Nppa and Nppb Deficiency Drives Ventricular Hypertrophy and Subendocardial Gene Deregulation in the Mouse Heart

TL;DR

Deleting Nppa and Nppb genes in mice leads to heart enlargement and changes in gene activity in the heart's inner layers.

Contribution

This study reveals the role of Nppa and Nppb in maintaining heart structure and gene regulation in mice.

Findings

Nppa–Nppb−/− mice show heart hypertrophy and QRS prolongation.

Subendocardial gene expression changes suggest conduction system disruption.

Tbx5 down-regulation indicates a feedback loop involving Nppa/Nppb.

Abstract

The natriuretic peptides A and B, encoded by NPPA and NPPB, respectively, have complementary and redundant functions in cardiovascular homeostasis. To establish their coordinated roles, we analyzed the cardiac phenotype of a mouse line in which the Nppa–Nppb cluster was deleted from the genome. At 8 weeks of age, Nppa–Nppb−/− mice (HOM) had significantly larger hearts and cardiomyocytic hypertrophy compared to wild-type and heterozygous mice. Electrocardiogram comparisons showed QRS prolongation in HOM mice. Hypertrophy was confirmed by echocardiography, which further indicated preservation of left ventricular systolic function. Bulk-transcriptomic analysis revealed moderate changes in gene expression of the left ventricle. Genes involved in fatty acid metabolism, ion handling and conductivity, including genes marking the ventricular conduction system, were down-regulated. Spatial transcriptomic analysis revealed the greatest changes in gene expression in the subendocardial wall, where the ventricular conduction system is located. Tbx5, the encoding dosage-sensitive T-box transcription factor Tbx5 that is essential for the expression of ventricular conduction system genes and for Nppa and Nppb, was down-regulated in the ventricles of HOM mice, indicating that a positive feedback loop normally maintains Tbx5 expression. We conclude that homozygous Nppa–Nppb deficiency in mice causes cardiac hypertrophy, including a likely perturbation of the ventricular conduction system.

Figures

Full text

1. Introduction

Natriuretic peptide A (atrial natriuretic peptide; ANP) and natriuretic peptide B (brain natriuretic peptide; BNP) are secreted hormones that act as important regulators of the cardiovascular-renal system, controlling diuresis and natriuresis to decrease blood volume and ultimately blood pressure [1,2]. ANP and BNP are encoded by the evolutionary paralogous genes NPPA and NPPB, which are located adjacent to each other on the genome on human Ch.1q36 and mouse Ch.4qE2, respectively. In the mouse, Nppa and Nppb expression in the heart can be detected from embryonic day (E)8 onwards. Both genes are specifically expressed in the developing atria and ventricles [3,4]. Within the developing ventricles, Nppa and Nppb expression become restricted to the trabecular myocardium, from which the bundle branches (BBs) and the Purkinje fiber network (PFN) of the ventricular conduction system (VCS) develop [5,6]. After birth, expression of Nppa is dramatically down-regulated in the adult ventricular working myocardium, only retaining a limited level of expression in the VCS [7,8]. Additionally, ANP signaling has been linked to VCS gene regulation and metabolic electrophysiological coordination, implying a potential role in maintaining electrophysiological stability [9,10]. In contrast to the steep Nppa down-regulation in the postnatal ventricle, Nppb levels remain relatively unchanged in the adult ventricular myocardium [3,11]. Both genes are highly re-expressed in the ventricles of adult hearts undergoing stress, hypertrophy or heart failure, and are specifically induced in the infarct border zone shortly after myocardial infarction [12,13]. The re-expression of these genes in stress or disease conditions has established NT-proBNP (N-terminal prohormone of brain natriuretic peptide) and MR-proANP (Midregional pro-atrial natriuretic peptide), the prohormones of BNP and ANP, respectively, as critical clinical biomarkers, with NT-proBNP serving as the gold standard for hypertrophy and heart failure diagnosis [14,15,16]. Furthermore, pathogenic variants in NPPA have been associated with arrhythmogenic remodeling [17,18,19].

