 cells after virus infection. Data are shown as means ± SD (N = 3). Student's t test and one-way ANOVA were used for statistical analysis.

TTP knockdown promoted nasal allergic symptoms by promoting Th2-type inflammation

We performed TTP knockdown experiments (using shRNA targeting TTP) in AR mice-aiming to mimic physiological low-expression states of TTP, and thus complement the overexpression data to clarify its endogenous function (Fig. 6A). The knockdown efficiency of TTP in nasal mucosa tissue was verified by RT-qPCR assays (Fig. 6B). We have added quantitative analyses of CD4^+^ T cell percentages and TTP fluorescence intensity based on the immunofluorescent staining of nasal mucosal tissues from AR model mice with LV-shNC or LV-shTTP infection. As shown in Figure 6, C and D, compared with the LV-shNC group, the fluorescence intensity of TTP in CD4^+^ T cells of the TTP knockdown group significantly decreased. Consistent with our overexpression results, TTP knockdown had no significant effect on T cell recruitment to the nasal mucosa (Fig. S1D). Functionally, TTP knockdown significantly aggravated allergic phenotypes in AR mice: specifically, it exacerbated nasal mucosal swelling (Figs. 6E, S1E), and increased the frequency of nose-scratching behaviors, including the number of sneezes and nose rubbing within 10 min (Fig. 6, F and G). To further confirm that these phenotypic changes were mediated by TTP knockdown in CD4^+^ T cells, we isolated splenocytes from RW + LV-shNC and RW + LV-shTTP mice (Fig. 6H) and detected Th2-related cytokine levels. As expected, TTP knockdown significantly elevated the secretion of IL-4, IL-5, and IL-13 (Fig. 6, I–K). This further confirms that the promotion of Th2 polarization by TTP deficiency is closely associated with the pathological features of AR.Figure 6**TTP knockdown exacerbated allergic phenotypes and promoted Th2-type inflammation in AR mice.**A, experimental scheme of RW-induced AR mice with or without TTP knockdown via intravenous injection of lentiviral vectors (Lv-shNC or Lv-shTTP). B, expression of TTP mRNA in AR mice with or without TTP knockdown. C, immunofluorescence staining for TTP protein (red) and CD4 protein (green) in normal and RW-exposed nasal tissues. DAPI (blue) was used for nuclear staining (Scale bar = 50 μm). D, quantitative analysis of TTP fluorescence intensity in nasal mucosal tissues from lentivirus-injected mice. E, hematoxylin-eosin (H&E)-stained nasal mucosal tissue sections, showing nasal mucosa thickness (Scale bar = 100 μm). Dashed lines indicate the boundary between the epithelial layer and lamina propria. F and G, changes in the number of sneezes and nasal rubbings after TTP knockdown in AR mice. H, schematic of splenocyte isolation from AR mice and in vitro treatment. I–K, Levels of IL-4, IL-5, and IL-13 in the cell culture supernatant of splenocytes treated with ionomycin and PMA for 6 h. Data are presented as means ± SD (N = 3 or 6). Student's t test was used for statistical analysis of AR mice transduced with shNC or shTTP.

RNA-seq revealed functional enrichment profiles during TTP-mediated Th2 differentiation

TTP-overexpressed CD4^+^ T cells were then subjected to RNA sequencing analyses to reveal the TTP-mediated transcriptome landscape (Fig. 7A). Differential expression analysis revealed a set of DEGs between TTP overexpression and control CD4^+^ T cells, and a total of 210 DEGs in RW-TTP compared to RW-NC were identified, among which 123 genes were upregulated and 87 genes were downregulated (adj.p ≤ 0.05; Log_2_FC ≥ 1; Fig. 7B). Gene set enrichment analysis (GSEA) revealed that these DEGs in TTP-overexpressed CD4+ T cells were enriched mainly in asthma, chemokine signaling pathway, and Th17 cell differentiation pathways based on KEGG pathway analysis. In addition, these DEGs were enriched in cellular response to IL-17 and immune system process (Fig. 7C), suggesting important functional role of TTP during Th2 cell differentiation. As shown in Figure 7D, KEGG pathway enrichment analyses revealed that DEGs related to TTP were mainly enriched in p53 and chemokine, and IL-17 signaling pathways. Furthermore, GO term analysis showed that the target genes of TTP were related to the regulation of inflammatory response, cytokine production, and cell differentiation.Figure 7**Transcriptional profiles of CD4+ T cell isolated from AR mouse spleen reveal categories of genes associated with TTP.**A, RNA transcriptome microarray analysis of CD4+ T cell isolated from mouse. B, a volcano plot of all DEGs between CD4+ T cells isolated from LV-TTP and LV-Vector infected AR mouse. C, GSEA analysis identified significant enrichment of signaling pathways based on KEGG and GO analysis following TTP overexpression. D, KEGG pathway enrichment and GO functional classification analysis of DEGs. Data are shown as means ± SD (N = 3).

