Harnessing apidaecin capability to improve intestinal health and inhibit Salmonella Typhimurium transmission in laying hens

TL;DR

Adding apidaecin to laying hens' diets improves gut health and reduces Salmonella contamination in eggs.

Contribution

Apidaecin's effectiveness in reducing Salmonella transmission and improving intestinal health in laying hens is demonstrated.

Findings

Apidaecin at 500 mg/kg improved intestinal barrier function and reduced Salmonella loads in hens.

Apidaecin increased beneficial gut bacteria and decreased harmful pathogens in the cecum.

In vitro tests confirmed apidaecin inhibits Salmonella adhesion and invasion of intestinal cells.

Abstract

Apidaecin (Api), an antimicrobial peptide, exhibits in vitro efficacy against Salmonella Typhimurium (S. Typhimurium) and enhances broiler growth performance via modulation of intestinal barrier function. This study evaluated the effects of dietary apidaecin on intestinal health in laying hens and its potential to mitigate S. Typhimurium infection and egg contamination. A total of 288 Hy-Line grey layers (45-wk-old) were randomly allocated to 4 dietary treatments (6 replicates per treatment, 12 birds per replicate). Basal diet supplemented with 0 (Con), 300 (Api300), 500 (Api500), or 700 (Api700) mg/kg apidaecin for 12 wk. Based on intestinal barrier function assessment, 18 hens each from the Con and Api 500 groups were selected for S. Typhimurium challenge. Apidaecin’s inhibitory effects on S. Typhimurium adhesion and invasion were further assessed using an in vitro intestinal epithelial cell model. Data were analyzed using one-way ANOVA with Duncan’s post-hoc test for multi-group comparisons and independent t-tests for 2-group comparisons. Results indicated that daily feed intake, crypt depth and villus height to crypt depth ratio (V/C) of intestinal tract showed a quadratic response (P < 0.05) to increasing levels of apidaecin supplementation. Apidaecin (500 mg/kg) significantly reduced feed intake (1.76%), jejunal (29.04%), and ileal crypt depth (31.04%), while increasing duodenal (24.41%), jejunal (45.15%), and ileal V/C (36.39%) vs. control (P < 0.05). Apidaecin significantly increased (P < 0.05) the relative abundance of beneficial short-chain fatty acid-producing bacteria (e.g. Phascolarctobacterium and Desulfovibrio), while reducing (P < 0.05) the relative abundance of enteritis-associated pathogens (e.g. Actinobacillus) of cecum. These beneficial effects were maximized at the 500 mg/kg diet level. Post-challenge, Api 500 hens exhibited increased (P < 0.05) jejunal and ileal V/C ratios and ileal secretory IgA expression compared to controls. Furthermore, apidaecin supplementation significantly reduced (P < 0.05) S. Typhimurium loads in the ileum, spleen, liver and on eggshells. In vitro assays confirmed apidaecin’s direct inhibition (P < 0.05) of S. Typhimurium adhesion to and invasion of intestinal epithelial cells. Collectively, these findings support the potential of dietary apidaecin supplementation in poultry feed formulations to enhance intestinal health and improve the food safety of egg products by reducing Salmonella contamination.

Dietary supplementation with apidaecin in laying hen feed modulates the gut microbial community structure, enhances intestinal function, and reduces Salmonella titers in hens by inhibiting bacterial adhesion to and invasion of intestinal epithelial cells, thereby preventing Salmonella transmission.

Figures

Effects of apidaecin supplementation on antioxidant properties and immunity in serum of laying hens. A: IgA; B: IgG; C: IgM; D: T-SOD, total superoxide dismutase; E: GSH-Px, glutathione peroxidase; F: MDA, malondialdehyde. Con, laying hens fed with basal diet; Api300, laying hens fed basal diet supplemented with 300 mg/kg apidaecin; Api500, laying hens fed basal diet supplemented with 500 mg/kg apidaecin; Api700, laying hens fed basal diet supplemented with 700 mg/kg apidaecin. n = 6 replicates per treatment group. Values are represented as mean ± SEM. *P < 0.05.

Effects of dietary apidaecin supplementation on intestinal health of laying hens. (A) Representative photomicrographs of duodenum, jejunum, and ileum with HE staining. Magnification was 4×. (B) The relative mRNA expression of tight junction proteins and Mucin-2 in ileum mucosa. (C) The level of sIgA in ileum mucosa. Con, laying hens fed with basal diet; Api300, laying hens fed basal diet supplemented with 300 mg/kg apidaecin; Api500, laying hens fed basal diet supplemented with 500 mg/kg apidaecin; Api700, laying hens fed basal diet supplemented with 700 mg/kg apidaecin. n = 6 replicates per treatment group. Values are represented as mean ± SEM. *P < 0.05.

Dietary apidaecin supplementation modulated cecal microbial composition in laying hens. (A) Alpha-diversity analysis of cecal microbial communities. (B) Principal coordinate analysis (PCoA) of the cecal microbiota based on weighted Unifrace. (C) Histogram of the liner discriminant analysis (LDA) score computed for differentially abundant taxa. (D) Relative abundance of cecal microbial composition at the phylum and genus level. Con, laying hens fed with basal diet; Api300, laying hens fed basal diet supplemented with 300 mg/kg apidaecin; Api500, laying hens fed basal diet supplemented with 500 mg/kg apidaecin; Api700, laying hens fed basal diet supplemented with 700 mg/kg apidaecin. n = 6 replicates per treatment group. *P < 0.05.

The differential cecal microbiota with apidaecin supplementation in laying hens. (A) Relative abundance of cecal microbial community members at the phylum and genus level. (B) Pearson correlation between cecal microbiota and intestinal parameters. Con, laying hens fed with basal diet; Api300, laying hens fed basal diet supplemented with 300 mg/kg apidaecin; Api500, laying hens fed basal diet supplemented with 500 mg/kg apidaecin; Api700, laying hens fed basal diet supplemented with 700 mg/kg apidaecin. n = 6 replicates per treatment group. *P < 0.05. P < 0.01. *P < 0.001.

Effects of apidaecin supplementation on antioxidant properties and immunity in serum of laying hens. A: IgA; B: IgG; C: IgM; D: T-SOD, total superoxide dismutase; E: GSH-Px, glutathione peroxidase; F: MDA, malondialdehyde. Sal, laying hens fed with basal diet and challenged with S. Typhimurium; Sal+Api, laying hens fed with apidaecin-supplemented diet and challenged with S. Typhimurium. n = 6 replicates per treatment group. Values are represented as mean ± SEM. *P < 0.05.