Multiple studies have used genetically modified mice to elucidate the function of the natriuretic peptide system during cardiac homeostasis and disease (reviewed in [1,20]). Mice carrying a homozygous deletion of either Nppa (Nppa knockout (KO) or Nppb (Nppb KO)) are sensitive to stress-induced ventricular arrhythmias [21], supporting the contribution of the natriuretic peptide system to conduction system integrity and cardiac rhythm regulation. Nppa KO are viable but develop cardiac hypertrophy and elevated blood pressure, a phenotype that worsens under cardiac stress, such as ventricular volume overload [22]. Another study reported reduced fractional shortening in Nppa KO mice after pressure overload, along with increased collagen deposition due to interstitial fibrosis, compared with wild-type mice [23]. The deletion of Nppa results in an increase in Nppb expression, which, however, does not fully compensate for the loss of Nppa [24,25,26]. In contrast to Nppa KO mice, Nppb KO mice do not exhibit hypertrophy or hypertension but develop fibrosis after cardiac pressure overload [27]. Another study reported no fibrosis or difference in systolic or diastolic function at baseline in Nppb KO mice, but observed more frequent acute lethal heart failure post myocardial infarction, accompanied by up-regulation of Nppa [13].

ANP and BNP exert their actions by interacting with receptors NPR-A, NPR-B and NPR-C (encoded by Npr1, Npr2 and Npr3, respectively) [28]. NPR-A is the primary receptor for ANP and BNP. NPR-B has the highest affinity for NP family member CNP (Nppc), and NPR-C is considered to be an NP clearance receptor. Various, sometimes contradictory observations have been reported for Npr1 KO mice. Similar to Nppa KO mice, Npr1 KO mice exhibit elevated blood pressure and display varying degrees of hypertrophy from birth onwards [29,30,31,32,33]. In some studies, interstitial fibrosis has been reported without a decrease in ventricular performance [29], whereas others did not detect interstitial fibrosis but a change in cardiac relaxation time [32]. Because NPR-A is expressed broadly, including in the heart, kidneys, adrenal glands, vasculature, lungs and adipose tissue [34], these different responses to Npr1-deficiency may involve secondary systemic effects. Nppa and Nppb are partially functionally redundant. In zebrafish, nppa-nppb deficiency results in cardiac defects, while single mutants are indistinguishable from the WT [34]. Moreover, Nppa expression is increased in Nppb-deficient mice and vice versa. However, the combined requirements of Nppa and Nppb for cardiac structure and function in mammals have yet to be examined. To investigate this requirement, we used a CRISPR/Cas9-generated Nppa–Nppb deletion mouse line [24]. We performed functional, phenotypic and transcriptomic analysis of mice homozygous for the deletion to determine the impact of complete Nppa–Nppb deficiency on the adult uninjured heart.

2. Results

2.1. Deletion of Nppa–Nppb Leads to Cardiac Hypertrophy and QRS Prolongation in Adult Mice

To study the impact of concurrent deletion of Nppa and Nppb on the structure and function of the adult heart, we generated a mouse line carrying a deletion of a genomic fragment containing both genes, using CRISPR/Cas9. Successful homozygous deletion of Nppa and Nppb in Nppa–Nppb^−/−^ (HOM) mice was validated by RNA-sequencing and qPCR (Figure 1a,b). Hearts of HOM adult mice were macroscopically larger than those of wild-type Nppa–Nppb^+/+^ (WT) mice (Figure 1c). Ratios of heart weight to body weight (HW/BW) and heart weight to tibia length (HW/TL) were significantly greater in HOM mice (Figure 1d,e). Genotype-dependent heart size differences were independent of sex (Figure 1f,g). Hematoxylin and eosin staining showed no gross morphological differences between WT and HOM mice (Figure 1h). Quantification of collagen deposition, or fibrosis, by picrosirius red staining, indicated no significant difference between WT and HOM hearts (Figure 1i,j). Next, we assessed the cause of the observed heart enlargement in HOM mice. We performed immunofluorescence staining for dystrophin (DMD), a muscle-specific marker, to measure the transverse cross-sectional area of cardiomyocytes (Figure 1k). Cardiomyocyte cross-sectional area was quantified as the mean ± SD per biological replicate (Figure 1l) or as the median with the distribution of individual cardiomyocytes (Figure 1m). HOM mice exhibited increased cross-sectional areas, indicative of cardiomyocyte hypertrophy, which contributed to the observed increase in heart size. Notably, HET mice did not show signs of cardiomyocyte hypertrophy compared with WT mice (Figure 1l,m). Due to the lack of morphological differences between WT and HET mice, we decided to exclude HET mice from further analysis. Taken together, these data show that homozygous deletion of this genomic locus results in cardiomyocyte hypertrophy, whereas at least one copy of Nppa and Nppb is sufficient to prevent cardiac enlargement.