TTP reduced TRIM18 mRNA stability via binding to 3′UTR ARE

As an RNA-binding protein, TTP preferentially binds to 3′ UTR AREs and targets mainly inflammation-associated mRNAs for degradation (28). We identified 14 potential target genes of TTP harboring AREs within their 3′UTRs, which exhibited a significant decrease in expression following TTP overexpression, including TRIM18 (Fig. 8A). Upon T helper cell activation, TRIM18 mRNA expression levels were significantly decreased in Th2 cells when TTP expression was overexpressed (Fig. 8B). RIP assay with an anti-TTP antibody or IgG revealed that TTP could bind to the 3′UTR of TRIM18 mRNA in Th2 cells (Fig. 8C). Moreover, the remaining TRIM18 mRNA was examined after inhibiting de novo synthesis with actinomycin D. The half-life of TRIM18 mRNA was decreased in Th2 cells when TTP was overexpressed (Fig. 8D), indicating that TTP decreased the TRIM18 mRNA stability. To determine whether TTP regulates TRIM18 mRNA stability via ARE, we first predicted the binding sites of TTP on the mouse TRIM18 3′UTR using the RBPmap database. Prediction results revealed a canonical half-binding site for TTP (UAUUU, a variant of AREs) within the mouse TRIM18 3′UTR with the highest Z-score (Z = 3.19 and p < 0.05; Sequence: 5′-UAUUU-3′; +3640 to +3644; NM_010797.4). Docking analysis demonstrated that the second CCCH-ZF domain (Amino acid residues 133–161) of TTP interacted with this half-binding site (Fig. 8E). Given that uridine (U) residues in AREs mediate protein-specific interactions (29), we constructed luciferase reporter vectors harboring either the wild-type (WT) TRIM18 3′UTR or a mutant variant where all U residues in the ARE were substituted with adenine (A). Luciferase assay results performed in Th2 cells via lipofectamine-mediated transfection showed that TTP overexpression significantly enhanced the stability of WT-TRIM18 mRNA (p = 0.006), whereas no significant change was observed in the ARE-mutated TRIM18 group (Fig. 8F). Furthermore, interaction analysis based on docking results identified four key residues within the second CCCH-ZF domain of TTP that mediate binding to TRIM18 ARE: Cys-139, Cys-154, Tyr-150, and Phe-156 (Fig. 8G). Previous studies have reported that single-point mutations in these residues impair TTP-ARE interactions and increase the expression of its canonical target TNF (12). Multiple sequence alignment of TTP homologs across diverse species confirmed the evolutionary conservation of these four residues (Fig. 8H). We selected Cys-139 for further functional validation by generating a TTP mutant (Cys to Arg, designated as C139R). RIP-PCR assays demonstrated that WT-TTP directly bound to TRIM18 mRNA, whereas the binding affinity of TTP-C139R for TRIM18 mRNA was significantly reduced (Fig. 8I). Consistent with this, TRIM18 expression was restored in Th2 cells transfected with the TTP-C139R overexpression plasmid, compared to cells transfected with the WT-TTP overexpression plasmid (Fig. 8J). These findings demonstrate that TTP regulates TRIM18 mRNA stability through direct binding to the canonical ARE within TRIM18 3′UTR via its conserved Cys-139-containing second CCCH-ZF domain.Figure 8**The TRIM18 mRNA served as a target for post-transcriptional regulation by the RNA-binding protein TTP.**A, Venn intersection of downregulated genes following TTP overexpression and the mRNAs containing AU-rich elements in their 3′UTRs. The TRIM18 was one of the intersecting factors, and its expression was verified by RT-qPCR experiments. B, the mRNA level of TRIM18 in Th2 cells after virus infection. C, interaction between TTP protein and TRIM18 mRNA in Th2 cells was detected by RIP-PCR assay. D, remaining TRIM18 mRNA levels were measured in Th2 cells following TTP overexpression by real-time PCR. E, prediction of TTP binding sites on the 3′UTR of mouse TRIM18, followed by molecular docking analysis between TTP protein and the TRIM18 3′UTR containing AREs. Interface predicted template modeling score (ipTM) and predicted template modeling score (pTM) values greater than 0.5 indicate that the generated TTP-TRIM18 3′UTR complex models are reliable. F, TTP-overexpressing Th2 cells were stably transfected with luciferase reporter constructs harboring the wild-type TRIM18 3′UTR, ARE-mutated TRIM18 3′UTR (TRIM18–3′UTR-pmirGLO), or the empty vector (pmirGLO). Relative luciferase activity was measured and normalized to Renilla luciferase activity to assess the regulatory effect of TTP on TRIM18 via its 3′UTR ARE. G, schematic illustration of four key residues within the second CCCH-ZF domain of TTP, which are predicted/validated to mediate binding to the ARE of TRIM18. H, Multiple sequence alignment of TTP homologs across diverse species (human, mouse, and rat) confirms the evolutionary conservation of the Cys-139 residue, indicative of its functional importance. I, RIP-PCR assay was performed to investigate and compare the binding capacity of wild-type TTP (TTP^WT^) and Cys-139 mutant TTP (TTP^C139R^) to TRIM18 RNA, with enrichment of TRIM18 RNA quantified by qPCR to verify the role of Cys-139 in the interaction. J, expression levels of TRIM18 in Th2 cells overexpressing wild-type TTP (TTP^WT^) or Cys-139 mutant TTP (TTP^C139R^), detected by RT-qPCR, to evaluate the regulatory effect of TTP Cys-139 on TRIM18 expression. Data are shown as means ± SD (N = 3). Student's t test and one-way ANOVA were used for statistical analysis.

