ASB5 is a specific marker for muscle satellite cells but dispensable for skeletal muscle development and regeneration
Muhammad Asif, Stephanie N. Oprescu, Renjie Shang, Zheng Zhang, Feng Yue, Pengpeng Bi, Shihuan Kuang
TL;DR
ASB5 is a specific marker for muscle satellite cells but not essential for muscle development or regeneration.
Contribution
ASB5 is identified as a specific marker for muscle satellite cells, but its dispensability is shown in muscle development and regeneration.
Findings
ASB5 is highly expressed in muscle satellite cells and their progenies during muscle regeneration.
Asb5 knockout mice show normal muscle development and regeneration.
Asb5 knockout reduces Tnfa expression in skeletal muscles.
Abstract
Skeletal muscle plays a crucial role in human life, contributing to posture, movement, nutrient storage, and body temperature regulation. Development and regeneration of skeletal muscles rely on embryonic myogenic progenitors and postnatal satellite cells (MuSCs), respectively. Identification of new molecular markers and elucidating their functions in MuSCs will provide better understanding of muscle development and regeneration. We surveyed single cell RNA-seq (scRNA-seq) data (Tabula Muris and GSE150366) to identify ASB5 (Ankyrin repeat and Suppressor of cytokine signaling Box containing 5) as a marker of MuSCs. We also used CRISPR-CAS9 genome editing and oviduct electroporation to generate a germline knockout (KO) mouse line of Asb5. We then analyzed the muscle growth and regeneration of the KO mice. We further analyzed proliferation and differentiation of MuSCs attached on…
Genes, proteins, chemicals, diseases, species, mutations and cell lines named across the full text — each resolved to its canonical identifier and authoritative record.
Click any figure to enlarge with its caption.
Figure 1
Figure 2
Figure 3
Figure 4- —https://doi.org/10.13039/100000002National Institutes of Health
Peer Reviews
No public reviews on file for this paper yet. If you reviewed it on a platform where reviews are public (OpenReview, ICLR, NeurIPS, ICML), you can paste yours below so the community can read it here.
Videos
No videos yet. Explain this paper in a talk, walkthrough, or lecture? Add one.
Taxonomy
TopicsMuscle Physiology and Disorders · Mesenchymal stem cell research · Pluripotent Stem Cells Research
Introduction
Skeletal muscles, being the largest component of the body, play many important roles in human physiology. They function to maintain body posture and movement, store nutrients, and regulate body temperature. Skeletal muscles have several properties, the most important one being able to regenerate after tissue damage or injury. Its regenerative potential depends on a resident stem cell population often referred to as satellite cells [15]. Quiescent MuSCs are located between the basal lamina and the sarcolemma. After tissue damage, MuSCs get activated and divide symmetrically or asymmetrically to generate a pool of myoblasts. Symmetric division leads to the production of two cells having the same fate while asymmetric division leads to production of a self-renewing cell and a committed cell [14]. Self-renewal is essential for maintaining the stem cell pool for future injuries while committed cells get differentiated and either fuse with other differentiated cells to form new myofibers or fuse with existing myofibers to help in repair [35].
The regeneration of skeletal muscle is an orchestrated process, controlled by a multitude of cellular and molecular signaling pathways. Whether the muscle is subjected to acute trauma, such as strain or contusion, or undergoes chronic degenerative disease or repetitive stress, the regenerative mechanism comes into play to restore the functional integrity of the muscle [6]. The myogenic progression of MuSCs is largely controlled by myogenic regulatory factors (MRF), including Myf5, MyoD, MyoG and MRF4 [11–13, 25, 34]. Expression of these MRFs is regulated by extracellular factors that trigger intracellular signaling pathways within the MuSCs. Notch signaling is one of the well-studied pathways that plays an impertinent role in maintaining balance between MuSCs quiescence and differentiation [1, 2, 14, 18, 32].