We next performed ECGs to determine whether the absence of Nppa–Nppb alters the electrophysiological properties of HOM mouse hearts (Figure 2a). While the RR and the PR interval (Figure 2b,c) did not differ, the QRS interval was longer in HOM mice (Figure 2d). Also, when comparing the QRS interval relative to the RR interval we find the QRS interval of HOM hearts to be longer (Supplementary File, Table S6). We next examined the impact of Nppa–Nppb deficiency on cardiac function by echocardiographic analysis (Figure 2e–p). Neither ejection fraction nor fractional shortening was different between WT and HOM mice, strongly indicating preservation of left ventricular systolic function (Figure 2f,g). Increased ventricular hypertrophy in HOM mice was in line with increased LV mass and wall thickness as indicated by interventricular septal thickness at diastole and posterior wall thickness at systole (Figure 2h,i,n). Additionally, there was an accompanying increase in diastolic chamber dimensions, including left ventricular internal diameter at diastole and LV volume at diastole (Figure 2k,o). In contrast, interventricular septal thickness at systole, left ventricular internal diameter at systole, LV volume at systole and LV posterior wall thickness at diastole remained unchanged (Figure 2j,l,m,p). Taken together, these data indicate that despite the structural ventricular remodeling caused by the absence of Nppa–Nppb, the systolic function remains unaffected.

While systolic cardiac function in HOM mice is unaffected under baseline conditions, previous observations indicate that either gene is required for the heart to cope with stress [13]. Therefore, we applied myocardial infarction (MI) by left anterior descending artery (LAD) ligation to test the response to cardiac stress and injury. In many mice, MI induction was hindered by an anomalous LAD position and morphology, with the LAD positioned deeper within the ventricular wall and poorly visible, occurring in nine out of 15 HOMs (vs three out of 16 WT; Chi-square test: p = 0.018). A similarly affected coronary vascular tree has been observed in mice homozygous for a deletion of the ventricular enhancer of Nppa–Nppb [24]. When the MI with confirmed infarction was successful, five of five HOM mice died within 2 days, whereas seven of 10 WT mice survived beyond this time point (log-rank p < 0.011 (Figure 2q)). Post-mortem analysis of deceased mice (HOM and early-dying WT) revealed MI scars in the ventricular wall, but no cardiac rupture, indicating the mice died of acute heart failure. Only mice with histologically confirmed infarction (post-mortem H&E; visible scars) were included. Estimated infarct sizes spanned comparable ranges in both genotypes (HOM: 5–40%; WT: 20–50%). All HOM mice died within 2 dpi regardless of infarct size (including smaller ~5–20% infarcts), while WT mice with larger infarcts (40–50%) often survived or died later than 2 dpi. This aligns with previous observations that Nppb^−/−^ mice also died within 3 dpi due to acute heart failure, regardless of infarct size [13]. This finding corroborates the importance of the natriuretic peptides in maintaining heart function in the early post-MI period in mice [13].

2.2. Nppa–Nppb Deficiency Causes Moderate Changes in Gene Expression

Next, we performed bulk RNA-sequencing on the left ventricle of the adult heart to investigate the impact of Nppa–Nppb-deficiency on ventricular gene expression. PCA of variance-stabilized counts revealed distinct clustering of HOM and WT samples primarily along PC1 (37% variance) with additional resolution on PC2 (28% variance), enabling clear separation of the genotypes without overlap, confirming strong genotypic effects on the transcriptome (Figure 3a). Differential gene expression analysis identified 369 genes as differentially expressed (Padj < 0.05), of which 167 were up-regulated and 202 were down-regulated in HOMs vs. WT (Figure 3b; Supplementary File, Table S1). The up-regulated genes were enriched for gene ontology (GO) terms associated with positive regulation of transcription, cell migration, signal transduction, and negative regulation of angiogenesis. On the contrary, down-regulated genes were enriched for GO terms associated with lipid storage, fatty acid and triglyceride metabolic processes, and heart rate by cardiac conduction (Figure 3c). The full analysis results are presented in Supplementary File, Tables S2 and S3. Several VCS-associated genes [35] including well-established specific VCS markers, Hcn4, Cntn2 and Scn10a, were down-regulated (Figure 3b) [36,37,38]. In addition, several potassium channel genes were down-regulated, including Kcnj2 (Kir2.1), Kcnh2 (hERG1), Kcnq1 (Kv7.1) and Kcnd2 (Kv4.2). Interestingly, the expression of Tbx5 was also decreased in HOM ventricles. Tbx5 is a T-box transcription factor required for heart development and homeostasis [39], and a well-established transcriptional activator of Nppa and Nppb. Together, these data suggest that Nppa–Nppb deficiency causes focused transcriptional changes in the adult left ventricle, characterized by reduced expression of genes associated with fatty acid metabolism (Angptl3, Acot1, Pla2g5, Alox5/12, Scd1/5, Cyp2u1, Ephx2) and ventricular conduction system-associated genes.