The TTP protein inhibited the Th2 inflammation and differentiation by inhibiting proinflammatory factor TRIM18

To further evaluate whether the TTP-TRIM18 post-transcriptional regulatory axis mediates Th2-related allergic inflammation in AR, we first delineated the functional role of TRIM18 in Th2 cells. As an E3 ubiquitin ligase, potential substrates of TRIM18 were retrieved from the UbiBrowser 2.0 database and underwent functional enrichment analysis as well as protein–protein interaction (PPI) analysis using the STRING database. Enrichment results revealed that 16 predicted substrates were significantly enriched in pathways regulating T cell activation and T helper cell differentiation (Fig. 9A). In vitro functional assays demonstrated that TRIM18 overexpression significantly upregulated IL-5 mRNA levels and increased secreted IL-5 protein concentrations (Fig. 9, B and C), indicating that TRIM18 promotes Th2 cell differentiation and functional activation.Figure 9**The TTP protein acted as a negative regulator of TRIM18-mediated Th2-type inflammation by reducing TRIM18 mRNA stability.**A, protein–protein interaction network of 16 potential substrates of E3 ubiquitin ligase TRIM18, constructed using the STRING database and supplemented with functional annotations via GO (Gene Ontology) pathway enrichment analyses, highlighting key biological processes and signaling pathways associated with these substrates. B and C, the qRT-PCR and ELISA were performed to detect the mRNA level and secreted protein concentration of IL-5, respectively, in naive CD4+ T cells or in vitro differentiated Th2 cells transfected with TRIM18 overexpression vector or empty vector. D, schematic diagram of the experimental workflow: Naive CD4+ T cells were induced to differentiate into Th2 cells under in vitro and were co-transfected with combinations of TTP overexpression vector, TRIM18 overexpression vector, or corresponding empty vectors. E, the mRNA level of TRIM18 in differentiated Th2 cells from the three groups (Control, TTP-OE, TTP+TRIM18-OE) was detected by qRT-PCR assays. F and G, The mRNA level and secreted protein concentration of IL-5 were measured by qRT-PCR and ELISA, respectively, in differentiated Th2 cells from the three groups (Control, TTP-OE, TTP+TRIM18-OE). H, flow cytometric analysis of the percentage of CD4+IL-4+ Th2 cells among the three groups after in vitro differentiation, and the proportion of double-positive cells was quantified to assess the impact of TTP and/or TRIM18 overexpression on Th2 cell differentiation. Data are shown as means ± SD (N = 3), One-way ANOVA was used for statistical analysis.