ASB5 belongs to the family of Ankyrin repeats and suppressor of cytokine signaling box containing (ASB) proteins. This family comprises of 18 members in mouse, differing in the numbers of N-terminal ankyrin repeat domains. Previous analyses have implicated a role of several ASB family members, including Asb5, in skeletal muscle development [8]. Although some ASB members are reported to be involved in modulating intracellular signaling transduction [20], very little is known about the detailed function and mechanism. Notch signaling was reported to induce ASB2 in murine fibroblasts to mediate ubiquitination and degradation of substrates involved in cell differentiation [19]. Another publication reported that knockdown of ASB3 leads to the inhibition of hepatocellular carcinoma by activating the mitochondrial apoptosis [37].
In this study, we focused on Asb5, whose expression is highly enriched in MuSCs. We generated a global knockout mouse model of Asb5 by using CRISPR-Cas9 technique. Our study revealed that ASB5 is dispensable for skeletal muscle development and post-natal muscle regeneration.
Methods
Oviduct electroporation and mouse genotyping analysis
All animal procedures were approved by the Institutional Animal Care and Use Committee (IACUC) at the University of Georgia. Mouse oviduct electroporation was performed as previously reported [21, 27]. Briefly, 6–10 weeks old female mice were mated with stud males the day before electroporation. The copulated female mice were used for surgery to exposes oviduct. CRISPR gene editing cocktails were freshly assembled and contained 6 μM Cas9 protein (IDT, 1081058) and 30 μM gRNA (Alt-R® crRNA annealed with tracrRNA, IDT, 1072534). This cocktail was delivered into oviduct through microcapillary injection. Oviduct electroporation was performed using CUY21EDIT II electroporator with the following protocol: Pd A: 100 mA, Pd on: 5 ms, Pd off: 50 ms, three cycles, decay 10%. The sequences of gRNA: #1 TTGTTCAACGCATGCTCACA; #2 ATATGGTGCCAAAGCCCAAC. F0 founder was bred with WT mice. The F1 generation mutant was identified by genotyping PCR using a pair of primers (forward: TCCCCATTCCTGTGACTCCT; reverse: GTACCTCCCCCTACCCATGT). Wildtype and knockout samples give to a band of 481 bp and 428 bp, respectively. Sequence of the PCR product was validated by Sanger sequencing.
Founder line was crossed to wildtype C57BL.6 J line for at least 3 generations before analysis. Mice were maintained in an animal facility with free access to standard rodent chow and water. All procedures involving mice were guided and approved by the Purdue Animal Care and Use Committee (PACUC). Mice were genotyped by PCR of ear DNA using genotyping protocols described earlier. Two-month-old male and female mice were used for all the experiments and gender matched for each experiment.
Muscle injury and regeneration
For muscle injury, two months old mice were used. Muscle injury was induced in left leg by 50 µl of 1.2% BaCl_2_ (ddH2O). Before muscle injury mice were anesthetized by Ketamine injection intraperitonially, then BaCl_2_ was injected in belly of TA muscle. After 5.5 days, TA muscles were harvested for histological sectioning to observe muscle regeneration.
Hematoxylin and eosin staining and immunofluorescence staining
For H&E and immunofluorescence staining, TA muscles were dissected and frozen immediately in OCT compound, and frozen samples were cross sectioned at 10 µm thickness. For H&E staining, slides were stained in hematoxylin for 15 min [31], rinsed until water was clear and then stained with eosin for 1 min. Dehydration was done in graded ethanol and xylene. For immunofluorescence, sections and cultured myofibers were fixed in 4% paraformaldehyde, washed with PBS, and quenched with 0.1 M glycine. It was followed by blocking in blocking buffer (5% goat serum, 2% bovine serum, 0.1% Triton X0-100). After that sections were incubated in primary antibodies for PAX7, DYSTROPHIN, LAMININ and embryonic MYHC overnight in 4C. Next day, after washing, they were incubated with secondary antibodies and DAPI for 1 h at room temperature, followed by washing with PBST and covered with coverslip after applying fluorophore.