2.3. Spatial Impact of Nppa–Nppb Deficiency Across the Ventricular Myocardial Wall

Both Nppa and Nppb are expressed in the chamber myocardium of the atria and ventricles during development; however, their expression in the ventricles shows a transmural pattern (highest at the endocardial side) and becomes progressively confined to the trabecular myocardium towards birth; after birth, the expression of Nppa is greatly decreased in the ventricles, and in the adult heart, Nppa is primarily found in the atria [12]. However, Nppa as well as Nppb can be induced in the ventricles in response to stress, such as pathological hypertrophy or in the myocardial infarction border zone [12,13]. To determine whether the function of Nppa and Nppb differs between the subendocardial (trabecular-derived) and sub-epicardial (compact wall-derived) ventricular wall, we performed spatial transcriptomics. We designated regions of interest (ROI) for trabecular, mid-myocardial, and compact layers within the left ventricle and for trabecular and compact layers within the right ventricle (Figure 3d). When plotted in principal component space (PC1–PC4), genotypes were partially separated, and the degree of separation was significantly less than what was observed in the bulk RNA-sequencing, which would suggest that the spatial transcriptomics platform (GeoMx) detects fewer genes, has higher background values, and less dynamic range than bulk RNA-sequencing (Figure 3e,f). To examine whether loss of Nppa and Nppb differentially affects trabecular compared to compact myocardium, we pooled trabecular regions from both ventricles and compact regions from both ventricles, respectively, and performed differential expression analyses between HOM and WT for trabecular and compact pools (Figure 3g,h; Supplementary File, Tables S4 and S5). When examining the trabecular layer, most of the classical VCS genes [35] showed log2 fold changes below zero, suggesting a trend toward decreased VCS gene expression in the trabecular layer, although only a few reached statistical significance due to limited power. However, because the directionality of this trend was consistent across these genes, we assume it accurately reflects the trend toward decreased VCS gene expression in the trabecular layer (Figure 3g). Conversely, in the compact myocardium, the VCS genes showed weaker statistical support and a variable pattern of directional change (Figure 3h). The reduced expression of VCS-enriched genes in these mice is supported by several observations: consistency of down-regulation of conduction/VCS-associated genes in the trabecular compartment, a similar pattern of down-regulation in the bulk RNA-sequencing data, and the localization of PFN of the VCS within the subendocardial (inner trabecular) layer of the ventricular myocardium [40] (Figure 3e). For example, in both data sets, Cntn2 is down-regulated in HOM ventricles. Immunofluorescent staining for CNTN2 in neonatal day 8 hearts (Figure 3j) shows that CNTN2 expression is restricted to the subendocardial VCS myocardium, and also supports reduced CNTN2+ expression in the subendocardial bundle branch area in HOM mice compared to that of WT mice.

A scatter plot of the trabecular and compact log2 fold changes illustrates the variation in both the magnitude and direction of gene regulation between these two myocardial layers (Figure 3i). When plotting the regression of genes affected (p-value < 0.05), we find a slope of 0.77, indicating that the trabecular layer is more affected by the deletion of Nppa and Nppb than the compact layer. Looking into the genes in these groups we find that genes responding in opposite directions between trabecular and compact myocardium do not show a clear pattern, although we find Arhgap8 (a GTPase-activating protein that de-phosphorylates Rho proteins) down-regulated in the trabeculae and up-regulated in the compact, whereas Ect2 (a guanine nucleotide exchange factor that phosphorylates Rho proteins) shows the opposite pattern, both suggesting increased Rho activity specifically in the trabecular layer. Examining genes nominally significant (p-value < 0.05) in only one myocardial layer indicates distinct regional responses. Trabecular-specific down-regulated genes showed strong enrichment for GO terms associated with cardiac contractile function (regulation of heart contraction, heart rate, action potential generation) and energy metabolism, particularly catabolic processes for small molecules, fatty acids, and organic acids (23 genes including Acaa2, Acacb, Acadvl, Ldhal6b and Ldhb). Complementing this suppression of metabolic gene expression, trabecular-specific up-regulated genes were highly enriched for transport processes, particularly organic anion, carboxylic acid, and sodium ion transport (33 genes, including numerous SLC family members). In contrast, compact-specific down-regulated genes were enriched for cell–substrate adhesion (30 genes), receptor-mediated endocytosis (24 genes), and actomyosin structure organization (19 genes). No significantly enriched GO terms were found for the compact-specific up-regulated genes. Interestingly, no transcriptomic signature of hypertrophy was detected in either region. Together, these data suggest that Nppa–Nppb deletion results in down-regulation of gene expression involved in conduction, contraction and metabolism, and that the trabecular myocardium is more strongly affected than the compact ventricular myocardium.