Effects of apidaecin on intestinal barrier function after S. Typhimurium infection. (A) Representative photomicrographs of duodenum, jejunum, and ileum with HE staining on the seventh day after challenging with S. Typhimurium. Magnification was 4×. (B) Villus height, crypt depth, and V/C of duodenum, jejunum, and ileum after challenging with S. Typhimurium. (C) The level of sIgA in ileum mucosa on the seventh day after challenging with S. Typhimurium. (D) The relative mRNA expression of tight junction proteins and Mucin-2 in jejunum and ileum mucosa. Sal, laying hens fed with basal diet and challenged with S. Typhimurium; Sal+Api, laying hens fed with apidaecin-supplemented diet and challenged with S. Typhimurium. n = 6 replicates per treatment group. Values are presented as mean ± SEM. *P < 0.05.

Effects of dietary apidaecin supplementation on S. Typhimurium numbers in tissues and eggs on the third day (A) and seventh day (B) after challenging with S. Typhimurium. Sal, laying hens fed with basal diet and challenged with S. Typhimurium; Sal+Api, laying hens fed with apidaecin-supplemented diet and challenged with S. Typhimurium. n = 6 replicates per treatment group. *P < 0.05.

(A) Determination of MIC. (B) Effects of apidaecin on cell activity. (C) Effects of apidaecin on S. Typhimurium adhesion to and invasion of intestinal epithelial cells in vitro. n = 6 replicates per treatment group. *P < 0.05. P < 0.01.

Tables

Table 1. Composition and nutrient levels of the experimental basal diet.

Ingredients	Content, %
Corn	62.5
Soybean meal (46% crude protein)	24.0
Soybean oil	0.5
Limestone	8.0
Premix1	5.0
Total	100.0
Nutrient levels2
Metabolizable energy, MJ/kg	11.17
Crude protein	16.05
Dry matter	89.55
Ether extract	3.20
Ash	9.81
Crude fiber	2.85
Calcium	3.14
Phosphorus	0.64
Available phosphorus	0.32
Lysine	0.87
Methionine	0.26

Table 2. Sequences of the primers used for quantitative real-time PCR for genes expression.

Genes	Primer sequence (5′-3′)	Accession No.	PCR size, bp
Claudin-1	F: CATACTCCTGGGTCTGGTTGGT R: GACAGCCATCCGCATCTTCT	NM_001013611	100
Occludin	F: ACGGCAGCACCTACCTCAA R: GGGCGAAGAAGCAGATGAG	XM_046904540	123
ZO-1	F: TATAGAAGATCGTGCGCCTCC R: GAGGTCTGCCATCGTAGCTC	XM_046925214	209
Mucin-2	F: TTCATGATGCCTGCTCTTGTG R: CCTGAGCCTTGGTACATTCTTGT	XM_040673077	93
β-Actin	F: ATTGTCCACCGCAAATGCTTC R: RAAATAAAGCCATGCCAATCTCGTC	NM_205518	113
Total bacteria	F: ACTCCTACGGGAGGCAGCAG R: ATTACCGCGGCTGCTGG	XM_041110399.1	152
Salmonella Typhimurium	F: TACAGGTGACTGCGGGCTTATC R: CTTACCGGGCAATACACTCACTA	NM_205751	199

Table 3. Effects of dietary apidaecin supplementation on production performance.

Items	Control	Dietary apidaecin supplementation, mg/kg diet1			SEM	P-value
		300	500	700		ANOVA	Linear	Quadratic
Week 1 to 4
Daily feed intake, g	108.55	108.43	109.07	111.15	0.59	0.351	0.138	0.191
Laying rate, %	85.27	89.19	87.90	85.11	1.33	0.664	0.990	0.451
Mean egg weight, g	62.77	61.61	62.37	62.36	0.30	0.599	0.763	0.563
Egg mass, g/hen/day	53.44	54.90	54.83	53.07	0.77	0.797	0.869	0.594
Feed to egg ratio	2.04	1.98	2.00	2.10	0.03	0.560	0.548	0.349
Week 5 to 8
Daily feed intake, g	116.21a	112.39b,c	111.83c	114.64a,b	0.54	0.007	0.177	0.020
Laying rate, %	86.95	89.23	88.05	84.09	1.15	0.462	0.433	0.268
Mean egg weight, g	62.56	61.05	61.58	62.17	0.30	0.298	0.669	0.176
Egg mass, g/hen/day	54.37	54.44	54.17	52.29	0.64	0.615	0.263	0.408
Feed to egg ratio	2.14	2.07	2.08	2.20	0.03	0.281	0.516	0.150
Week 9 to 12
Daily feed intake, g	117.42	115.52	114.88	118.05	0.48	0.053	0.955	0.032
Laying rate, %	85.54	89.77	87.66	82.48	1.36	0.280	0.469	0.141
Mean egg weight, g	62.98	61.82	62.14	63.38	0.61	0.224	0.727	0.107
Egg mass, g/hen/day	53.85	55.49	54.45	52.27	0.81	0.584	0.438	0.378
Feed to egg ratio	2.20	2.09	2.12	2.27	0.03	0.232	0.541	0.112
Week 1 to 12
Daily feed intake, g	113.92a	112.08b	111.92b	114.54a	0.37	0.014	0.822	0.006
Laying rate, %	85.87	89.39	87.86	83.93	1.21	0.429	0.616	0.243
Mean egg weight, g	62.77	61.49	62.03	62.64	0.28	0.373	0.894	0.228
Egg mass, g/hen/day	53.85	54.94	54.48	52.57	0.68	0.664	0.494	0.445
Feed to egg ratio	2.12	2.04	2.07	2.19	0.03	0.297	0.512	0.153

Table 4. Effects of dietary apidaecin supplementation on egg quality.