Single myofiber isolation and culture
For single myofiber isolation and culture, EDL muscles were harvested hygienically from 2–3-month-old mice. EDL muscles were collected from tendon to tendon as previously described [4, 23]. Muscles were digested with 0.2% type 1 collagenase in DMEM for 50 min at 37°C, with gentle rotation after each 15 min. To stop digestion muscles were transferred to horse serum coated 60 mm petri dish containing 5 ml DMEM. To isolate single myofibers, muscles were gently flushed by a large bore pipette and single myofibers were collected using a small-bore pipette and cultured in culture medium (20% FBS, 4 ng/mL bFGF, 1% penicillin–streptomycin in DMEM) for 72 h.
RNA extraction and real-time PCR
Total RNA was extracted using Trizol reagent from tissues according to the manufacturer’s instructions. A spectrophotometer (Nanodrop 3000, Thermo Fisher) was used to measure purity and concentration of RNA. From extracted RNA, 3 µg of total was used to reverse transcribe using random primers and M-MLV reverse transcriptase according to the manufacturer’s instructions (ThermoFisher, Cat#28025021). Real-time PCR was done using SYBR Green Master Mix (Roche, Cat#06924204001). Primers used are listed in Table 1. Finally, 2^−∆∆CT^ method was used for the analysis and relative expression, and β-actin was used as housekeeping control.Table 1. Primers used for qPCRPrimerSequence (5’−3’)q-Asb5-FGGCCATTTGCTCAACAGCTATq-Asb5-RCTTTCGGTTGCCTTTCACGAq-Adgre1-FCACGGCTTCAGAGATGACCAq-Adgre1-RCTGCAACAGAGCAGTTCAGCq-CD68-FGGACTACATGGCGGTGGAATq-CD68-RTGGTCACGGTTGCAAGAGAAq-IL1-FGCAGTGGTTCGAGGCCTAATq-IL1-RCATCACTGTCAAAAGGTGGCAq-IL6-FTCGTGGAAATGAGAAAAGAGTTGTGq-IL6-RGAGCATTGGAAATTGGGGTAGGAq-TNFα-FACAGAAAGCATGATCCGCGAq-TNFα-RGTTTGCTACGACGTGGGCT
Statistical analysis
Statistical analysis was performed using GraphPad Prism Version 10.3.1. Student’s t-test was used to compare continuous variables between the groups and data are presented as mean ± SD. The parameter ‘n’ symbolizes an independent biological sample. A P-value of less than 0.05 was nominated as significant.
Results
scRNA-seq identification of novel myogenic lineage markers including Asb5
We analyzed publicly accessible scRNA-seq data available at Tabula Muris Consortium comprising ~ 100,000 cells from 20 organs and tissues. These cells were clustered by tSNE into 80 unique cell clusters, including the MuSC cluster marked by the muscle cell adhesion molecule Cdh15 (Fig. 1A, left). We found that Asb5 is mainly expressed in the MuSC cluster among all 80 clusters (Fig. 1A, right). We further examined Asb5 expression in various cell populations within the skeletal muscle and found that Asb5 is predominately expressed in the MuSCs population (Fig. 1B). These analyses identify ASB5 as a unique marker of MuSCs in adult non-injured skeletal muscles.Fig. 1. Asb5 expression across developmental stages of muscle satellite cells (MuSCs). A Expression of Cdh15 (a marker of MuSCs) and Asb5 across 20 tissues and 80 cell clusters, based on Tabula Muris dataset. B Violin plot showing the Asb5 expression in various cell types within the limb muscle, based on Tabula Muris dataset. MP: macrophage, MSCs: mesenchymal stem cells, EC: endothelial cells, NA: cell type