Nano-curcumin mitigates aluminum oxide nanoparticle toxicity in Nile tilapia through antioxidant and immune modulation
Sahr B. Mahmoud, Maha M. Rashad, Ghada E. Ali, Eman Ragab, Omaima Ahmed, Fady Sayed Youssef, Ola Hasan Abd El Megeed
TL;DR
Nano-curcumin helps reduce the harmful effects of aluminum oxide nanoparticles in Nile tilapia by boosting antioxidants and immune responses.
Contribution
This study demonstrates the protective role of nano-curcumin against Al2O3-NP toxicity in fish through experimental validation.
Findings
N-CUR improved growth, feed efficiency, and specific growth rate in fish exposed to Al2O3-NPs.
N-CUR reduced ALT activity and enhanced immune markers like albumin and IgM.
N-CUR mitigated histopathological damage and oxidative stress caused by Al2O3-NPs.
Abstract
Our study investigated the toxicological effects of aluminum oxide nanoparticles (Al2O3-NPs) and the potential protective role of dietary nano-curcumin (N-CUR) in juvenile Oreochromis niloticus (30.39 ± 0.05 g) under controlled experimental conditions. It was hypothesized that N-CUR could mitigate the adverse impacts of Al2O3-NPs on growth, biochemical, oxidative, and histopathological parameters. A total of 180 O. niloticus were divided into six groups: a control group, two N-CUR-supplemented diets (40 and 50 mg/kg), an Al2O3-NP-exposed group (10 mg/L), and two co-treated groups receiving both treatments for 4 weeks. Growth performance, biochemical, immunological, antioxidant, and histopathological parameters were assessed. Exposure to Al2O3-NPs markedly reduced growth indices and survivability while elevating ALT activity and pro-inflammatory gene expression (TNFα, IL1β, MT).…
Genes, proteins, chemicals, diseases, species, mutations and cell lines named across the full text — each resolved to its canonical identifier and authoritative record.
Click any figure to enlarge with its caption.
Figure 10
Figure 11
Figure 12
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9- —National Research Centre Egypt
Peer Reviews
No public reviews on file for this paper yet. If you reviewed it on a platform where reviews are public (OpenReview, ICLR, NeurIPS, ICML), you can paste yours below so the community can read it here.
Videos
No videos yet. Explain this paper in a talk, walkthrough, or lecture? Add one.
Taxonomy
TopicsAluminum toxicity and tolerance in plants and animals · Nanoparticles: synthesis and applications · Coagulation and Flocculation Studies
Introduction
In the present era, metals and metal-based materials have become more widely used as a result of industrial and technological developments. Many metal nanoparticles have been proposed or experimentally investigated for use in aquaculture-related applications, such as pond and cage sterilization, fish feed, medications, water treatment procedures, packaging, and biofilm control (Khosravi-Katuli et al. 2017; Roy and Nat 2022). Such pollutants may have an impact on aquatic ecosystems because a significant percentage of industrial pollutants eventually find their way to aquatic habitats where they can be absorbed by aquatic life (Canli and Canli 2020). These metal oxide nanoparticles can penetrate through the cell membranes of gills and reach the brain through the blood–brain barrier (Hu and Gao 2010). Moreover, they can accumulate in tissues, causing toxicity and alterations in dynamic molecules such as enzymes (Hoseini et al. 2016). Exposure to aluminum oxide nanoparticle (Al_2_O_3_-NPs) has been stated to induce several detrimental effects in many fish species, including impaired neurodevelopmental behaviors, increased oxidative stress responses, genotoxicity, and histopathological anomalies such as hyperplasia and degeneration of the gills and liver tissues (Benavides et al. 2016; Murali et al. 2017; Chen et al. 2020; Temiz and Kargın 2022). Although there are no specific data available on the amount of Al_2_O_3_ nanoparticles in aquaculture ponds, environmental guideline values for aluminum in freshwater and marine systems (ANZECC & ARMCANZ, 2000) suggest that toxicity risks may exist for concentrations above 0.5–55 µg/L. In addition, laboratory experiments have demonstrated that aluminum oxide nanoparticles can persist in the aquatic environment and influence freshwater organisms, with Ceriodaphnia dubia being a sensitive bio-indicator for aluminum oxide nanoparticles at low concentrations (~ 1 µg/mL) (Pakrashi et al. 2013). The potential effects of Al_2_O_3_ nanoparticles on fish growth, physiology, immunity, and survival are still an experimental concern rather than a well-established aquaculture-specific problem because they may enter aquatic environments through various pathways. Consequently, it is of scientific interest to investigate safe and environmentally friendly methods to counteract toxicity caused by nanoparticles under carefully regulated experimental conditions.