3. Discussion

In this study, we show that homozygous deletion of the clustered paralogous gene pair Nppa–Nppb results in heart enlargement and ventricular cardiomyocyte hypertrophy accompanied by QRS prolongation, indicative of ventricular conduction slowing, and modest transcriptional changes that differ in magnitude across the transmural ventricular myocardium. Mice heterozygous for the deletion of the gene pair had unaffected heart sizes, indicating that one copy of each gene is sufficient to establish and maintain normal homeostasis. Despite hypertrophic remodeling in HOM hearts, baseline ejection fraction was preserved (Figure 2), consistent with prior reports of increased heart size without systolic dysfunction upon loss of either Nppa, Nppb, or their receptor NPR-A (Npr1) [13,20,23,41]. Both Nppa and Nppb are likely required for cardiac and systemic functional adaptation to abnormal conditions, such as cardiomyopathies, hypertension, hypertrophy, or conduction abnormalities. These requirements for the natriuretic peptide genes and their underlying mechanisms can be explored in genetic, pharmacologic, or surgical models that induce these conditions, such as isoproterenol-induced cardiac hypertrophy and Transverse Aortic Constriction-induced cardiac hypertrophy, high salt diet-induced hypertension, or genetic interventions inducing cardiomyopathies or conduction abnormalities.

Nppa–Nppb-deficient mice displayed abnormal positioning of the LAD, making LAD ligation surgery to induce MI technically demanding. This observation is consistent with a previous study in which the deletion of an enhancer cluster required for ventricular expression of Nppa–Nppb led to similar morphological mispositioning of the LAD [24]. The malformations are likely to develop during fetal development, when the coronary vasculature forms in the ventricular wall. Detailed studies of heart development in HOMs would be required to explore the relationship between Nppa–Nppb expression and coronary morphogenesis. The survival of HOM mice that underwent a successful MI did not exceed day 2 post-MI. Studies have shown that post-ischemic Nppa^−/−^ mice exhibit increased mortality due to cardiac rupture and larger infarct sizes [42], while Nppb^−/−^ mice develop acute and lethal heart failure post-MI [13]. Additionally, Npr1 deletion resulted in higher mortality rates within the first week post-MI due to acute heart failure [43]. Collectively, these findings highlight an indispensable, non-redundant role of Nppa and Nppb in ensuring survival following myocardial injury.

Mice and zebrafish deficient in either Nppa or Nppb are structurally indistinguishable from their WT counterparts [34,44,45]. In zebrafish, however, nppa–nppb double mutants display ectopic atrioventricular canal (AVC) marker expression and expanded cardiac jelly, whereas cardiomyocyte size remained unchanged. Although developmental defects in homozygous Nppa–Nppb double mutant mice remain uncharacterized, the adult hearts do not show obvious structural defects but instead display ventricular hypertrophic remodeling, which suggests that complete natriuretic peptide deficiency in postnatal mammals primarily perturbs cardiomyocyte hypertrophic growth restraint rather than cardiac patterning. Interestingly, myocardial nppb overexpression during cardiogenesis in zebrafish reduced cardiac chamber size by limiting cardiomyocyte proliferation, suggesting that the functions of natriuretic peptide signaling are context-dependent and may differ between species or developmental stages [46].