not annotated. C UMAP plot showing cell clusters (labeled in circles) and corresponding time points based on scRNA-seq data (GSE150366). scRNA-seq were performed using GFP^+^ cells sorted from Pax7^CreER^/Rosa26^LSL−sfGFP^ mice before injury (Non-inj) and at 5 and 10 days post injury (dpi). QSC, quiescent satellite cells; SSC, self-renewing satellite cells; ASC, activated satellite cells; PSC, proliferating satellite cells; DSC, differentiating satellite cells; IMB, immunomyoblasts. D UMAP plots showing the expression of Lyz2, Asb5 and myogenic markers including Pax7, Myf5, Myod1 and Myog. E Heatmap visualizing the top 10 markers for each cluster
To further determine Asb5 expression in MuSCs during their myogenic progression, we performed scRNA-Seq of MuSCs and their descendant cells marked by indelible GFP expression [36]. GFP^+^ cells were purified from Pax7^CreER^/Rosa26^sfGFP^ mice by fluorescence activated cell sorting (FACS) at 5 and 10 days post injury (dpi) induced by cardiotoxin, as well as MuSCs from non-injured muscles. Using unsupervised UMAP clustering (Fig. 1C), MuSCs were grouped into well-defined clusters known as quiescent satellite cells (QSC), self-renewing satellite cells (SSC), activated satellite cells (ASC), proliferating satellite cells (PSC), differentiating satellite cells (DSC) and newly-defined immunomyoblasts (IMB) [22]. Visualization of the cell clusters according to timepoints revealed that QSC, ASC and SSC are predominantly located in non-injured, 5-dpi and 10-dpi muscles, respectively (Fig. 1C). Meanwhile, PSC, DSC and IMB were present at both 5-dpi and 10-dpi but not in non-injured muscles (Fig. 1C). Furthermore, expression patterns of Pax7, Myf5, Myod1 and Myog, Lyz2 were consistent with their known functions during myogenesis (Fig. 1D). These data establish the validity of the scRNA-seq data and annotation of the cell clusters.
Using this scRNA-seq dataset (GSE150366), we detected Asb5 expression in every cluster of MuSCs and their progenies (Fig. 1D). Specifically, Asb5 expression correlated strongly with that of Pax7 and Myf5, but to a lesser extent with Lyz2, Myod1 and Myog (Fig. 1D). Asb5 was most unanimously expressed in IMB among all cell clusters (Fig. 1D), suggesting a role of ASB5 in modulating immune response during regeneration.
We also ranked the top 10 marker genes for each cluster based on enrichment scores and presented the data in a heatmap (Fig. 1E). These markers distinguished subsets of myogenic cells and thus did not include well-established markers of MuSCs and myogenic progenitors that are common to several clusters, such as Pax7 and Myod. Overlapping the marker genes with genes expressed in MuSCs in Tabula Muris identified Clmn, Dhcr24, and Neu2 as unique genes of QSC, and Chodl as a unique gene of SSCs. Analysis of signature genes of IMBs suggest that most genes had shared-expression with another myogenic cluster (Fig. 1E). For example, IMB signatures Tnnt3 Klf2, Ankrd1, Chchd10 and Mical2 were also expressed in DSCs; Eno3 in PSCs; Igf1 in QSCs, Lyz2 in SSCs; Basp1 in ASCs. The co-expression of IMB markers with another myogenic cluster suggests that the IMB cluster represents a transient cell state encompassing all myogenic stages.