Nile tilapia (Oreochromis niloticus) is the most widely cultivated fish species in Egypt, renowned for its flavorful and nutritional value (Mei et al. 2024). According to FAO (2024), Nile tilapia is now the world’s second most cultured fish species, with a yearly production of 5.3 million tons. It is also widely used as an experimental animal to study the effects of various pollutants (Canli and Canli 2020).
Curcumin (CUR) is a popular traditional herb and an active ingredient of Curcuma longa, commonly known as turmeric, which belongs to the family Zingiberaceae (Pal et al. 2020; El Basuini et al. 2022). The potential of curcumin to reduce metal-induced toxicity has been widely studied, as it can scavenge free radicals, acting as a natural chelating mediator, and/or induce antioxidant enzymes (Liu et al. 2005; Manolova et al. 2014). According to Jaruga et al. (1998), CUR can easily pass through the blood–brain barrier and cell membranes and scavenge toxic metals intracellularly due to its high lipophilicity. Nano-curcumin (N-CUR) dietary supplements have been shown to have immunostimulatory, growth-promoting, and antioxidant effects in a variety of fish species (Eissa et al. 2023b; Elabd et al. 2023). However, curcumin faces several obstacles regarding delivery, as it exhibits poor absorption and low bioavailability (Tabanelli et al. 2021). Consequently, to improve CUR distribution, stability, and availability, nano-delivery approaches have been used (Karthikeyan et al. 2020). Nanoparticles may improve distribution and efficiency, thereby decreasing the amount and cost of curcumin needed to be added to diets (Tawfik et al. 2020; Moghadam et al. 2021).
To date, no research study has demonstrated the integrated protective role of N-CUR against Al_2_O_3_-NP toxicity in Nile tilapia. Although each type of nanoparticle was separately assessed, their comparative biological activities have not been verified under the same experimental model. It should be pointed out that, although Al_2_O_3_ nanoparticles might pose a potential risk to the environment, the actual risk to aquaculture productivity has yet to be determined. Thus, the purpose of this study was to examine the effects of Al_2_O_3_-NPs and the possible protective role of N-CUR on growth performance, immune and antioxidant responses, inflammatory gene expression, and tissue pathology in Nile tilapia using a controlled experimental model. This study offers new mechanistic insights into the combined effects of dietary nano-curcumin and Al_2_O_3_-NPs in Nile tilapia under controlled experimental conditions.
Materials and methods
Preparation of nanoparticles
All materials used in this study were of analytical grade and used without additional purification. Curcumin powder (≥ 94% purity) and PVA (polyvinyl alcohol) with an average molecular weight (~ 30,000–70,000) were obtained from Sigma-Aldrich (St. Louis, MO, USA) for nano-curcumin preparation. Ethanol (absolute, ≥ 99.5%) and deionized water were used as solvents.
For the synthesis of aluminum oxide nanoparticles, aluminum nitrate nonahydrate [Al(NO_3_)3·9H_2_O] and aqueous ammonia solution (25%) were obtained from El-Nasr Chemicals Company (Cairo, Egypt). All solutions were prepared using deionized water, and all glassware was washed with nitric acid and rinsed carefully before use (Ibrahim and Kandil 2020).
Preparation of nano-curcumin (N-CUR)
Nano-curcumin was synthesized using a solvent evaporation technique. A total of 100 mg of curcumin was dissolved in 10 mL of ethanol and added dropwise to 90 mL of distilled water containing 0.5% PVA under magnetic stirring (1000 rpm, 1 h). The mixture was then ultrasonicated (20 kHz, 100 W, 10 min) and left to evaporate under reduced pressure. The resulting suspension was stored at 4 °C until use (Yallapu et al. 2012).
Preparation of aluminum oxide nanoparticles (Al2O3-NPs)
Aluminum oxide nanoparticles were prepared via a chemical precipitation method. A total of 5 g of Al (NO_3_)3·9H_2_O was dissolved in 100 mL of deionized water. Ammonia solution (25%) was added dropwise until pH 9 was reached. The white precipitate was stirred at 60 °C for 2 h, aged overnight, filtered, washed with water and ethanol, and dried at 100 °C. The dried material was then calcined at 500 °C for 3 h (Ibrahim and Kandil 2020).
Characterization of nanoparticles
The synthesized nanoparticles were characterized in terms of particle size, zeta potential, morphology, and structure. Dynamic light scattering (DLS) and zeta potential were analyzed using a Zetasizer Nano ZS (Malvern, UK). Transmission electron microscopy (TEM; JEOL JEM-2100) was used to observe the morphology (Sharma et al. 2009; Yallapu et al. 2010).