Nppa–Nppb-deficient mice exhibited a prolonged QRS duration indicative of slower activation of the ventricular mass. This electrical change could potentially be attributed to an increase in cardiac mass. Indeed, QRS prolongation has been observed in left ventricular hypertrophy due to increased myocardial thickness [47]. Additionally, prolongation of the QRS complex in HOM mice, accompanied by normal PR and RR duration, indicates ventricular conduction slowing, which may involve reduced conduction velocities in the VCS, including the PFN. Indeed, reduced natriuretic peptide A (Nppa) signaling has been shown to decrease VCS marker gene expression and to impair PFN development [9,48].

Notably, spatial transcriptomics revealed trabecular-specific down-regulation of metabolic genes in Nppa–Nppb-deficient mice, with reduced expression of genes involved in fatty acid oxidation (FAO) and lipid metabolism, as well as VCS genes. This is consistent with observations that ANP/NPRA signaling drives FAO and lipid droplet formation via PPARγ, and VCS gene expression (CX40) in embryonic ventricles [10]. Interestingly, Tbx5 was down-regulated in HOM mice. TBX5 is a highly dosage-sensitive cardiogenic transcription factor required for cardiac morphogenesis and gene regulation [39,49]. Tbx5 is expressed in a transmural gradient in the developing ventricular wall, with the highest expression in the trabecular myocardium from which the VCS develops [50,51]. The expression of Tbx5 persists in the adult mature heart, where it is required to maintain VCS gene expression and identity [52,53]. TBX5 is an essential dosage-sensitive activator of Nppa and Nppb [49,54,55]. The down-regulation of Tbx5 in HOM ventricles suggests the presence of a disrupted feedback mechanism in which loss of natriuretic peptide signaling reduces expression of Tbx5 and its key target genes, including VCS-enriched Scn10a, Hcn4, and Cntn2. Spatially, the consequences of Nppa–Nppb deficiency were more pronounced in the trabecular compared to the compact ventricular myocardium. Because the wild-type adult compact and trabecular layer show very few transcriptional differences [56], the transcriptional differences between the WT and HOM trabecular layers we observed are likely due to the reduced expression of VCS markers, many of which are TBX5 target genes. Together, these findings indicate that Nppa–Nppb deficiency deregulates a TBX5-dependent transcriptional network that maintains adult VCS gene expression [53].

In conclusion, Nppa–Nppb deficiency promotes compensatory ventricular hypertrophy and conduction slowing in adult mice, accompanied by modest but regionally distinct transcriptional changes across the ventricular myocardium. These observations indicate redundant roles for natriuretic peptides in restraining postnatal cardiac growth and maintaining baseline electrophysiological function, with a greater impact in the subendocardial trabecular component potentially involving VCS homeostasis.

4. Methods

4.1. CRISPR/Cas9 Genome Editing

The Nppa–Nppb^+/−^ line was generated previously, with the generation procedure reported in [24]. Briefly, Nppa–Nppb^+/−^ mice were generated using CRISPR/Cas9. Single guide RNA (sgRNA) constructs were designed to target the regions downstream of Nppa and upstream of Nppb using the online tool ZiFiT Targeter [57]. The sgRNA constructs and Cas9 construct [58] were in vitro transcribed using the MEGAshortscript T7 Transcription Kit and the mMessage mMachine T7 Transcription Kit (ThermoFisher Scientific, Waltham, MA, USA). The sgRNAs (10 ng/µL per sgRNA) and Cas9 mRNA (25 ng/µL) were microinjected into the cytoplasm of one-cell embryos of the FVB/NRj background for the generation of founder mouse lines. The used CRISPR sequences are as follows: sgR1: 5′ GGCCAGTTCAAACGATTTGT 3′, sgR2: 5′ GGTCATCTTATAGCTCCAAT 3′. Founders (F0) were crossed with wild-type FVB/NRj mice to obtain F1 Nppa–Nppb^+/−^ mice. F1 offspring of 1 founder was selected to establish the Nppa–Nppb^+/−^ line, which was maintained on the FVB/NRj background. Nppa–Nppb^+/−^ mice (of generation F2 and further) were intercrossed to obtain wild-type, heterozygous Nppa–Nppb^+/−^ and homozygous Nppa–Nppb^−/−^ mice.

4.2. Animal Experiments

Animal experiments were performed in accordance with the Dutch Experiment on Animals Act and European Directives and approved by the Central Authority for Animal Experiments and the Animal Welfare Body of the Amsterdam University Medical Center (#AVD11400202216572; approval date: 9 January 2023) in compliance with the Dutch government guidelines. The experimental mice were maintained under well-controlled standard laboratory conditions, featuring a 12 h light and 12 h dark cycle to simulate natural environmental conditions. The mice had continuous access to a standard diet and drinking water.