Items	Control	Dietary apidaecin contents, mg/kg diet1			SEM	P-value
		300	500	700		ANOVA	Linear	Quadratic
Week 4
Shell thickness, mm	0.33	0.34	0.34	0.35	<0.01	0.231	0.037	0.106
Shell strength, kg/cm2	4.12	4.73	4.68	4.39	0.12	0.306	0.497	0.182
Yolk color	5.78	5.72	5.72	5.61	0.09	0.949	0.361	0.449
Albumen height, mm	7.80	7.85	7.91	8.10	0.14	0.886	0.345	0.633
Haugh Unit	86.87	87.93	87.70	88.87	0.83	0.876	0.377	0.650
Week 8
Shell thickness, mm	0.34	0.34	0.34	0.33	<0.01	0.231	0.125	0.250
Shell strength, kg/cm2	5.04	4.75	4.72	4.61	0.09	0.450	0.038	0.119
Yolk color	5.28	5.75	5.39	5.78	0.09	0.098	0.156	0.361
Albumen height, mm	7.44	7.55	7.87	7.67	0.18	0.883	0.315	0.611
Haugh Unit	84.90	86.01	87.14	87.17	1.23	0.915	0.474	0.774
Week 12
Shell thickness, mm	0.36a	0.35a	0.36a	0.34b	<0.01	0.023	0.036	0.100
Shell strength, kg/cm2	4.68	4.61	4.97	4.43	0.09	0.509	0.562	0.848
Yolk color	5.39	5.53	5.56	5.22	0.07	0.314	0.832	0.521
Albumen height, mm	7.59	7.71	8.15	7.64	0.15	0.512	0.688	0.526
Haugh Unit	85.21	85.70	89.44	86.26	1.03	0.489	0.562	0.443

Table 5. Effects of dietary apidaecin supplementation on morphological structure of intestinal mucosa.

Items	Control	Dietary apidaecin contents, mg/kg diet1			SEM	P-value
		300	500	700		ANOVA	Linear	Quadratic
Duodenum
Villus height, μm	1743.72	1865.31	1786.55	1784.74	30.65	0.581	0.972	0.923
Crypt depth, μm	154.80	134.26	132.37	130.34	18.88	0.078	0.003	0.003
V/C	10.90b	13.87a	13.56a	13.85a	0.32	<0.001	0.001	<0.001
Jejunum
Villus height, μm	1089.00	1097.48	1158.36	1334.19	38.88	0.107	0.071	0.019
Crypt depth, μm	135.04a	100.65b	95.83b	123.63a	4.25	<0.001	0.519	<0.001
V/C	8.04c	10.11b	11.67a	10.30a,b	0.36	<0.001	0.006	0.002
Ileum
Villus height, μm	706.63	681.50	689.07	656.80	22.83	0.902	0.675	0.625
Crypt depth, μm	115.89a	88.08b	79.92b	89.92b	3.72	0.001	0.002	0.002
V/C	6.10b	7.84a	8.32a	7.38a,b	0.29	0.027	0.031	0.008

Full text

Introduction

Foodborne pathogens like Salmonella Typhimurium pose a risk to poultry product safety and public health. During 2020, eggs and their derivative products were the source of 44.0% of Salmonella outbreaks reported across the European Union (EFSA and ECDC 2023). Salmonella can colonize the intestinal tracts of laying hens to initiate infections and rapidly transmit to other tissues such as liver and the reproductive tracts, subsequently leading to egg contamination. Eliminating the infected flocks, or the use of antibiotics, represent conventional approaches to managing Salmonella in poultry (Wegener et al 2003; WHO 2007; Dolowschiak et al 2016). However, owing to the challenge of discerning clinical symptoms and the rising concern of bacterial resistance, it is urgently required to develop an effective measure to control Salmonella to guarantee egg products using non-antibiotic alternatives.

Antimicrobial peptides (AMPs) are small proteins with potent antibacterial activity (Wang et al 2019; Lazzaro et al 2020), which are candidates for the replacement of traditional antibiotics in suppressing harmful bacteria (Cardoso et al 2019; Rodrigues et al 2022). Numerous AMPs, including β-defensins, cecropin, and Microcin J25, have been proved to improve poultry production metrics and enhance gut mucosal integrity, particularly through their capacity to suppress pathogenic colonization by microorganisms associated with zoonotic transmission risks (Wang et al 2016; Silveira et al 2021). Apidaecins, one of the best characterized short Pro-rich AMPs, are isolated from lymph fluid of bacteria-infected honeybees (Apis mellifera) (Casteels et al 1989). Apidaecins have been shown antibacterial activity predominantly against Gram-negative bacteria including a wide range of zoonotic bacterial pathogens, like Escherichia coli, S. Typhimurium and Agrobacterium tumefaciens (Otvos 2002). Apidaecin executes its antimicrobial function by first permeating and traversing the outer membrane in a non-specific manner, then passing through the inner membrane. Subsequently, it translocates into the cell interior where it targets and disrupts critical intracellular components (Otvos et al 2005; Skowron et al 2023). Moreover, researchers recently found that apidaecin Api-PR19 can modulate the beneficial gut microbiota of broilers to improve intestinal structure and immune functions (Wu et al 2020), which confirms its potential alternative to antibiotics. Therefore, apidaecin demonstrates potential to inhibit pathogen colonization and infection while enhancing intestinal barrier functions, making it a promising candidate for blocking pathogen transmission into raw fresh eggs. However, the experimental evidence supporting this hypothesis is still lacking.

This study was designed to assess the anti-Salmonella effects of apidaecin facilitated by consolidation of layer intestinal barriers and its utilization in blocking the transmission of Salmonella from laying hens to fresh raw eggs. Our finding will provide a better understanding of how apidaecin enhances intestinal epithelial barrier function against bacterial infection, which may further develop a preventive strategy for reducing the risk of egg contamination from layer enteric pathogens.

Material and methods

Ethics statement

The experiment was conducted in accordance with the laboratory animal management and ethical review of Northwest A&F University (No. DK2022061).

Apidaecin

The apidaecin used in this study contained 1 × 10^6^ units of active polypeptide per gram and was obtained from the Gansu Aolinbeier Biotechnology Group Co., Ltd. (Zhangye, Gansu, China). This bee-derived peptide is a characteristic proline-rich polypeptide with the primary amino acid sequence PRVRRPVYIPQPRPPHPRL (Wang et al 2024a).

Feed and animals

A total of 288 45-wk-old Hy-Line grey laying hens (Julong Poultry Co., Ltd., Shaanxi China) were stratified into 4 experimental groups, each comprising 6 replicates of 12 birds. Uniform environmental conditions were maintained across all housing units. The diet formula (Table 1) was formulated according to NRC recommendations (1994) and Chinese Feeding Standard of Chicken. The control group (Con) was fed a basic diet, while Api300, Api500 and Api700 groups were fed the basic diet supplemented with 300, 500, and 700 mg/kg diet apidaecin respectively for 12 wk. A 2-wk trial (pre-feeding) period was conducted prior to the formal experiment. Water and feed were provided unlimited.

Feeding management

The poultry were housed in cage-based facilities under controlled environmental conditions, with ambient temperature regulated between 22 and 25°C. A 16-hour photoperiod was implemented, complemented by a hybrid ventilation system combining natural air circulation with horizontal negative-pressure mechanisms. Feeding occurred at 3 fixed intervals (09:00, 14:00, and 19:00 hours) daily, with egg collection consistently performed at 15:00. Standard operating procedures were followed for all vaccination and sanitation protocols.