Calibration and validation of nanoparticle measurements
To validate the accuracy of nanoparticle measurement, all measuring equipment was calibrated and checked before we began to measure. For the DLS system (Zetasizer Nano ZS, Malvern, UK), a traceable certified polystyrene nanoparticle standard (100 nm) was used to ensure calibration accuracy of hydrodynamic size distribution and zeta potential. The TEM equipment (JEOL JEM-2100) was calibrated using a gold nanoparticle grid (20 nm) to optimize contrast, magnification, and dimension retrieval. All measurements were done at least 3 times (n = 3) and the particle size and zeta potential values obtained showed good reproducibility (< 5% of variation), indicating that the analytical procedures were precise and stable.
Gas chromatography–mass spectrometry (GC–MS) analysis
Using a direct capillary column TG–5MS (30 m × 0.25 mm × 0.25 µm film thickness), the samples were analyzed with a Trace GC1310–ISQ mass spectrometer (Thermo Scientific, Austin, TX, USA) at the Regional Center for Mycology and Biotechnology (RCMB), Al-Azhar University. Initially, the column oven temperature was maintained at 35 °C, then increased at a rate of 3 °C/min to 200 °C. A final temperature of 280 °C was reached after 10 min at a rate of 3 °C/min. The injector and MS transfer line temperatures were maintained at 250 °C and 260 °C, respectively. Helium was used as the carrier gas at a constant flow rate of 1 mL/min.
Aliquots of 1 µL were automatically injected using an Autosampler AS1300 coupled to the GC in split mode after a solvent delay of 3 min. Electron ionization (EI) mass spectra were collected in full-scan mode at an ionization voltage of 70 eV over an m/z range of 40–1000. The ion source temperature was set to 200 °C. Identification of components was based on comparison with the WILEY 09 and NIST 11 mass spectral libraries (Huwaimel et al. 2023).
Fish handling and experimental outlines
This experiment was performed at the Hydrobiology Department, National Research Centre, Dokki, Giza. A total of 180 healthy juvenile O. niloticus with an average body weight of 30.39 ± 0.05 g were obtained from a private fish farm in Kafr El-Sheikh Governorate, Egypt. Fish were transferred to the laboratory, kept in rectangular glass tanks (100 L capacity, working volume 70 L), and acclimatized for 2 weeks while being fed a control basal diet.
Fish were distributed in groups of 10, with three replicates per treatment, in tanks with continuous water flow (Table 1). This sample size was selected according to similar aquaculture studies (Abd El Megeed et al. 2025) and in accordance with Institutional Animal Ethics Committee recommendations that ensures sufficient biological differences between groups and power statistical analysis. Fish were fed three times per day (08:00 a.m., 2:00 p.m., and 5:00 p.m.) at a rate of 3% of their body weight for 4 weeks. The extruded fish diets were obtained from Aller Aqua Feed (Aller® Aqua, 6th of October City, Egypt) and adjusted according to NRC (2011).
Table 1. Groups and experimental dietGroupsExperimental dietGroup (1) (negative control)Basal diet + free dechlorinated water flowGroup (2)N-CUR 40 mg/kg diet + basal diet + free dechlorinated water flowGroup (3)N-CUR 50 mg/kg diet + basal diet + free dechlorinated water flowGroup (4)10 mg/L Al2O3-NPs (in water) + basal dietGroup (5)N-CUR 40 mg/kg diet + basal diet + 10 mg/L Al2O3-NPs (in water)Group (6)N-CUR 50 mg/kg diet + basal diet + 10 mg/L Al_2O3_-NPs (in water)
The proximate composition of the basal fish diet was as follows: crude protein (30%), fish meal (295 g/kg diet), crude fat (5%), crude fiber (8.35%), nitrogen-free extract (NFE) (47.2%), ash (5.8%), vegetable oil (35 g/kg diet), phosphorus (0.8%), digestible energy (8.7 MJ), and gross energy (17.8 MJ).
The control group received the basal diet without any treatment. The second and third groups were fed a diet supplemented with 40 and 50 mg N-CUR/kg diet, respectively, as reported by Eissa et al. (2023a). The fourth group was exposed to 10 mg/L Al_2_O_3-_NPs in water and fed the basal diet based on previously published toxicological studies to induce detectable biological responses under monitored experimental conditions (Abdel-Khalek et al. 2020). The fifth and sixth groups were exposed to 10 mg/L Al_2_O_3-_NPs in water and simultaneously supplemented with 40 and 50 mg N-CUR/kg diet, respectively, as shown in Fig. 1.Fig. 1. Flow chart displays the experimental outlines
During the 4-week experimental period, fish reflexes and behavior were monitored for any anomalies, and mortality rates were recorded daily. Water was replaced with clean, dechlorinated water, and Al_2_O_3-_NPs were re-added twice a week to maintain accurate concentrations and prevent loss over time.