To verify that TTP exerts its anti-inflammatory effects by targeting TRIM18, we performed a rescue experiment via co-overexpressing TTP and TRIM18 in Th2 cells (Fig. 9D). Consistently, TTP overexpression reduced TRIM18 mRNA levels, while TRIM18 overexpression alone elevated its own mRNA abundance (Fig. 9E). Notably, TTP overexpression downregulated IL-5 expression, whereas TRIM18 overexpression significantly increased IL-5 mRNA and protein levels (Fig. 9, F and G). Furthermore, flow cytometry analysis showed that TRIM18 upregulation restored the percentage of Th2 cells in TTP-overexpressing cells (Fig. 9H). Taken together, these results demonstrate that TTP represses Th2 cell differentiation by accelerating TRIM18 mRNA degradation. Collectively, these findings confirm that TRIM18 acts as a positive regulator of Th2 cell differentiation, and TTP inhibits Th2-related allergic inflammation in AR through post-transcriptional downregulation of TRIM18 via accelerating its mRNA degradation, thus validating the functional significance of the TTP-TRIM18 regulatory axis in Th2 polarization.

Discussion

Type 2 inflammatory responses are closely linked to the etiology of allergic diseases, driving the production of allergen-specific IgE, a key mediator of various allergic conditions (30). This process is orchestrated by multiple RNA-binding protein (RBP) families; the CCCH-ZF family is uniquely distinguished by its dual role: not only regulating cytokine expression but also directly governing the differentiation and functional specialization of immune cells, an attribute that sets it apart from most other RBP families (31). Herein, transcriptomic analysis of three allergic diseases identifies TTP, a well-characterized CCCH-ZF family member, as a potential pan-allergic disease biomarker. TTP participates in both cytokine modulation by targeting ARE-containing mRNAs for degradation and immune cell fate determination (32), which aligns with the pathological core of AR. The endogenously upregulated TTP in the nasal mucosa of AR mice reflects a compensatory yet insufficient protective response. This phenomenon is consistent with TTP's known regulatory pattern: its expression and activation are dynamically tuned to balance homeostatic and inflammatory states, ensuring appropriate immune reactions (33). Similar compensatory upregulation of TTP has been documented in other inflammatory pathologies: in patients with chronic obstructive pulmonary disease (COPD), TTP expression is significantly higher in those with airway eosinophilic inflammation than in non-eosinophilic patients (34), and a human trial verified TTP upregulation as an adaptive response to systemic mild inflammation (35). Our gain-of-function and loss-of-function experiments in AR mice, mimicking physiological high/low TTP expression, confirmed that TTP mitigates allergic phenotypes by suppressing Th2-type inflammation. Beyond CD4^+^ T cells, TTP may act on other upper respiratory tract cell types: TTP family members (ZFP36L1/ZFP36L2) are dysregulated in the airway epithelium of asthmatic models (36), and while TTP's epithelial functions are less defined, its divergent target mRNAs suggest cell-specific roles (37). For example, TSLP, an epithelial-derived cytokine critical for Th2 initiation, is regulated by NF-κB (38), a pathway modulated by TTP in our study. Whether TTP directly regulates TSLP secretion in epithelial cells warrants further investigation, as no RBP-mediated regulation of TSLP has been reported to date.

A central feature of inflammatory transcripts is the presence of cis-elements (e.g., AREs and pyrimidine-purine-pyrimidine tri-loops) that govern their rapid degradation in immune cells, making these elements pivotal for post-transcriptional gene regulation (39). CCCH-ZF proteins (TTP, Roquin, Regnase-1) exploit these elements to directly and rapidly modulate core immune effectors: TTP binds AREs, while Regnase-1 recognizes stem-loop structures (40). Although our study focused on TRIM18, TTP's regulation of ARE-containing cytokines (e.g., TNF-α and IL-13) likely contributes to its anti-AR effects, consistent with RNA-seq data showing TTP regulates NF-κB and chemokine signaling pathways, which are tightly linked to AR progression (41). Approximately 27.45% of genes downregulated by TTP overexpression contain AREs, but most ARE-containing genes showed no significant changes, likely due to antagonism by HuR, an ARE-binding protein that stabilizes mRNAs (42). TRIM18 mRNA was a direct target of TTP protein: the second CCCH-ZF domain of TTP interacts with the UAUUU half-binding site in TRIM18's 3′UTR, consistent with structural studies of TTP family members (e.g., ZFP36L2 binds the UAUU subsite via its second CCCH-ZF domain) (43). We further validated the specificity of the TTP-ARE-TRIM18 axis. Likewise, TRIM18, other TTP's targets that were identified in RNA-seq analysis include a complement and immune regulator CD46, transcriptional co-activator WWTR1, and a growth factor FGF2 are involved in CD4+ T cell plasticity and allergic disease (44, 45, 46); MERTK and CD163 regulate macrophage function to participate in the inflammatory regulation of allergic diseases (47, 48). These findings suggested that TTP exerts pleiotropic effects by destabilizing a broad spectrum of mRNAs.