Generation of mouse Asb5 knockout model by CRISPR-Cas9 mediated genome editing
To explore the in vivo role of ASB5, we used CRISPR-Cas9 technique to knock out Asb5 gene [24], located on Chromosome 8 of mouse genome (Fig. 2A). We injected the Cas9 mRNA and sgRNAs targeting exon 4 of Asb5 in fertilized embryos (Fig. 2A, gRNA highlighted in blue). We identified a heterozygous mouse line carrying ~ 50 bp deletion in the targeted region*,* based on PCR and gel electrophoresis (Fig. 2B). Sanger sequencing of the PCR bands confirmed a 53-bp truncation within exon 4 (Fig. 2C). Murine ASB5 protein consists of 329 amino acids containing 6 Ankyrin repeats and a SOCS Box (Fig. 2D). The 53-bp deletion is predicted to cause frameshift and a premature stop codon, producing a truncated protein of 159 aa deprived of the functional SOCS Box (Fig. 2D). We have therefore successfully generated an Asb5 KO mouse line to study the function of ASB5 in vivo.Fig. 2. Generation of Asb5 knockout mouse by CRISPR-Cas9 mediated genome editing. A Gene structure and relative positions of a pair of gRNAs targeting exon 4 of mouse Asb5 gene. Exons from transcript isoform 1 (NM_029569.3) were annotated. The predicted cutting site for the 5’ and 3’ gRNA is located in codon Ser145 and Gln163, respectively. B Genotyping PCR result for F1 generation Asb5 knockout heterozygous (+/–) and wildtype control (+/+), and PCR amplification control (H_2_O). Band for wildtype (WT) allele is 481 bp, band for mutant allele is 428 bp. C Chromatogram traces obtained from Sanger sequencing analysis of the purified genotyping PCR products for a heterozygous mouse. D Comparison of protein domains encoded by wildtype and the mutant alleles
ASB5 is dispensable for skeletal muscle development
We performed qPCR to examine expression of Asb5 in various tissues of wildtype mice. The analysis show that Asb5 is highly expressed in skeletal muscles (EDL, soleus, diaphragm) and primary myoblasts (PMB), moderately expressed in heart muscles, and with little or no expression in brain, brown adipose tissue (BAT), inguinal white adipose tissue (iWAT), kidney, liver, spleen and lung (Fig. 3A). This result suggests that Asb5 KO should mainly affect the skeletal muscles.Fig. 3ASB5 is dispensable for skeletal muscle development. A Relative expression of Asb5 across different body tissues (n = 4; mean ± SD). B Body Weight of WT and KO mice at 4 to 7 weeks old, measured weekly (n = 4; mean ± SD). C H&E staining on TA muscle sections. Scale bar, 50 µm. D Immunofluorescence staining for DAPI (nuclei), PAX7 (satellite cell marker) and Laminin (n = 4; mean ± SD). Scale bar, 50 µm.** E,F** Quantification of satellite cells (E) and fiber area (F). (n = 4). G Immunofluorescence staining of Pax7 and MyoD on single myofiber after 72 h culture. Scale bar, 50 µm. H-I. Quantification of cell numbers per cluster (H) and fractions of Pax7^+^/MyoD^−^, Pax7^+^/MyoD^+^, and Pax7^−^/MyoD.^+^ cells (I). (n = 4 pairs of mice, roughly 20 myofibers were quantified from each mouse). The data are presented as mean ± S.E.M, ns: p > 0.05
We crossed the heterozygous founder mice with WT to generate F1 heterozygous males and females, which were subsequently bred to generate homozygous Asb5 KO mice. The Asb5 KO mice were born at an expected 25% Mendelian ratio from heterozygous breeders and were indistinguishable from heterozygous and wildtype littermates. These observations suggest that the Asb5 KO does not affect embryonic development of mice. We next monitored growth of the WT and KO mice for 4 consecutive weeks and found there was no difference in body weight, (Fig. 3B), suggesting normal postnatal growth of the Asb5 KO mice.
To understand the potential impact of Asb5 KO on skeletal muscles, we performed H&E staining on TA muscle and found that the muscle morphology and myofiber size were indistinguishable between Asb5 KO and wildtype littermates (Fig. 3C). Additionally, we performed immunohistochemistry staining of PAX7 to mark MuSCs and Laminin to outline myofiber boundary (Fig. 3D). Quantitative analysis showed that the number of PAX7^+^ MuSCs per area (Fig. 3E) and myofiber cross sectional area (Fig. 3F) were identical between Asb5 KO and WT groups. Therefore, Asb5 KO does not affect generation of MuSCs or skeletal muscle development and growth.
We further analyzed behavior of MuSCs cultured on EDL myofibers for 72 h. The cultured myofibers were then fixed and stained for PAX7 and MyoD (Fig. 3G). Using this model, the proliferation, differentiation, and self-renewal of MuSCs are marked by PAX7^+^/MyoD^+^, PAX7^−^/MyoD^+^ and PAX7^+^/MyoD^−^, respectively. Quantitative analysis revealed no differences between the total number of cells in the Asb5 KO and WT groups (Fig. 3H). There is also no difference between the proportions of PAX7^+^/MyoD^+^, PAX7^−^/MyoD^+^ and PAX7^+^/MyoD^−^ cells between the two groups (Fig. 3I). Therefore, Asb5 KO has no effect on proliferation, differentiation, or self-renewing properties of MuSCs.