Measurement of production performance and egg quality

Eggs from each replicate were collected daily to record the number and egg weight. Residual feed quantities were subtracted from the initial feed provision to quantify intake. Throughout the trial, daily feed intake, egg production rate, mean egg weight, egg mass, and feed efficiency were computed. We randomly collected 3 eggs from each replicate across all experimental groups at weeks 4, 8, and 12 for quality characterization using Egg Tester Ultimate (Orka Food Technology Co., Ltd., Israel). Parameters assessed included: shell thickness, shell strength, albumen height, yolk color, and Haugh units (calculated from weight and albumen height) (Hisasaga et al 2020).

Salmonella Typhimurium (S. Typhimurium) challenge

At the end of 12 wk, since the production performance of the Api500 group is better, we used birds of this group for the following test. Prior to the trial, we confirmed the birds were free of S. Typhimurium by PCR testing of fecal samples, as described in Oliveira et al. (2002). Primers are presented in Table 2. Eighteen birds were selected from the Con group and the Api500 group respectively for S. Typhimurium challenge. Six replicates were assigned to each group, each comprising 3 birds. The S. Typhimurium was resuscitated in sterile buffered peptone water under 37 °C shaking incubation (16 to 18 h). Primary enrichment cultures were plated onto deoxycholate hydrogen sulfide lactose agar for 24 h at 37 °C. A representative colony was transferred to buffered peptone water and shake-cultured at 37 °C (12 h), then adjusted to 1 × 10^9^ CFU/mL in saline. The selected birds received 1 mL bacterial suspension 1 × 10^9^ CFU via oral gavage.

Sample collection and processing

Serum, cecal contents, and tissue samples (including spleen, liver, and intestinal mucosa) were collected and stored at −80°C. On days 3 and 7 post-S. Typhimurium challenge, 6 chickens per group were euthanized for aseptic collection of spleen, liver, oviduct, and intestinal mucosa per tissue for Salmonella enumeration. The sample collection protocol was consistent with our laboratory’s prior published work (Feng et al 2023).

Intestinal histology and ileal immunity

Following fixation in 4% paraformaldehyde, duodenal, jejunal, and ileal segments were processed: trimming, paraffin embedding, and sectioning at 5 µm. Sections were hematoxylin-eosin (HE) stained and morphometrically evaluated by light microscopy, with 6 birds × 2 sections × 10 fields per group assessed for villus height and crypt depth. Concurrently, ileal mucosa was homogenized in saline (10 min centrifugation at 3,000 × g). Clarified supernatants, stored at −20°C, were subjected to ELISA quantification of secretory immunoglobulin A (sIgA) (Shanghai Preferred Biotechnology Co., Ltd., Shanghai, China).

Detection of S. Typhimurium in tissues and eggs

Samples of liver, spleen, jejunum, ileum and oviduct were weighted, homogenized with sterile saline at 1:9. Shells were wiped with swabs soaking in sterile buffered peptone water while egg white and yolk mixture was dipped with swabs. Put swabs and samples into 5 mL of buffered peptone water to incubate at 37 °C with shaking for 16 h. DNA of S. Typhimurium was extracted from 1 mL of bacterial solution by boiling. Extracted DNA was tested for S. Typhimurium and total bacteria by a qPCR (Cui et al 2023). Primers for our assay are presented in Table 2. Quantitative analysis of S. Typhimurium utilized a standard curve calibrated against genomic DNA copy numbers. The results were reported as S. Typhimurium log_10_ DNA copies/g for qPCR counts.

Real-time quantitative PCR (RT-qPCR)

Total RNA extraction employed Trizol reagent (Solarbio, China) following the manufacturer’s protocol. RNA quality was assessed via dual approaches: 1) electrophoretic integrity confirmation on 1% agarose gels, and 2) visco-spectrophotometric analysis of concentration per purity (NanoReady system). Subsequent cDNA synthesis utilized the AG21102 kit (Accurate Biological, China). β-Actin mRNA levels quantified for sample normalization. Target gene amplification was performed on a CFX96 thermocycler (Bio-Rad, USA) with 3 technical replicates. Primer efficiency was determined by serial dilution analysis. All primers demonstrated efficiencies of 95% to 105%, meeting the requirements for accurate quantification using the 2^(−ΔΔCt)^ method. The stability of β-actin as a reference gene was validated per MIQE guidelines. Briefly, geNorm analysis showed an M-value of 0.28 across all samples (n = 24), with inter-group CV < 4.5%. Amplification efficiency was 98.3% (R^2^ = 0.998), and melting curves confirmed single-product specificity. No genomic DNA contamination was detected (ΔCt > 7 in -RT controls).

Serum biochemical indices

Glutathione peroxidase (GSH-Px), total superoxide dismutase (T-SOD) and malondialdehyde (MDA) concentration in the serum were determined with assay kits (Nanjing Jiancheng Bioengineering Institute, China). immunoglobulin A (IgA), immunoglobulin M (IgM) and immunoglobulin G (IgG) in serum were measured with ELISA (Nanjing Jiancheng Bioengineering Institute, China).

Bioinformatic analysis of microbial

Microbial genomic DNA from cecal contents was purified via the cetyltrimethylammonium bromide method (Nobleryder, China). Targeted amplification of 16S rRNA V3-V4 regions used barcoded primers 341F/806R. Quality-controlled sequences were binned into operational taxonomic units (OTUs) (97% identity threshold). Raw sequence data were processed using the QIIME2 pipeline with the DADA2 plugin, which performed quality filtering (removing low-quality reads), denoising (correcting sequencing errors), merging of paired-end reads, and chimera removal to generate amplicon sequence variants (ASVs). The resulting high-quality sequences were then clustered into OTUs for downstream analysis. The reference database used for taxonomic assignment was Greengenes Database 13_8. Five alpha diversity parameters—Chao1, Shannon, Simpson, Observed_features, and Faith’s PD—were computed. Beta diversity was calculated to evaluate the similarity between groups and then visualized via principal coordinate analysis (PCoA). Linear discriminant analysis (LDA) combined effect size measurements (LEfse) were further employed to identify the biological differences in the microbial composition among groups. Sequencing data are available in the National Center of Biotechnology Information Sequence Read Archive database (accession number: PRJNA1394628).