Five fish from each biological replicate were collected for each assay, and each fish was considered an independent biological replicate. Biochemical, oxidative stress, and antioxidant assays were performed in triplicate technical replicates, and statistical analyses were based on the mean values of these technical replicates.
Growth performance, feed efficiency, and survivability
At the beginning of the experiment, the initial body weight (g) of each fish was measured, and growth performance was assessed at the end of the experimental period by randomly weighing each group of fish. Weight gain (g), specific growth rate (%/day), and feed conversion ratio (FCR) were calculated according to Abdel-Moneamet al. (2025a) as follows:
- Weight gain (g) = Final body weight (FBW, g) − Initial body weight (IBW, g).
- Weight gain rate (%) = [(FBW − IBW)/IBW] × 100.
- Specific growth rate (SGR, %/day) = 100 × [ln (FBW) – ln (IBW)]/Number of feeding days.
- Feed conversion ratio (FCR) = Feed intake (g)/Body weight gain (g).
- Survival rate (%) = (Number of surviving fish/Number of stocked fish) × 100.
Water quality parameters
Water quality parameters were monitored weekly throughout the experimental period. Dissolved oxygen (DO) was measured using an OXY-CHECK meter with a probe. Total ammonia nitrogen (TAN), nitrite (NO_2⁻), and nitrate (NO_3⁻) were determined using colorimetric kits. Electrical conductivity (EC) and pH were measured using standard digital meters.
Serum immunoglobulin M (IgM)
At the end of the experimental study, IgM levels were measured in fish serum (n = 5 per replicate) using the ELISA technique as outlined in the manufacturer’s kit (Biocheck Inc., Foster City, CA, USA). Optical density was measured spectrophotometrically at 490 nm using a Spectra Max 190 spectrophotometer (Molecular Devices, Sunnyvale, CA, USA). The IgM concentration in the samples was calculated by comparing the optical density (O.D.) of the samples with that of the control and expressed as mg/dL.
Biochemical tests
According to Reinhold (1953), total protein (TP) and albumin (ALB) were determined using commercial kits (Spectrum Co., Egypt) (n = 5/replicate). Globulin (GLO) values were calculated by subtracting ALB from TP. Alanine aminotransferase (ALT) activity was analyzed according to the manufacturer’s instructions for the commercial kits (Bio-Diagnostic Co., Giza, Egypt) using a UNICO S-1000 spectrophotometer (UNICO®).
Quantitative real-time PCR analysis
The relative mRNA abundance of gill and liver catalase (CAT), superoxide dismutase (SOD), tumor necrosis factor-α (TNFα), interleukin-1β (IL1β), and metallothionein (MT) genes was determined by quantitative real-time PCR (qRT-PCR) of cDNA samples, using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a housekeeping gene (Abdel-moneam et al. 2025a).
Total RNA was extracted from approximately 50 mg of gill and liver tissues (n = 5/replicate) using a total RNA extraction kit (Applied Biotechnology, EX02). RNA purity and concentration were verified using a NanoDrop spectrophotometer at 260 nm and 280 nm (Abd El Megeed et al. 2025). Reverse transcription was performed using M-MuLV reverse transcriptase (Applied Biotechnology, AMP 11). A quantitative assessment of cDNA amplification for each gene was performed using the fluorescent SYBR Green dye (Applied Biotechnology, AMP 03) (Abou-Okada et al. 2023).
The primer sequences used to amplify the selected genes are listed in Table 2. During the elongation phase of PCR, variations in product concentrations were determined by monitoring fluorescence intensity. Real-time PCR conditions consisted of an initial denaturation at 95 °C for 5 min, followed by 40 cycles of denaturation at 95 °C for 15 s, annealing at 60 °C for 20 s, and extension at 72 °C for 15 s. After the final amplification cycle, a melting curve analysis was performed using the following cycling conditions: 95 °C for 15 s, 55 °C for 15 s, and 95 °C for 15 s (Abou-Okada et al. 2023). Negative controls without templates were included in each experiment to ensure the accuracy of the results.
Table 2. The primer sequences used in RT-PCR analysisGeneAcc. noForwardReverseGAPDNM_001279552.1GCTGTACATGCACTCCAAGGACTCAAACACACTGCTGCTGCATJF801726.1AGAACTTGGCCGGGTTTCTACGGCTGTAAACGTGCAAAGTSODJF801727.1CCCTACGTCAGTGCAGAGATGCCGCCTCCATTAAACTTGATNF αNM_001279533.1GCCTCACAATTCTCAGCCACAAACACGCCAAAGAAGGTCCIL-1βKF747686.1CACAAGGATGACGACAAGCCTCTCCTGACACACTTCCACCMTXM_003447045.5CCGAAGAGACAAGAGCAACGCTGGTGTCGCATGTCTTTCC
Each qRT-PCR analysis was performed in biological triplicate, with each biological replicate measured three times. Relative transcription levels of each gene were normalized using GAPDH as a housekeeping gene (Abdel-moneam et al., 2025b), and the comparative 2^-^ΔΔCT method was applied to determine the expression levels (Livak and Schmittgen 2001).