This TTP-ARE-TRIM18 axis directly links TTP's canonical function to AR pathogenesis. TRIM18 was prioritized among differentially expressed ARE-containing genes. It is a well-documented pro-inflammatory regulator that promotes allergic asthma (26). TRIM18 is an E3 ubiquitin ligase belonging to the Tripartite Motif (TRIM) subfamily of RING-containing proteins, which mediates K6, K27, K29, and K63-linked polyubiquitination of its substrates (22, 49). TRIM18's C-terminal PRYSPRY domain, a well-characterized druggable module, makes it a promising target for small-molecule inhibitors, supporting its potential as a therapeutic candidate for AR (50). Herein, 16 TRIM18 substrates enriched in T cell differentiation pathways, including IRF4 (essential for Th2/Th17 maintenance) (51) and ZEB1 (required for pathogenic Th1/Th17 differentiation) (52). Importantly, TRIM18 regulates STAT3 signaling (53), and STAT3 activation is critical for Th2 differentiation and cytokine production (54). Inhibition of the STAT3 signaling pathway ameliorates combined allergic rhinitis and asthma syndrome after PM2.5 exposure (55). TRIM18 overexpression alone promoted Th2 cytokine IL-5 secretion. Thus, TRIM18 may participate in Th2 cell differentiation through these critical components of the ubiquitination network or the STAT3 signaling pathway, which will be the focus of our subsequent research. However, we were unable to validate the TTP-TRIM18 axis in AR mice due to key technical constraints, and future work will optimize CRISPR-Cas9 or optimized adenoviral vectors.

In summary, increased TTP was found in the nasal mucosa of mice with RW-induced AR. TTP alleviates AR by suppressing Th2-type inflammation and differentiation, primarily through binding the ARE motif in TRIM18's 3′UTR to promote its mRNA degradation. These findings identify the TTP-TRIM18 axis as a novel therapeutic target for AR, highlighting the potential of targeting post-transcriptional regulation in allergic diseases.

Experimental procedures

Bioinformatics analysis

The allergic rhinitis dataset GSE140454, the asthma dataset GSE3004, and the atopic dermatitis dataset GSE72540 were downloaded from the GEO database (https://www.ncbi.nlm.nih.gov/geo/). Differential analysis was performed using the GEO2R tool (https://www.ncbi.nlm.nih.gov/geo/geo2r/?acc), and differentially expressed genes (DEGs) were screened according to the threshold of |Log_2_diseased/normal-tissue| > 1 and p < 0.05. For the upregulated genes in the three datasets, the genes were arranged in descending order (i.e., from largest to smallest) according to the Log_2_diseased/normal-tissue values. The Robust Rank Aggregation (RRA) algorithm was used to perform an integrated ranking of the three sorted gene sets. The RRA score and frequency of each gene were used to screen the core molecular cluster of IgE-mediated inflammation.

Experimental animals and groups

The BALB/c mice (6–8 weeks old; female) were used to generate the murine model of RW-specific AR as previously reported (3), and mice were randomly divided into four groups (N = 6 per group): Control group, RW-induced AR group, RW + LV-NC group, and RW + LV-TTP group. The experimental protocol is depicted in Figure 1A. All animal experiments were approved by the Ethical Committee of China Medical University (CMU20231172).

Construction and preparation of lentiviral vector

The shRNA targeting sequence for TTP (shTTP) was 5′-CCCATCTTCAATCGCATCTCT-3′, first synthesized and inserted into the pLVX-shRNA1 plasmid. A scramble nonsense sequence (5′-TTCTCCGAACGTGTCACGT-3′) was used as a negative control. The plasmids were packaged into lentivirus using a three-plasmid system, pLVX-shRNA1 with the targeted sequence, psPAX2, and pMD2G (All purchased from Hunan Fenghui Biotechnology Company). Then, the combined lentivirus packaging plasmids were co-transfected into HEK293T cells to obtain lentivirus particles. Next, the supernatants containing lentivirus particles were collected and concentrated by ultracentrifugation. Finally, it was stored at −80 °C for further use. The same procedure was used for the lentiviral packaging of the recombinant lentiviral expression vector pLVX-IRES-puro (Hunan Fenghui Biotechnology Company), corresponding to TTP overexpression or TRIM18 overexpression.