Cell culture

The porcine intestinal epithelial cell line IPEC-J2 donated by RSBM cell bank. Dulbecco’s Modified Eagle Medium, formulated with 10% heat-inactivated fetal bovine serum (Gibco/Life Technologies), plus penicillin-streptomycin cocktail (100 U/mL to 100 µg/mL; Gibco/Life Technologies), served as the culture substrate. Cells were incubated at 37 °C in a 5% CO_2_/90% air-humidified chamber.

Determination of minimum inhibitory concentration (MIC)

The minimum inhibitory concentration (MIC) of apidaecin against S. Typhimurium was assessed via broth microdilution. Briefly, bacterial suspensions (10^7^ CFU/mL in LB broth) were dispensed (100 μL/well) into 96-well microplates alongside apidaecin solutions (100 μL/well). Antimicrobial agent underwent 2-fold serial dilution (64 → 0.25 μg/mL in LB). After 24-hour incubation at 37 °C, MIC values were defined as the minimal concentration preventing visible bacterial growth (Kadeřábková et al 2024).

Bacterial adhesion and invasion assays

Microdilution broth method was used to detect the MIC of apidaecin was 16 µg/mL, so we used the sub-inhibitory concentration (SIC) of apidaecin that was 8 µg/mL to finish the following assays. Pre-assay viability confirmation utilized the Cell Counting Kit-8 (CCK-8) protocol on intestinal epithelial cell cultures. Positive controls: S. Typhimurium monoinfection in culture medium. Experimental group: Pathogen + apidaecin co-treatment in equivalent medium. Post 1-h incubation at 37 °C, infected monolayers underwent triple PBS washing. Adherent S. Typhimurium were liberated via 0.5% Triton X-100 lysis and quantified. For invasion assessment, cells were gentamicin-treated (50 µg/mL) in complete medium for 2 h after the initial infection period, followed by lysis and enumeration of internalized bacteria. All cell experiments included 3 biological replicates, defined as independent experiments performed on different days with freshly cultured cells (passage 3 to 7). For each biological replicate, cells were seeded from distinct frozen vials and cultured separately to ensure experimental independence. Within each biological replicate, 3 technical replicates (parallel plates) were included to assess procedural variability. Technical replicates were treated identically with the same cell suspension and reagents.

Statistical analysis

Data analyses were performed using SPSS 25 for statistical computation and GraphPad Prism 8 for visualization. For evaluating apidaecin treatment effects on production parameters, egg quality, and gut health indices, we implemented one-way ANOVA models incorporating treatment group as a fixed effect and biological replicate (n = 6 per group) as a random effect, with normality confirmed by Shapiro-Wilk tests (all *P *> 0.05) and variance homogeneity verified via Levene’s test. The longitudinal performance data were analyzed using mixed-effects models that accounted for treatment group, time (week), and their interaction as fixed effects, with individual animals nested within replicates as random effects, employing an autoregressive covariance structure to address temporal correlations. Significant ANOVA results (*P *< 0.05) were further examined using Duncan’s multiple range test for post-hoc comparisons, while Salmonella trial data were analyzed via independent t-tests with Welch’s correction when appropriate. The results are expressed as mean value and standard error of the mean (SEM), with *P *< 0.05 considered statistically significant.

Results

Production performance and egg quality with apidaecin supplement

Production performance metrics across different time periods are presented in Table 3, while corresponding egg quality parameters are shown in Table 4. A marked decrease (*P *< 0.05) in daily feed intake of Api300 group (112.08 g) and Api500 group (111.92 g) was evidenced in results compared with Con group (113.92 g) and Api700 group (114.54 g), and the daily feed intake showed a quadratic response (*P *< 0.05) to apidaecin supplementation. Feed intake demonstrated initial suppression (week 5 to 8, *P *< 0.05) followed by recovery across apidaecin gradients, attaining minimal values in the Api500 group. No statistically significant variations (*P *> 0.05) emerged in egg production rate, mean egg weight, egg mass, or feed conversion ratio across treatment cohorts during the trial. The only significant effect on egg quality was a reduction (*P *< 0.05) in eggshell thickness in Api700 (0.34 mm) vs. controls (0.36 mm) at week 12. No statistically discernible differences (*P *> 0.05) emerged in ancillary egg quality indices when comparing groups or temporal intervals.

Serum antioxidant capacity and immunity with apidaecin supplement

The effects of apidaecin-supplemented diets on serum parameters of laying hens were reported in Figure 1. GSH-Px activity was markedly elevated (*P *< 0.05) in both Api500 and Api700 cohorts relative to controls (Figure 1E). IgM level was significantly elevated (*P *< 0.05) in Api700 group compared with Con group (Figure 1C). However, Statistical analysis revealed non-significant (*P *> 0.05) intergroup variation across all groups for the concentration of T-SOD, MDA, IgA and IgG.

*Effects of apidaecin supplementation on antioxidant properties and immunity in serum of laying hens. A: IgA; B: IgG; C: IgM; D: T-SOD, total superoxide dismutase; E: GSH-Px, glutathione peroxidase; F: MDA, malondialdehyde. Con, laying hens fed with basal diet; Api300, laying hens fed basal diet supplemented with 300 mg/kg apidaecin; Api500, laying hens fed basal diet supplemented with 500 mg/kg apidaecin; Api700, laying hens fed basal diet supplemented with 700 mg/kg apidaecin. n = 6 replicates per treatment group. Values are represented as mean ± SEM. P < 0.05.

Effect of apidaecin on intestinal barrier function

The change of Intestinal morphology and structure in response to dietary apidaecin supplementation of laying hens were presented in Table 5. The representative picture of intestinal paraffin sections of each group was shown in Figure 2A. In the jejunum, both crypt depth and the V/C ratio showed significant quadratic responses (*P *< 0.05) to apidaecin levels (Table 5). The crypt depth in Api500 group decreased by 29.04% compared to the control group. Crypt depth decreased (*P *< 0.05) initially and then increased (*P *< 0.05), whereas the V/C ratio showed the opposite pattern. Similarly, the same results were observed in the ileum (*P *< 0.05). The V/C of duodenum in other 3 groups was increased (*P *< 0.05) significantly compared with the Con group (Table 5). Neither tight junction protein nor mucin gene expression exhibited apidaecin-induced differential regulation (*P *> 0.05) (Figure 2B). As illustrated in Figure 2C, the level of sIgA in ileum mucosa was significantly elevated (*P *< 0.05) in Api300 group and Api500 group compared with Con group.