Histopathological examination
The liver and gills of five O. niloticus from each replicate were excised, cut into pieces approximately 0.5 cm^3^ in size, and fixed for 24 h in 10% buffered neutral formalin solution. After dehydration through ascending grades of ethanol, the tissues were cleared in xylene and embedded in paraffin wax. Paraffin sections, 3–4 µm thick, were prepared using a rotary microtome and stained with hematoxylin and eosin (H&E) according to Bancroft and Gamble (2013). Tissue sections were examined under a light microscope (LEICA DM500) equipped with a digital camera (LEICA ICC50 HD).
Five slides from five fish per replicate were examined at × 400 magnification to evaluate the degree of histological alterations in the gills and liver among the experimental groups using a semiquantitative lesion grading system. The grading scale was applied based on the frequency and severity of the lesions as follows: Mild (+): < 25% of the section; Moderate (+ +): 25%–50% of the section; Severe (+ + +): > 50% of the section (Sayed and Younes 2017).
Statistical analysis
Data were analyzed using one-way analysis of variance (ANOVA) followed by Tukey’s multiple comparison post hoc test to determine significant differences among the experimental groups. Statistical analyses were performed using SPSS version 20 (IBM Corp., Armonk, NY, USA). Values are presented as mean ± SEM. Effect size was calculated as partial eta squared (ηₚ^2^) from ANOVA sums of squares according to Levine and Hullett (2002).
Results
Characterization of nano-curcumin (N-CUR) and aluminum oxide nanoparticles (Al2O3-NPs)
To confi rm nano-scaled characterization and colloidal stability, DLS and zeta potential studies, as well as TEM images, were recorded for nano-curcumin (N-CUR) and aluminum oxide nanoparticles (Al_2_O_3_ NPs). For N-CUR, DLS measurements (Fig.2) showed an average particle size of about 25 nm, whereas the zeta potential value (Fig. 3) of−29 mV indicated good colloidal stability. For Al_2_O_3_ nanoparticles, DLS analysis (Fig. 4) showed the particle size ranging between 25–45 nm, as verifi ed by zeta potential analysis (Fig. 5) with values ranging from −18 to −30 mV, indicating moderate but adequate electrostatic stability. TEM micrographs for N-CUR (Fig. 6) also showed that the particles were uniformly spherical, well-dispersed particles ranging between 11.2 and 20.6 nm, indicating theabsence of aggregation and suggesting stability for biological uptake. TEM images for Al_2_O_3_ NPs (Fig. 7) determined 30–50 nm particle cores of uniform morphology with no marked agglomeration. The good agreements between DLS and TEM for the two kinds of nanoparticles confirmed the controlled synthesis scheme and indicated the potential implementations in nanomedicine, toxicity management, and other medical engineering.Fig. 2. Size distribution profile of nano-curcumin particles as determined by dynamic light scattering (DLS)Fig. 3. Zeta potential of nano-curcumin particlesFig. 4Size distribution profile of Al_2_O_3_-NPs as determined by dynamic light scattering (DLS)Fig. 5. Zeta potential of Al_2_O_3_-NPsFig. 6Transmission electron microscopy (TEM) image of nano-curcumin (N-CUR) showing spherical particles that are well dispersed with a smooth surface. The particle sizes are in the ultra-nano region (11–20 nm), indicating good nanoscale separation without aggregation (500 nm scale bar)Fig. 7. Transmission electron micrograph of pure Al_2_O_3_-NPs (× 40,000) shows the uniform dispersion and spherical–polyhedral shape. The mean particle size is about 25–48 nm. This validates the nanoscale uniformity and confirms a tight particle size distribution seen in DLS and zeta potential measurements (500 nm scale bar)
Gas chromatography–mass spectrometry (GC–MS) analysis