4.3. Myocardial Infarction

Myocardial infarction was performed on Nppa–Nppb^+/+^ and Nppa–Nppb^−/−^ mice by left anterior descending artery ligation as previously described [24]. Briefly, myocardial infarction was induced in mice under isoflurane anesthesia (4% induction, 2% maintenance) via mechanical ventilation. Following left thoracotomy at the fourth intercostal space, permanent ligation of the left anterior descending coronary artery was performed using an 8-0 nylon suture. The thoracotomy was closed, and post-operative analgesia was maintained for two days.

4.4. Heart Collection and Histological Analysis

Hearts were excised, washed in PBS and fixed in 4% PFA at room temperature (on a shaker) for 24 h before being exchanged to 70% ethanol. The paraffin-embedded hearts were sectioned at 5 μm and mounted on microscope slides before deparaffinization and rehydration in an ethanol gradient. Hematoxylin and Eosin staining was used to assess morphological changes in the adult hearts. Picrosirius red staining was used to assess the presence of fibrosis in adult mice. Quantification of fibrosis (% collagen deposits) was performed on 4 biological replicates, 1 section per heart, where 3 fields were measured. ImageJ software (version 1.54) was used to quantify the percentage of the total myocardium that was red on the picrosirius staining. Images were acquired by using a Leica DM5000 microscope (Leica Microsystems, Wetzlar, Germany). The heart and tibia were collected at the end of each experiment to assess heart weight and tibia length ratios.

4.5. Mouse Electrocardiography

Animals were anesthetized by 4% isoflurane inhalation and maintained in anesthesia with 2% isoflurane in 1 L/min O_2_. Subcutaneous recording electrodes were placed at the left armpit, right armpit and left groin and ECGs were recorded for a period of 1 min. ECG parameters (RR, PR, and QRS) were calculated from lead II using LabChart Pro 8 (ADInstruments, Dunedin, New Zealand).

4.6. Echocardiography

At 8 weeks of age, cardiac function was evaluated by echocardiography on sedated mice (2% isoflurane) using a Visual Sonic Ultrasound system with a 30 MHz transducer (VisualSonics Inc., Toronto, ON, Canada). Cardiac imaging was performed at the level of the papillary muscles in a parasternal long-axis view to record M-mode measurements, including left ventricular internal diameter and left ventricular posterior wall thickness, and B-mode measurements, including left ventricular end-diastolic volume and left ventricular end-systolic volume. Fractional shortening was calculated as the end-diastolic dimension minus the end-systolic dimension normalized to the end-diastolic dimension, and ejection fraction was calculated as stroke volume normalized to end-diastolic volume.

4.7. Mouse Harvest and Tissue Collection

Mice at 8 weeks of age were sedated using 3–4% isoflurane followed by cervical dislocation. The heart was excised and washed in PBS and weighed. The weight of the mice and the tibia length were measured to assess heart weight/body weight and heart weight/tibia length, respectively. For RNA isolation, hearts from female mice were rapidly removed, washed in ice-cold PBS and the left ventricle was separated using fine scissors on ice under a stereo-microscope. The tissue was subsequently snap-frozen in liquid nitrogen and stored at −80. Mice were selected for RNA isolation based on their genotype, and hearts were isolated directly after functional testing (echocardiography or ECG). The only inclusion criteria were genotype, confirmed using PCR on genomic DNA isolated from toe cuts and sex.

4.8. RNA Isolation and qPCR

Total RNA was isolated from mouse left ventricles using ReliaPrep™ RNA Miniprep Systems (Promega, #Z6012, Madison, WI, USA) according to the manufacturer’s protocol. 1 μg of total RNA was reverse transcribed for cDNA synthesis using SuperScriptTM II Reverse Transcriptase (Invitrogen, #18064014, Carlsbad, CA, USA). Quantitative PCR (qPCR) was performed on LightCycler 480 Instrument II (Roche, #05015243001, Basel, Switzerland) using LightCycler 480 SYBR Green I Master (Roche, #04707516001. qPCR data were analyzed using LinRegPCR (version 2021.1) [59]. Calculated N0 values were normalized by the geometric mean of the reference genes (Hprt and Eef1e1).