*Effects of dietary apidaecin supplementation on intestinal health of laying hens. (A) Representative photomicrographs of duodenum, jejunum, and ileum with HE staining. Magnification was 4×. (B) The relative mRNA expression of tight junction proteins and Mucin-2 in ileum mucosa. (C) The level of sIgA in ileum mucosa. Con, laying hens fed with basal diet; Api300, laying hens fed basal diet supplemented with 300 mg/kg apidaecin; Api500, laying hens fed basal diet supplemented with 500 mg/kg apidaecin; Api700, laying hens fed basal diet supplemented with 700 mg/kg apidaecin. n = 6 replicates per treatment group. Values are represented as mean ± SEM. P < 0.05.

Effect of apidaecin on cecal microbiome

The results of cecal microbiome different were shown in Figure 3. The species richness (Observed_features and Chao 1) in Api300 group and Api500 were larger (*P *< 0.05) compared with Con group, neither Shannon nor Simpson diversity indices demonstrated statistically detectable variations across cohorts (Figure 3A). Dietary regimens failed to induce distinct clusters in the PCoA space (Figure 3B), as quantified by inter-sample dissimilarity metrics. LEFSe analysis were shown in Figure 3C. Inter-group divergence in bacterial relative abundance at taxonomic levels (phylum per genus) is presented in Figure 3D. Firmicutes and Bacteroidota are the mainly phyla, accounting for more than 75% of the whole phyla. Higher relative abundance of Firmicutes and Synergistetes was detected (*P *< 0.05) in Api500 and Api700 contrasted with the Con group (Figure 4A). The relative abundance of Phascolarctobacterium, Desulfovibrio in Api500 and Api700 increased (*P *< 0.05) significantly while the relative abundance of Prevotellaceae-Prevotella, Sphaerochaeta decreased (*P *< 0.05) significantly compared with the Con group (Figure 4A). Seven hundred mg/kg diet apidaecin increased (*P *< 0.05) the relative abundance of Eubacterium, Peptoccocus and Dorea compared with con group (Figure 4A). Pearson correlational metrics substantiated linkages between gut ­architectural remodeling and microbial community shifts (Figure 4B). The V/C in the ileum was positively (*P *< 0.05) correlated with Desulfovibrio, Dorea, Paludibacter and Phascolarctobacterium, while negatively (*P *< 0.05) correlated with Sphaerochaeta. The V/C of duodenum was positively correlated with Dorea, while negatively (*P *< 0.05) correlated with Prevotellaceae-Prevotella. The V/C of jejunum was positively (*P *< 0.05) correlated with Dorea and Phascolarctobacterium. Serum GSH-PX was positively (*P *< 0.05) correlated with Dorea, Peptococcus, Phascolarctobacterium and Desulfovibrio, while negatively (*P *< 0.05) with Odoribacter, Sphaerochaeta, Prevotellaceae-Prevotella, and Actinobacillus (Figure 4B).

*Dietary apidaecin supplementation modulated cecal microbial composition in laying hens. (A) Alpha-diversity analysis of cecal microbial communities. (B) Principal coordinate analysis (PCoA) of the cecal microbiota based on weighted Unifrace. (C) Histogram of the liner discriminant analysis (LDA) score computed for differentially abundant taxa. (D) Relative abundance of cecal microbial composition at the phylum and genus level. Con, laying hens fed with basal diet; Api300, laying hens fed basal diet supplemented with 300 mg/kg apidaecin; Api500, laying hens fed basal diet supplemented with 500 mg/kg apidaecin; Api700, laying hens fed basal diet supplemented with 700 mg/kg apidaecin. n = 6 replicates per treatment group. P < 0.05.

*The differential cecal microbiota with apidaecin supplementation in laying hens. (A) Relative abundance of cecal microbial community members at the phylum and genus level. (B) Pearson correlation between cecal microbiota and intestinal parameters. Con, laying hens fed with basal diet; Api300, laying hens fed basal diet supplemented with 300 mg/kg apidaecin; Api500, laying hens fed basal diet supplemented with 500 mg/kg apidaecin; Api700, laying hens fed basal diet supplemented with 700 mg/kg apidaecin. n = 6 replicates per treatment group. *P < 0.05. **P < 0.01. **P < 0.001.

Effects of apidaecin on serum antioxidant capacity and immunity after S. Typhimurium infection

The effects of feeding apidaecin on serum parameters of laying hens on the seventh day (Figure 5) after challenging with S. Typhimurium were reported. A marked enhancement (*P *< 0.05) in GSH-Px enzymatic function was recorded in Sal+Api group compared with Sal after challenging with S. Typhimurium. Statistically significant upregulation (*P *< 0.05) of MDA activity was observed in Sal+Api group compared with Sal after challenging with S. Typhimurium. The 2 cohorts exhibited comparable outcomes without statistical separation (*P *> 0.05) for the serum concentration of T-SOD, IgA, IgG and IgM.

*Effects of apidaecin supplementation on antioxidant properties and immunity in serum of laying hens. A: IgA; B: IgG; C: IgM; D: T-SOD, total superoxide dismutase; E: GSH-Px, glutathione peroxidase; F: MDA, malondialdehyde. Sal, laying hens fed with basal diet and challenged with S. Typhimurium; Sal+Api, laying hens fed with apidaecin-supplemented diet and challenged with S. Typhimurium. n = 6 replicates per treatment group. Values are represented as mean ± SEM. P < 0.05.

Effects of apidaecin on intestinal barrier function after S. Typhimurium infection

On the seventh day post-challenge, intestinal samples were made into HE-stained 5 µm sections (Figure 6A). Statistical analysis confirmed significantly elevated (*P *< 0.05) V/C indices in the jejunum and ileum of Sal+Api-treated subjects vs. the Sal group, but the villus height and crypt depth were not affected (*P *> 0.05) ­significantly by apidaecin (Figure 6B). Assessment of apidaecin’s impact on ileal barrier integrity included transcriptional profiling of tight junction genes, Mucin-2 mRNA, and sIgA immunoassay. Absence of statistical significance (*P *> 0.05) in Claudin-1, Occludin, ZO-1, and Mucin-2 at the mRNA levels of ileum and jejunum was observed in 2 groups (Figure 6C). Ileum mucosa sIgA level was significantly elevated (*P *< 0.05) in Sal+Api group on the seventh day post-challenge (Figure 6D).