Loss of Asb5 does not impair the skeletal muscle regeneration
To explore if Asb5 KO affects MuSC-mediated skeletal muscle regeneration, we employed a model of acute injury induced by Barium Chloride, or BaCl2 [9, 28]. We injured the tibialis anterior (TA) muscle by focal injection of 50 µl BaCl_2_ (1.2% in ddH_2_O) and analyzed the injected muscles at 5.5 dpi, when regeneration peaks. H&E staining revealed no obvious differences in muscle morphology and regenerated myofiber structure between WT and Asb5 KO mice (Fig. 4A). We also performed immunofluorescence staining on injured TA sections with PAX7 to mark MuSCs [26] and Laminin to mark myofiber ECM (Fig. 4B). Quantification showed that there was no difference in the number of MuSCs per area between two genotypes (Fig. 4C). We further stained TA sections with embryonic myosin heavy chain (eMyHC) to mark newly regenerated myofibers and dystrophin to mark myofiber membrane (Fig. 4D), but there was no difference in size of regenerated myofibers between the two genotypes (Fig. 4E). These data together demonstrate that ASB5 is dispensable for skeletal muscles regeneration after acute injury.Fig. 4. The absence of ASB5 does not impair skeletal muscle regeneration. A H&E staining of TA muscle sections at 5.5 DPI. Scale bar, 50 µm (B) Immunofluorescence staining for DAPI (nuclei), PAX7 (satellite cell marker) and Laminin (extracellular matrix) in TA muscle sections. Scale bar, 50 µm (C) Quantification of MuSC cells per TA area at 5.5 DPI (n = 4; mean ± SD). D Immunofluorescence staining for eMyHC and Dystrophin of TA muscle sections at 5.5 DPI. Scale bar, 50 µm. E Quantification of myofiber cross section area at 5.5 DPI (n = 4; mean ± SD). F-G Quantitative RT–PCR (qPCR) analysis of Asb5, IL-1, IL-6, TNF-a, CD68 and Adgre1 (F4/80) from non-injured (F) and 5.5 DPI (G) TA muscles (n = 4 pair of mice at each time point). The data are presented as mean ± S.E.M. *p < 0.05, **p < 0.01, ns: p > 0.05
As the SOCS Box of ASB5 is thought to regulate cytokine signaling, we examined if Asb5 KO alters expression of inflammatory cytokines (Il1, Il6, Tnfa) and macrophage markers (CD68, Adgre1 – encoding F4/80). The qPCR analysis of non-injured (Fig. 4F) and injured TA muscles at 5.5 dpi (Fig. 4G) confirmed that Asb5 expression is completely abolished in the KO muscles. We only observed a significant reduction of Tnfa expression in non-injured muscles (Fig. 4F) and a ~ 50% but non-significant reduction in the injured muscles (Fig. 4G) of the Asb5 KO mice. The levels of Il1 also exhibited a tendance to decrease in the KO muscles (Fig. 4F, G). Asb5 KO had no effect on the expression of other markers including Il6, Cd68, and Adgre1 (Fig. 4F, G). These results suggest that although Asb5 KO reduces TNF-α signaling, it does not negatively impact regeneration of healthy skeletal muscles.