The GC–MS spectrum further supported the identification of 17 bioactive volatile constituents within the nano-curcumin extract (Table 3). The main components were hexadecanoic and octadecanoic acids methyl esters and several derivatives of unsaturated fatty acid, which have been reported to have antioxidant and anti-inflammatory functions. The presence of these constituents proved the therapeutic importance of nano-curcumin, which may contribute to its protective effects against Al_2_O_3_ toxicity. Only major peaks are presented here, and full spectra were employed for verification, but they do not directly relate to the biological findings of this study. Table 3. Different bioactive volatile molecules in curcuminvia testing using GC–MSRTCompound nameMolecular formulaMolecular weightArea%45 0.632-Heptadecanone****C17H34O2540.3446 0.62Hexadecanoic acid, methyl ester****C17H34O2270****17.6648 0.45n-Hexadecanoic acid****C16H32O2256****0.8351 0.029,12-Octadecadienoic acid (Z,Z)****C18H32O2280****1.9451 0.539,12-Octadecadienoic acid (Z,Z)-, methyl ester****C19H34O2294****10.3151 0.939-Octadecenoic acid (Z)-, methyl ester****C19H36O2296****40.2352 0.0411-Octadecenoic acid, methyl ester****C19H36O2296****4.1552 0.73Methyl stearate****C19H38O2298****8.9753 0.179,15-Octadecadienoic acid, methyl ester****C19H34O22940.3954 0.329,11-Octadecadienoic acid, methyl ester, (E,E)****C19H34O2294****2.9656 0.42Oleic acid****C18H34O2282****0.4059 0.54Eicosanoic acid, methyl ester****C21H42O2326****0.6465 0.66Docosanoic acid, methyl ester****C23H46O2354****0.5170 0.94Tetracosanoic acid, methyl ester****C25H50O2382****0.2983 0.13Palmitic acid, 2-(tetradecyloxy) ethyl ester****C32H64O3496****2.2279 0.68Oleic acid, 3-(octadecyloxy)propyl ester****C39H76O3592****6.8589 0.979-Octadecenoic acid, 1,2,3-propanetriyl ester, (E,E,E)****C57H104O6884****1.31
Clinical symptoms of treated fish
Fish in groups 1, 2, 3, 5, and 6 appeared clinically normal without any external lesions throughout the experimental period (Fig. 8A–C). In contrast, group 4, which was exposed to Al_2_O_3-NPs, showed darkening, loss of scales, scattered hemorrhages, skin discoloration, and fin and tail rot. Internal lesions included severely congested gills, brain and internal organs, an enlarged pale liver, and an engorged gall bladder (Fig. 8D–H).Fig. 8. Clinical manifestations of treated O. niloticus. Apparently, healthy fish in groups (1,2,3,5, and 6) showed normal gills, skin, and internal organs (A, B, C). Groups exposed to Al_2_O_3-NPs showed enlarged pale liver, congested gills, and internal organs, skin darkening, hemorrhagic patches on skin, tail rot, loss of scales, and engorged gall bladder (D, E, F, G, and H) (scale bar = 1 cm)
Growth performance and fish survivability
As shown in Table 4, the Al_2_O_3-_NP-exposed group showed significant decreases (P < 0.05) in final weight (g), weight gain (g), and weight gain rate (%) compared to the control group, while N-CUR-supplemented groups exhibited significant increases (P < 0.05). Conversely, the feed conversion ratio showed a significant decrease (P < 0.05) in all groups compared to the Al_2_O_3-_NP-exposed group. Feed intake (g) increased significantly (P < 0.05) in all groups compared to the control group. Specific growth rate (%/day) was significantly higher in all groups compared to the Al_2_O_3-NP-exposed group. Fish groups received both treatments (Al_2_O_3-NPs + N-CUR 40–50 mg/kg diet) showed a significant increase (P < 0.05) in the growth parameters (final weight (g), weight gain (g), and weight gain rate (%)) compared to the Al_2_O_3-NP-exposed group. The survival rate (%) showed a significant increase (P < 0.05) in all groups (100% and 98%) compared to the Al_2_O_3-NP-exposed group (95%). As shown in Table 5, the 95% confidence intervals indicate a narrow range, highlighting the low variability and high consistency among the measured values. Table 4. Effects of aluminum oxide