Allergic rhinitis model and lentiviral intervention

In brief, mice were immunized with a 200 μl mixture of RW (100 μg; Greer Labs, Cat No.XP56D3A2.5) and aluminum hydroxide hydrate gel (1 mg) by intraperitoneal injection on day 0 and with 200 μl RW/PBS (100 μg) by intraperitoneal injection on day 7. From day 14 to 17, mice were intranasally administered with RW (1 mg in 20 μl of PBS) for four consecutive days. The mice in the control group were treated with an equivalent dose of PBS. For lentivirus administration, on day 14, mice were intravenously injected with lentivirus (50 μl; 1 × 10^9^ TU/ml) 2 h before the RW challenge.

Allergic symptoms

Nasal rubbing and sneezing without anesthesia were observed during a 10 min period on day 17, following the final RW intranasal challenge. These data were recorded by blinded observers during the 10 min after the last intranasal RW challenge.

Collection and examination of NALF and blood samples

Twenty-four hours after the RW challenge, the mice were sacrificed, and the nasal mucosa, spleen, blood, and nasal lavage fluid (NALF) were harvested for further analysis. Giemsa staining was performed to evaluate the number of total cells, eosinophils, neutrophils, macrophages, and lymphocytes in the NALF as previously reported (56). In NAL fluid, the level of Thymic Stromal Lymphopoietin (TSLP) was detected using a Mouse TSLP ELISA Kit (Multi-Science, Cat No.EK265, China). To obtain serum, samples of blood were centrifuged at 10,000 rpm for 10 min at 4 °C. Then the serum was preserved at −80 °C for further use. The histamine levels in the serum sample were measured by the Histamine Colorimetric Assay Kit (Elabsciencem, Cat No.E-BC-K893-M, China).

Real-time quantitative PCR

Total RNA was extracted using TRIpure lysate (BioTeke, Cat No.RP1001, China) from collected nasal mucosal tissues and cells. The RNA concentration was assessed by a NanoDrop One ultraviolet spectrophotometer (Thermo Fisher Scientific). RNA was reverse transcribed into cDNA, and the qPCR reaction system was performed using SYBR Green (Solarbio, Cat No.SR4110) and PCR MasterMix (Solarbio, Cat No.PC1150). The 2^−ΔΔCt^ method was used for gene expression quantification, and β-actin served as an internal control. Real-time qPCR was performed with specific primers: TTP (Forward) CGGACCTACTCAGAAAGCG, (Reverse) CTGGAGGTAGAACTTGTGGC; IL-5 (Forward) GGCTTCCTGTCCCTACT, (Reverse) CTTCCATTGCCCACTCT; TRIM18 (Forward) TTCCCGAAATCAACCTC, (Reverse) CGCTGAACTCGTCCTCT, and β-actin (Forward) CATCCGTAAAGACCTCTATGCC, (Reverse) ATGGAGCCACCGATCCACA.

Immunofluorescence staining analysis

For nasal histopathological examination, acquired tissue samples were fixed in 4% paraformaldehyde for 24 h and then decalcified in a 10% ethylenediaminetetraacetic acid (EDTA) solution (adjusted to pH 7.2–7.5) on a shaker at room temperature for 4 weeks. The decalcification solution was changed every 7 days. After that, the tissues were embedded in paraffin, cut into 5-μm slices. For immunofluorescence staining, the embedded mucosal sections were dehydrated in xylene for 15 min, and cleared with graded ethanol (95%, 85%, and 75% ethanol each for 1 min), and boiled in antigen retrieval solution for 10 min in an autoclave. To block nonspecific binding, sections were treated with 1% BSA. Then, the sections were co-incubated with antibodies against TTP (1:100 dilution, Proteintech, Cat No.66938-1-Ig) and CD4 (1:50 dilution, Abclonal, Cat No.A0363) overnight at 4 °C. The samples were incubated with anti-mouse/rabbit IgG (1:200 dilution, CST) for 90 min. After being counterstained with DAPI, images were obtained under a fluorescence microscope (400×, Olympus).