4.9. RNA-Sequencing and Gene Ontology

Total RNA was delivered to the Core Genomics Facility of Amsterdam UMC for library preparation and RNA-sequencing. Tapestation assessment was performed to ensure the RIN score of the RNA. RNA Library Prep was performed using KAPA Hyperprep with RiboErase (Roche) according to the manufacturer’s instructions. Forward and reverse RNA sequencing using the platform NovaSeq 6000 S4 (Illumina, San Diego, CA, USA). Approximately 40–50 million reads/samples were retrieved. Data analysis was performed by uploading Fastq files on UseGalaxy.eu. Fastq files were trimmed using the algorithm “Trim Galore” and mapped to the GRCm38/mm10 mouse genome. Deseq2 analysis was performed across groups to identify up- or down-regulated genes significantly and to generate normalized counts used for Z-score assessment across groups. Gene Ontology (GO) analysis of differentially expressed genes was performed using Database for Annotation, Visualization, and Integrated Discovery (DAVID).

4.10. Nanostring GeoMx Digital Spatial Profiler Analysis

Nanostring GeoMx Digital Spatial profiler (Nanostring, Seattle, DC, USA) was used in combination with the GeoMx Whole Transcriptome Atlas Mouse RNA probe mix (v1) for NGS on paraplast-embedded fixed adult mouse hearts according to the manufacturer’s instructions. Hearts were selected based on their genotype and sex (only female mice); no other criteria were used for inclusion. Anti-cTnI (Hytest 4T21/2, 1:150) together with anti-Goat AlexaFluor 555 (Thermofisher Scientific A-21432, 1:250) and SytoxGreen nuclear stain (Invitrogen S7020) were used to manually segment regions of interest. cTnI signal-based masking was used to further specify regions of interest (ROIs), enriching for cardiomyocytes. After selecting the ROIs, oligos were collected into a 96-well plate for library preparation and subsequent sequencing. Sequencing depth was determined by calculating the total area of all AOIs (µm^2^) and multiplying this by the Nanostring recommended Sequencing Depth Factor (100 for the Whole Transcriptome Atlas). Sequencing was performed on the NextSeq 1000 (Illumina). FASTQ files were trimmed, stitched, aligned, and deduplicated using the Nanostring GeoMx NGS pipeline (version 2.3.3.10). The generated DCC files were processed with the R GeoMxTools package (version 3.8.0) using the configuration file, the sample sheet, and the probe metadata file (v1). Normalization was performed using quantile-normalization. For hypothesis testing, a Wald test was performed and the multiple testing correction was performed using the Benjamini–Hochberg method. All graphs were made in R (v4.3.1), using the package ggplot2 (v3.4.2) and ggrepel (v0.9.3).

4.11. Immunohistochemistry and Imaging

Paraffin-embedded sections were deparaffinized and rehydrated using an alcohol gradient. Sections were subsequently boiled in antigen retrieval buffer, permeabilized with 0.1% Triton-X/PBS for 8 min, blocked with 4% BSA for 30 min, and incubated o/n at 4 °C with primary antibodies, including mouse anti-DMD (Abcam, # ab15277, 1:200, Cambridge, UK), diluted in 2% BSA. Afterwards, sections were washed and incubated for 2 h with DAPI (Serva, #18860, 1:1000, Heidelberg, Germany), and corresponding secondary antibodies, including Alexa Fluor 647 donkey anti-rabbit (Invitrogen, #A31573, 1:250), and Alexa Fluor 555 donkey anti-rabbit (Invitrogen, #A31572, 1:250). Following secondary antibody incubation, sections were washed 3 times for 5 min in 0.05 Tween-20/PBS and mounted using 50:50% glycerol/PBS. For measuring cardiomyocyte cell size, sections were visualized using a Leica DM6000 upright microscope with a 20× objective. Confocal microscopy was performed using a Stellaris 8 Confocal Microscope with a 40× objective and Leica LAS X software (version 4.1.1).

4.12. Statistical Analysis

The number of samples (n) used in each experiment is shown in the figures and indicates the number of biological replicates. Data are presented as the mean ± standard deviation (SD), unless stated differently in the figure legend. Statistical analyses were performed using PRISM (GraphPad Software, version 10). The Mann–Whitney U-test was used to statistically compare two groups. One-way ANOVA was used to statistically compare multiple groups. The Kolmogorov–Smirnov test was used to statistically compare the cumulative distribution. Differences were considered statistically significant at p < 0.05.