nanoparticles (Al_2_O_3-NPs) and/or curcuminnanoparticles (N-CUR) on growth performance and survival rates of O. niloticusFish groupsGrowth performance valuesInitial weights (G/fish)Final weights (G/fish)Weight gains (G/fish)Weight gain rate (%)Feed intake (G/fish)Feed conversion rateSpecific growth rate (%/D)Survivability (%)Group (1)30.39 ± 0.0536.51 ± 0.20^d^6.12 ± 0.22^d^20.16 ± 0.73^d^30.81 ± 0.23^d^5.22 ± 0.19^b^0.42 ± 0.23^e^98%^b^Group (2)30.39 ± 0.0542.10 ± 0.35^b^11.71 ± 0.35^b^38.54 ± 1.19^b^33.26 ± 0.28^bc^2.91 ± 0.08^c^1.08 ± 0.28^c^100%^a^Group (3)30.39 ± 0.0552.43 ± 0.37^a^22.04 ± 0.37^a^72.52 ± 1.24^a^34.53 ± 0.28^ab^1.58 ± 0.31^d^1.82 ± 0.23^a^100%^a^Group (4)30.39 ± 0.0535.61 ± 0.09^d^5.21 ± 0.98^d^17.17 ± 0.33^d^32.43 ± 0.34^c^6.28 ± 0.13^a^0.21 ± 0.01^f^95%^c^Group (5)30.39 ± 0.0540.79 ± 0.24^c^10.39 ± 0.24^c^34.22 ± 0.83^c^34.33 ± 0.36^ab^3.35 ± 0.08^c^0.67 ± 0.01^d^100%^a^Group (6)30.39 ± 0.0552.01 ± 0.34^a^21.62 ± 0.36^a^71.17 ± 1.24^a^35.06 ± 0.37^a^1.63 ± 0.03^d^1.48 ± 0.02^b^100%^a^P-*****value**1*** < 0.001**** < 0.001**** < 0.001**** < 0.001**** < 0.001**** < 0.001**** < 0.001Effect size (η^2^)NA0.9490.9470.9450.4150.8930.960****1.0Values are presented as ± SEM. Dissimilar letters indicate significant differences found between fish groups in the same column (P < 0.05) (n = **5/replicate). Initial weight (IW) showed no significant difference among groups (P = 1). Group (1): negative control, group (2): fish group supplemented with 40 mg/kg diet N-CUR, group (3): fish group supplemented with 50 mg/kg diet N-CUR, group (4): exposed group to 10 mg/L Al_2_O_3-NPs, group (5): fish group supplemented with 40 mg/kg diet N-CUR and exposed to 10 mg/L Al_2_O_3-NPs, group (6): fish group supplemented with 50 mg/kg diet N-CUR and exposed to 10 mg/L Al_2_O_3-NPs. Effect size (η^2^) indicates the proportion of total variance explained by the group factor η^2^ = (0.01**—**small), (0.06—medium), (0.14—large effect)
Table 595% confidence intervals of all groups for growth parameterGroupsFinal weights (G/fish)Weight gains (G/fish)Weight gain rate (%)Feed intake (G/fish)Feed conversion rateSpecific growth rate (%/D)Survivability (%)Group (1)**36.08–36.945.67–6.5718.65–21.6630.33–31.284.82–5.620.37–0.4798%**Group (2)**41.37–42.8310.97–12.4436.11–40.9832.68–33.842.73–3.091.02–1.14100%**Group (3)**51.67–53.1921.27–22.8069.98–75.0633.94–35.121.51–1.641.77–1.87100%**Group (4)**35.41–35.815.01–5.4216.49–17.8531.72–33.135.99–6.560.19–0.2395%**Group (5)**40.29–41.289.88–10.9032.51–35.9233.58–35.073.17–3.530.63–0.71100%**Group (6)**51.30–52.7320.87–22.3668.62–73.7134.29–35.831.57–1.691.44–1.53100%**Values are represented as lower and upper bounds. Group (1): negative control, group (2): fish group supplemented with 40 mg/kg diet N-CUR, group (3): fish group supplemented with 50 mg/kg diet N-CUR, group (4): exposed group to 10 mg/L Al_2_O_3_-NPs, group (5): fish group supplemented with 40 mg/kg diet N-CUR and exposed to 10 mg/L Al_2_O_3_-NPs, group (6): fish group supplemented with 50 mg/kg diet N-CUR and exposed to 10 mg/L Al_2_O_3_-NPs
Water quality analyses
Results shown in Table 6 reveal that nearly all measured parameters were within the permissible limits (PL), except for NO_2_ results in all groups, which exceeded the PL as reported by the EPA (2001). There were no significant differences among groups in temperature, pH, and dissolved oxygen; however, significant differences (P < 0.05) were observed among all groups for EC, TAN, NO_2_, and NO_3_ compared to the Al_2_O_3_-NP-exposed group. As shown in Table 7, the 95% confidence intervals indicate a narrow range, highlighting the low variability and high consistency among the measured values. Table 6. Effects of aluminum oxide nanoparticles (Al_2_O_3_-NPs) and/or curcuminnanoparticles (N-CUR) on water quality parametersGroupsWater quality