Histopathological examination of nasal tissue

Once 5-μm-thick sections had been deparaffinized and rehydrated, they were stained with hematoxylin and eosin (H&E; Sigma-Aldrich, St USA) to observe thickening of nasal mucosal tissue. Periodic acid-Schiff (PAS) staining was used to identify the number of PAS-positive goblet cells. To analyze this cell type, the average cell counts in three randomly selected fields were determined under a high magnification (400×)

Primary splenocytes isolation and ELISA

Splenocytes were isolated from the spleen of control, RW-induced AR, RW + LV-NC, and RW + LV-TTP mice using a mouse spleen lymphocyte isolation kit (Solarbio, Cat No.P4880) as previously reported (57). In detail, the spleen was dissected out and immediately immersed in PBS, then ground and passed through a 70 μm cell strainer. The cell suspension was added to the upper layer of the lymphocyte separation solution at a ratio of 1:1 and centrifuged at 800g for 25 min. Afterward, the splenocytes at the middle boundary were harvested, washed twice with cell washing solution from the same kit or PBS, and centrifuged at 250g for 10 min, respectively. The splenocytes were incubated in RPMI 1640 medium containing 10% fetal bovine serum, 50 ng/ml phorbol 12-myristate 13-acetate (PMA; Shanghai Yuanye Bio-Technology, Cat No.R32414, China) and 1 μg/ml ionomycin (Macklin, Cat No.I838446, China), at 37 °C and 5% CO_2_. Cell supernatants were collected after continuous culture for 6 h. The IL-4, IL-5, and IL-13 levels in cell supernatant collected from primary splenocytes were determined by using Mouse IL-4 ELISA Kit (Cat No. EK204), Mouse IL-5 ELISA Kit (Cat No. EK205), and Mouse IL-13 ELISA Kit (Cat No. EK2213), respectively, according to the manufacturer's instructions.

Flow cytometry analysis

For flow cytometry, the primary splenocytes were stimulated with 50 ng/ml PMA (Shanghai Yuanye Bio-Technology, Cat No.R32414), 1 μg/ml ionomycin (Macklin, Cat No.I838446), and 1 μl/ml BD Golgi Plug for 6 h. Centrifugal collection of cells was resuspended in 100 μl of staining buffer, and surface markers were stained with 5 μl anti-mouse CD4 (RM4-5; Liankebio, Cat No.F21004A02) and 5 μl APC anti-mouse IL-4 (Elabsciencem, Cat No.E-AB-F1204E) for 30 min. After centrifugation, the samples were analyzed using a Flow Cytometer.

Isolation of naive CD4 T cells and Th2 differentiation

Firstly, primary splenocytes were collected from the spleen tissues of healthy mice by the same method. The naïve CD4^+^ T cells were purified from splenocytes by magnetic-activated cell sorting (MACS) using a Naive CD4^+^ T Cell Isolation Kit (Miltenyi Biotec, Cat No. 130-104-453). In detail, the 1 × 10^7^ splenocytes in 40 μl buffer solution were incubated with 10 μl Biotin-Antibody Cocktail for 5 min at 4 °C. Cells were further incubated with 20 μl anti-biotin microbeads and 10 μl CD4 microbeads for 10 min at 4 °C. After washing with buffer solution, cells were separated manually using a separation column. Among them, the magnetically labeled non-target cells are depleted by retaining them on a MACS Column in the magnetic field of a MACS separator, while the unlabeled target cells pass through the column. MACS-pre-purified naïve CD4^+^ T cells were stimulated with plate-bound anti-CD3 (5 μg/ml; Bioxell, Cat No.BE0002) and anti-CD28 (2 μg/ml; Bioxell, Cat No.BE0015) for 5 days. Lentiviral plasmids (MOI = 30) were used to infect the activated naïve CD4^+^ T cells for 48 h, and then cytokines were added for polarization. For Th2 polarization, cells were supplemented with anti-IFN-γ (20 μg/ml; Thermos, Cat No.16-7311-81) and IL-4 (20 ng/ml; MCE, Cat No. HY-P701093) for 72 h.

RNA stability

Time-dependent degradation assays were performed after inhibition of transcription with Actinomycin D (Aladdin, Cat No. A432787). Actinomycin D at 3 μg/ml was added to the cells to inhibit the synthesis of new mRNA in cells with TTP overexpression or control. Cells were harvested at 0, 4, 8, and 12 h after treatment, and total RNA was extracted. The relative expression levels of TRIM18 mRNA at different time points were measured by RT-qPCR, and the mRNA levels at each time point were compared with those at 0 h to assess the effect of TTP on TRIM18 mRNA stability.

Western blot analysis

Proteins from Th2 cells were obtained by using cell lysis buffer for Western and IP (Beyotime, Cat No.P0013) mixed with PMSF (Cat No. ST506). The protein concentrations were determined by using a BCA Protein Assay Kit (Cat No. P001). The proteins were separated by SDS-PAGE and transferred onto PVDF membranes (Abcam, Cat No.ab133411). The membranes were blocked in blocking buffer (Cat No.P0023) for 1 h and incubated with primary antibody overnight at 4 °C against TTP antibody (Proteintech, Cat No.66938-1-Ig, China). After incubation, the membranes were incubated with the secondary antibody against β-actin (Santa Cruz, Cat No.sc-47778). The protein bands were visualized by using the enhanced chemiluminescence reagent (Cat No.P0018). Data were analyzed using a Gel-Pro-Analyzer.