*Effects of apidaecin on intestinal barrier function after S. Typhimurium infection. (A) Representative photomicrographs of duodenum, jejunum, and ileum with HE staining on the seventh day after challenging with S. Typhimurium. Magnification was 4×. (B) Villus height, crypt depth, and V/C of duodenum, jejunum, and ileum after challenging with S. Typhimurium. (C) The level of sIgA in ileum mucosa on the seventh day after challenging with S. Typhimurium. (D) The relative mRNA expression of tight junction proteins and Mucin-2 in jejunum and ileum mucosa. Sal, laying hens fed with basal diet and challenged with S. Typhimurium; Sal+Api, laying hens fed with apidaecin-supplemented diet and challenged with S. Typhimurium. n = 6 replicates per treatment group. Values are presented as mean ± SEM. P < 0.05.

Effect of apidaecin on S. Typhimurium numbers in tissues and eggs

Dysfunctional gut barrier permeability facilitates bacterial transmigration. Therefore, we checked the number of S. Typhimurium colonies in tissues and eggs. S. Typhimurium was undetectable in all specimens derived from unchallenged birds. The efficacy of apidaecin supplementation in reducing S. Typhimurium colonization and invasion was evaluated by using qPCR to count the number of S. Typhimurium challenge strain in liver, spleen, jejunum, ileum, oviduct, eggshell and egg liquid (Figure 7). It showed that on the third day post-challenge, S. Typhimurium was detected in all samples. S. Typhimurium burdens in the spleen and on eggshells were markedly diminished (*P *< 0.05) in Sal+Api-treated subjects relative to Sal controls. By 7 post-challenge, S. Typhimurium loads in all tissues were significantly reduced (*P *< 0.05) compared to day 3 levels. Notably, S. Typhimurium was undetectable in egg liquid at this timepoint. On the seventh day post-challenge, S. Typhimurium load of the liver, spleen, ileum and eggshell in Sal+Api group were robustly suppressed (*P *< 0.05) than Sal group. The results showed that compared with Sal group, S. Typhimurium load in spleen and eggshell was significantly suppressed (*P *< 0.05) in Sal+Api group, which indicated that apidaecin could reduce egg S. Typhimurium load.

*Effects of dietary apidaecin supplementation on S. Typhimurium numbers in tissues and eggs on the third day (A) and seventh day (B) after challenging with S. Typhimurium. Sal, laying hens fed with basal diet and challenged with S. Typhimurium; Sal+Api, laying hens fed with apidaecin-supplemented diet and challenged with S. Typhimurium. n = 6 replicates per treatment group. P < 0.05.

S. Typhimurium adhesion to and invasion of intestinal epithelial cells in vitro

We used the sub-inhibitory concentration (SIC) of apidaecin (8 µg/mL) to detect adhesion and invasion, which couldn’t inhibit the growth of S. Typhimurium (Figure 8A). As showed in Figure 8B, the addition of apidaecin to the medium could not affect (*P *> 0.05) the cell activity. The ability of apidaecin to inhibit S. Typhimurium colonization of intestinal epithelial cells was assessed by adhesion and invasion assays. Apidaecin significantly attenuated (*P *< 0.05) S. Typhimurium adhesion and invasion of intestinal epithelia, as empirically validated in Figure 8C.

*(A) Determination of MIC. (B) Effects of apidaecin on cell activity. (C) Effects of apidaecin on S. Typhimurium adhesion to and invasion of intestinal epithelial cells in vitro. n = 6 replicates per treatment group. *P < 0.05. *P < 0.01.

Discussion

*Salmonella-*contaminated eggs pose a risk to food safety and human health, and preharvest interventions, such as antimicrobial peptide (AMP), have shown potential in reducing pathogen colonization in live birds and controlling egg contamination (Li et al 2006). Apidaecin as an AMPs was demonstrated to have ­antibacterial activity against several zoonotic pathogen colonization, including Salmonella (Obe et al 2023). Besides, recent studies reported beneficial effects of apidaecin on intestinal health of chickens and rumen microbiome of castrated bulls (Wu et al 2020; Shi et al 2023), which exhibit great potential to block Salmonella transmission from the intestinal tract. However, there is no available information concerning the application of apidaecin in laying hens. Thus, the current study evaluated the effects of apidaecin on production performance and intestinal health in laying hens and investigated whether apidaecin could be helpful for controlling S. Typhimurium infection and egg contamination. These findings would provide a theoretical basis for the practical application of apidaecin for laying hens and the development of decontamination measures through preharvest interventions.

Antimicrobial peptides appeared as a promising antibiotic alternative without drug resistance and residue (Ji et al 2024), which has been widely used in the animal production due to its beneficial effects on animal production performance and immune function (Rodrigues et al 2021). Previous studies showed that AMPs have beneficial effects on production performance, egg quality and antioxidative status in laying hens (Xu et al 2022). Furthermore, apidaecin was demonstrated to improve the feed conversion efficiency in broilers. No apidaecin-associated modulation of egg yield was observed; however, equivalent laying performance persisted under conditions of depressed dietary intake. Appetite in birds is controlled by a complex metabolic pathway via several hormones (Shojaei et al 2020). There was no available information on the effects of AMPs on appetite regulation in birds. Numerous studies supported that gut microbiota and their metabolites play a profound influence on eating behavior in humans and animals (Te Pas 2020; Han et al 2021). For example, short chain fatty acids-producing microbiota involve in the long-term regulation of host appetite via energy metabolism; acetate can suppress appetite through central effects (Fetissov 2017). Additionally, the incorporation of apidaecin into the diet elevated the levels of serum IgM and GSH, suggesting an enhancement in both the antioxidant capacity and immune status of laying hens. This aligns with findings by Li et al. (2025), who further demonstrated that apidaecin modulates the gut microbiota to enhance mice immune function.

A complete intestinal morphology plays a decision role in nutrient absorption, defense against pathogenic infection and immune response of the host (Xie et al 2021; Kong et al 2023). Many studies have shown that dietary supplementation with AMPs can enhance intestinal morphology in broilers and laying hens, reflected by the increased V/C ratio and decreased VH (Choi et al 2013; Yin et al 2023). Our current study indicated that laying hens exhibited a shallower CD and higher V/C ratio in response to dietary apidaecin addition, displaying the potential to maintain a favorable intestine structure and gut health. Consistent with our findings, diets supplemented with apidaecin decreased CD and V/C ratio of duodenum and jejunum of Arbor Acre broilers (Wang et al 2024). Furthermore, our research had found that apidaecin increased the level of sIgA in the intestinal mucosa. sIgA governs intestinal equilibrium in laying hens by modulating mucosal immunity-serving as the linchpin of adaptive defense systems that sustain barrier integrity via polymechanistic interventions (Mantis et al 2011). Increased secretion of immunoglobulins induced by apidaecin can reinforce the mucosal immune response and barrier function, likely contributing to preventing epithelial adhesion and invasion by pathogens. The regulatory effects of apidaecin on intestinal morphology and immune function have been demonstrated in numerous studies to be contingent upon alterations in the intestinal flora, as the transmembrane ability of apidaecin was high specific for bacteria rather than intestinal cells (Li et al 2006; Skowron et al 2023; Dehsahraee et al 2024).