Discussion
The members of ASB family have a remarkably diverse expression pattern and perform many essential functions in mammalian body. It is one of largest group of SOCS-box proteins which is expected to utilize N-terminal ankyrin repeats to recruit E3 ligases to promote protein degradation by ubiquitin proteasome system. Knockdown of ASB3 has been reported to promote mitochondria apoptosis by activating caspase 8 cleavage and increased level of autophagy in hepatocellular carcinoma [37]. Another study showed that ASB4 promotes differentiation of trophoblast cells into placental vasculature and loss of it during placenta formation leads to placental diseases [29]. Previous studies also have shown involvement of ASB5 in arteriogenesis [3]. A recent study has reported the redundant function of Asb5a/Asb5b in early cardiac development and function in zebrafish [5]. Other than these reports, the biological functions of ASB family proteins are largely unexplored. Our results indicate a dispensable role of ASB5 in skeletal muscle development and regeneration, despite its high expression at various stages of myogenesis. The lack of myogenic phenotypes in the Asb5 KO may be explained by redundant or compensatory function of other ASB proteins, several of which (ASB2, ASB3, ASB8, and ASB15) are also expressed in skeletal muscles and are involved in protein turnover. Of these, ASB2 and ASB15 have been shown to regulate proliferation and differentiation of MuSCs [10, 16]. Overexpression of ASB15 also increased myofiber area and protein synthesis [16]. These observations suggest that ASB family proteins might operate in compensatory pathway ensuring proper muscle homeostasis. Future studies including compound knockout of these ASB-family genes would validate this possibility.
Immune response after injury plays a vital role in regenerative response of skeletal muscles. Any physical or chemical insult to skeletal muscle tissue leads to recruitment of inflammatory cells including phagocytes and lymphocytes and they influence the satellite cell activation, proliferation and differentiation. Several cytokines including IL-1, IL-6 and TNF-α play a role in modulating muscle regeneration through regulating MuSCs [7], but how MuSCs communicate to the immune cells are poorly understood. We have recently identified a subset of myogenic cells that express immune cell markers, and name these cells immunomyoblasts or IMBs [22]. While the origin and function of IMBs are still under active investigation, it is hypothesized that these cells play a role in mediating crosstalk to immune cells by acting as antigen presenting cells [33]. In this study we show that Asb5 is highly expressed in IMBs. This observation suggests a role of ASB5 protein in mediating cytokine expression through the SOCS box. Consistently, we observe a reduced expression of TNF-α in muscles of the Asb5 KO mice. This observation suggests that ASB5 may augment normal immune response. Interestingly, ASB5 expression is enriched in immunomyoblasts, hinting a mechanistic link where ASB5 may coordinate an immune-stem cell crosstalk, and dynamic levels of ASB5 may trigger initial inflammation and timely resolution of inflammation in regenerating muscles. The reduced level of TNF-α in the Asb5 KO muscle should normally accelerate regeneration, but the effect may have been masked in young healthy mice as they exhibit excellent regenerative capacity. It would be interesting to determine in future studies if Asb5 KO improves regeneration of dystrophic and cachectic muscles that are characterized by elevated TNF-α signaling [17, 30].
Conclusion
This study identifies ASB5 as a specific marker highly expressed at various stages of muscle satellite cells. In addition, single cell RNA-seq analysis revealed several markers distinguishing satellite cells at different regenerative stages. An Asb5 knockout mouse line was also generated, but analysis of the knockout mice indicates a dispensable role of ASB5 in muscle regeneration of young mice under normal physiological conditions.
Limitations of the study
Our study has identified Asb5 as a gene enriched at mRNA level in myogenic lineage cells in resting and regenerating skeletal muscles. However, unavailability of a specific ASB5 antibody has precluded the examination of ASB5 protein levels and dissection of ASB5 interacting proteins. We have further demonstrated that ASB5 is dispensable for skeletal muscle development and regeneration, but we have not examined if Asb5 KO promotes muscle regeneration in aged muscles or under pathological conditions. Given the reduced levels of TNF-α in Asb5 KO muscles, it remains of interest to investigate whether ASB5 expressing immunomyoblasts mediates intercellular communication between myogenic cells and immune cells. A third limitation is the different injury models used in this study (BaCl_2_) and our previous scRNA-seq study where we identified immunomyoblasts after cardiotoxin-induced muscle injury. BaCl_2_ and cardiotoxin differ in their mechanisms of action and effect on host inflammatory response [9]. Such differences may compromise direct comparison of transcriptional profiles among datasets. Lastly, although our study focused on skeletal muscles that highly express Asb5, the potential effects of Asb5 KO on other tissues that express moderate (heart) or low level of Asb5 warrants future investigation.