RNA sequencing (RNA-seq)

Splenic CD4^+^ T cells isolated from mice were subjected to RNA-seq analysis. Briefly, total RNA was extracted from purified CD4^+^ T cells, and RNA concentration was determined using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies). RNA integrity was assessed via an Agilent 2100 Bioanalyzer (Agilent Technologies), with samples meeting the quality criteria RNA integrity number (RIN) ≥ 7.0 and OD260/280 ratio ≥ 1.8 selected for subsequent sequencing.

RNA-seq libraries were constructed from 100 ng of total RNA using the Illumina TruSeq RNA Library Prep Kit (Illumina) following the manufacturer's standard protocol, and libraries were sequenced on an Illumina NovaSeq 6000 platform. Raw sequencing data (FASTQ files) underwent quality control using FastQC (v0.11.9). Clean reads were aligned to the mouse reference genome (GRCm39, Ensembl) using STAR software (v2.7.10b), and aligned reads were quantified for gene expression counts. Differential expression analysis was performed using R software (v4.3.0) with the DESeq2 package (v1.38.3). Log2-transformed transcripts per million (TPM) values were computed for normalization. Differentially expressed genes (DEGs) were defined as those with an absolute log2 fold change (|log2FC|) ≥ 1 and p-value < 0.05. Hierarchical clustering heatmaps were generated to visualize the expression profiles of DEGs across experimental groups.

RNA immunoprecipitation (RIP) assay

To assess the interaction between TTP and the 3′UTR of TRIM18 mRNA, we performed RIP using the EZ-Magna RIP Kit (Millipore; Cat. No. 17-701). Both wild-type (WT) and ARE-containing region-mutated (MUT) variants (with U-to-A mutations) of the TRIM18 mRNA 3′UTR were included in the assay. For co-immunoprecipitation, beads conjugated with IgG (as a negative control) or TTP-specific antibodies were used. The RNAs purified from the immunoprecipitated complexes were quantified via real-time PCR.

Luciferase reporter assay

The 3′UTR of mouse TRIM18 was cloned into the pmirGLO vector and was inserted downstream of the firefly luciferase coding sequence in the sense orientation. To explore the effect of TTP on the TRIM18 3′UTR, Th2 cells were co-transfected with a luciferase plasmid and plasmids carrying WT-TTP-overexpressing or MUT-TTP^C139R^-overexpressing vectors using Lipofectamine 3000 (Invitrogen, Cat No.L3000015) following the manufacturer's instructions. The firefly and Renilla luciferase activity was measured using the Dual-Luciferase Reporter Gene Assay Kit (KeyGEN, Cat No.KGE3302). Renilla luciferase activity was normalized to firefly luciferase activity.

Molecular docking

Mouse TTP protein structures were downloaded from the AlphaFold Protein Structure Database (https://alphafold.ebi.ac.uk/). The annotation of the C3H1-ZF domain of the mouse TTP protein is based on the Uniport website (https://www.uniprot.org/). The ConSurf (http://consurfdb.tau.ac.il/) was a server that uses the estimated evolutionary conservation of amino acid positions in the TTP protein (58). Docking analysis was performed using the AlphaFold Server (https://deepmind.google/technologies/alphafold/alphafold-server/) (59) to examine the interaction between mouse TTP protein, two Zn^2+^ ion ligands, and the ARE-containing TRIM18 mRNA, wherein the ARE sequence of TRIM18 mRNA was predicted via the RBPmap website (http://rbpmap.technion.ac.il/). PyMOL software (version: 2.5.2) was applied for the analysis of protein structure and the interaction in complexes.

Statistical analysis

This experiment presents data from our study in the format of mean ± standard deviation (SD). Data that meet the normal distribution by Shapiro–Wilk test were subjected to variance analysis. Differences between the two groups were evaluated using an independent samples t test. One-way analysis of variance (ANOVA) was conducted for comparisons among multiple groups. Statistical analyses were performed using GraphPad Prism software, and a significance level of p < 0.05 was considered statistically significant.

Data availability

Data will be made available on request.

Supporting information

This article contains supporting information.

Conflict of interest

The authors declare that they have no known competing financial interests.