The regulation of apidaecin on gut microbiota homeostasis was an important way to improving production performance and immunity on animals. As anticipated in our study, dietary supplemented with 500 mg/kg diet apidaecin increased Chao1 and observed-features of cecal microbiota, which instructed the increase of gut microbiota diversity. Unlike Wu et al. (2020) who observed a predominant increase in Lactobacillus in broilers, our study highlighted the enrichment of Firmicutes and Synergistetes in laying hens, indicating host-specific microbiota modulation by apidaecin. While apidaecin did not alter laying rates, its modulation of gut microbiota diversity (e.g. increased Firmicutes and Synergistetes) may explain the observed maintenance of production performance despite reduced feed intake. Specifically, Firmicutes enrichment is linked to enhanced energy harvest efficiency, a plausible mechanism for sustaining egg output under lower nutrient intake (Wang et al 2024). Synergistetes enrichment drove natural IgM seroconversion, amplifying protective humoral responses through B-cell mediated effector functions (Lopez et al 2016). Following apidaecin supplementation, the relative abundance of Synergistetes increased, which contributes to maintaining gut homeostasis and consequently enhances immune function in laying hens. Apidaecin could elevate the relative abundance of some SCFAs-producing such as Desulfovibrio, Phascolarctobacterium, Dorea, Peptococus and Paludibacter (Hiippala et al 2020; Deepthi et al 2021; Han et al 2021; Palmnas-Bedard et al 2022; Zha et al 2023). Substantial evidence confirms that SCFAs (e.g. butyrate, propionate) serve as primary metabolic substrates for colonocytes, while critically modulating immune responses and reinforcing intestinal barrier integrity in animal models (Parada Venegas 2019; Deng et al 2023). Correlation analysis further demonstrated that SCFA-producing bacteria contribute to enhanced intestinal morphological development and improved antioxidant capacity in laying hens. The addition of apidaecin reduced the relative abundances of Prevotellaceae-Prevotella, Sphaerochaeta and Actinobacillus in the cecum. The colonization of these bacteria could lead to ­decreased levels of SCFA in the gut, exacerbating intestinal barrier damage and inflammation (Armstrong et al 2019; Ren et al 2020; Iljazovic et al 2021). Thus, the inclusion of apidaecin in the diet sustained production performance although feed intake was lower in some groups, which may be attributed to improved gut barrier function through increased SCFA-producing microbes and decreased enteritis-associated pathogenic bacteria.

Building on apidaecin’s demonstrated capacity to enhance intestinal barrier function in laying hens and inhibit S. Typhimurium in vitro, this study investigated its efficacy in suppressing systemic pathogen dissemination within hens and subsequent egg contamination. Consistent with previous studies (Wu et al 2020), apidaecin treatment efficiently increased intestinal barrier function compared with S. Typhimurium infected group, as evidenced by an increased V/C ratio and elevated levels of sIgA. Certain poultry antimicrobial products targeting Salmonella, such as bacteriophages or acidifiers, have also demonstrated the ability to improve intestinal morphology. This enhancement of gut structure may contribute to reduced Salmonella colonization (Saleh et al 2025). Salmonella contaminated eggs vertically after invading the intestines. This study evaluated the inhibitory effect of apidaecin on Salmonella transmission in laying hens by measuring Salmonella load in multiple tissues. Apidaecin decreased S. Typhimurium load in spleen and eggshell on the third day, and ­decreased S. Typhimurium load in spleen, liver, ileum and eggshell on the seventh day. Despite its initial mucosal ­invasion through intestinal epithelia, Salmonella exploited the splenic niche as the dominant replication site, leveraging the dense network of resident macrophages within this lymphoid organ (Jones and Falkow 1996). The decrease in S. Typhimurium counts within the spleen during the initial stages of infection might be attributed to the inhibition of S. Typhimurium invasion by apidaecin in the intestine. An intriguing observation is that apidaecin reduces the S. Typhimurium load on the eggshell surface without altering its levels in the oviduct. This can likely be attributed to the specific physiological configuration of the hen’s cloaca. Functioning as a shared conduit for excretory and reproductive processes, this multipurpose cavity facilitates horizontal dissemination of microorganisms throughout reproductive tissues post-colonization (Dai et al 2023). By decreasing the S. Typhimurium population in the intestine, apidaecin subsequently lowered the amount of S. Typhimurium that adhered to the eggshell during the process of egg excretion. After continuous ingestion of apidaecin following the S. Typhimurium infection, the amount of S. Typhimurium in the bodies of laying hens decreased, further confirming apidaecin ability to effectively prevent S. Typhimurium from invading their intestines. The interaction with the intestinal epithelium is a crucial step for the establishment of S. Typhimurium ­infection. This was also demonstrated by the cell experiment in vitro. Subinhibitory concentrations of apidaecin reduced the adhesion and invasion of S. Typhimurium on intestinal epithelial cells. Apidaecin-mediated suppression of Salmonella virulence likely stems from dual targeting of SPI-1 T3SS transcriptional machinery and flagellar motility apparatus, culminating in significantly impaired bacterial adherence, host cell invasion, and pathogenicity (Chen et al 2015; Birhanu et al 2018). This also provided us with a reference direction for our next step in exploring the mechanism by which apidaecin inhibits S. Typhimurium adhesion and invasion. Given this study’s limitation to acute (7-d) challenge conditions, future research will evaluate apidaecin’s sustained efficacy across all production phases in laying hens.

Conclusion

Dietary supplementation with 500 mg/kg diet apidaecin significantly enhanced intestinal morphological and mucosal immunity in laying hens, potentially mediated by increased colonization of SCFA-producing bacteria (e.g. Phascolarctobacterium and Desulfovibrio). The observed enhancement of intestinal barrier integrity and suppression of S. Typhimurium adhesion per invasion mechanisms induced by the apidaecin synegistically reduced bacterial titers in internal organs and diminished egg contamination. However, further studies are needed to determine whether apidaecin effectively blocks the ovarian vertical transmission of Salmonella. These findings demonstrated that apidaecin consolidates intestinal barrier function via immunomodulatory and microbiota-shaping effects, thereby providing an effective feed-based intervention strategy to mitigate S. Typhimurium dissemination within poultry production systems.