parametersTemperatureDissolved oxygenPHElectrical conductivityTotal ammonia nitrogenNO_3_NO_2_Group (1)29.05 ± 0.166.74 ± 0.106.65 ± 0.0859.72 ± 0.14^b^0.0012 ± 0.00002^b^0.061 ± 0.0001^b^0.184 ± 0.00^a^Group (2)29.02 ± 0.216.67 ± 0.116.80 ± 0.0459.64 ± 0.13^b^0.0012 ± 0.00002^b^0.061 ± 0.0001^b^0.184 ± 0.00^a^Group (3)29.01 ± 0.196.66 ± 0.116.79 ± 0.3959.60 ± 0.07^b^0.0012 ± 0.00003^b^0.061 ± 0.0001^b^0.183 ± 0.00^a^Group (4)29.05 ± 0.186.62 ± 0.136.78 ± 0.0360.47 ± 0.22^a^0.0017 ± 0.00005^a^0.065 ± 0.0005^a^0.177 ± 0.00^b^Group (5)29.01 ± 0.236.72 ± 0.106.77 ± 0.0459.65 ± 0.06^b^0.0012 ± 0.00002^b^0.061 ± 0.0002^b^0.185 ± 0.00^a^Group (6)28.97 ± 0.206.59 ± 0.146.70 ± 0.0559.75 ± 0.10^b^0.0012 ± 0.00002^b^0.061 ± 0.0001^b^0.183 ± 0.00^a^P-value10.9440.215 < 0.001 < 0.001 < 0.001 < 0.001Effect size (η^2^)0.00150.0150.0850.2711.01.01.0Values are presented as ± SEM. Dissimilar letters indicate significant differences found between fish groups in the same column (P < 0.05) (n** = 5/replicate). Group (1): negative control, group (2): fish group supplemented with 40 mg/kg diet N-CUR, group (3): fish group supplemented with 50 mg/kg diet N-CUR, group (4): exposed group to 10 mg/L Al_2_O_3_-NPs, group (5): fish group supplemented with 40 mg/kg diet N-CUR and exposed to 10 mg/L Al_2_O_3_-NPs, group (6): fish group supplemented with 50 mg/kg diet N-CUR and exposed to 10 mg/L Al_2_O_3_-NPs.NO_2_ (nitrite)and NO_3_ (nitrate). Effect size (η^2^) indicates the proportion of total variance explained by the group factor η^2^ = (0.01—**small), (0.06—medium), (0.14—large effect)Table 795% confidence intervals of all groups for water quality parametersGroupsTemperatureDissolved oxygenPHElectrical conductivityTotal ammonia nitrogenNO_3_NO_2_Group (1)28.70–29.396.52–6.966.47–6.8259.41–60.020.0011698–0.00125880.06093–0.061640.18340–0.18602Group (2)28.55–29.486.41–6.926.71–6.8859.35–59.930.0011871–0.00128430.06102–0.061560.18391–0.18538Group (3)28.58–29.446.41–6.916.70–6.8759.45–59.760.0011628–0.00129430.06093–0.061640.18277–0.18466Group (4)28.65–29.466.33–6.956.70–6.8659.97–60.960.0016420–0.00185800.06419–0.066380.17582–0.17832Group (5)28.49–29.516.50–6.956.68–6.8659.51–59.790.0011758–0.00128130.06108–0.062060.18393–0.18621Group (6)28.53–29.406.28–6.896.58–6.8159.51–59.980.0011699–0.00127300.06129–0.062130.18259–0.18413Values are represented as lower and upper bounds. Group (1): negative control, group (2): fish group supplemented with 40 mg/kg diet N-CUR, group (3): fish group supplemented with 50 mg/kg diet N-CUR, group (4): exposed group to 10 mg/L Al_2_O_3_-NPs, group (5): fish group supplemented with 40 mg/kg diet N-CUR and exposed to 10 mg/L Al_2_O_3_-NPs, group (6): fish group supplemented with 50 mg/kg diet N-CUR and exposed to 10 mg/L Al_2_O_3_-NPs. NO_2_ (nitrite)and NO_3_ (nitrate)
Biochemical analysis and immunological indices
Data presented in Table 8 show that exposure to Al_2_O_3_-NPs caused a significant increase (P < 0.05) in ALT levels in fish serum (8.53 ± 0.007) compared to the control group. In contrast, groups supplemented with N-CUR showed a significant decrease (P < 0.05) in ALT levels compared to the Al_2_O_3_-NP-exposed group. Fish groups received both treatments (Al_2_O_3_-NPs + N-CUR 40–50 mg/kg diet) showed a significant decrease in ALT levels (5.31 ± 0.012, 5.11 ± 0.005, respectively) versus the Al_2_O_3_-NP-exposed group (8.53 ± 0.007). TP, ALB, A/G, and IgM significantly decreased in the Al_2_O_3_-NP-exposed group. However, N-CUR-supplemented groups showed significant increases (P < 0.05) in TP, ALB, and IgM levels compared to the Al_2_O_3_-NP-exposed group. The group supplemented with the lower dose (40 mg/kg diet) showed a significant decrease (P < 0.05) in GLO levels compared to the control group. Fish groups received both treatments (Al_2_O_3_-NPs + N-CUR 40–50 mg/kg diet) showed a significant increase (P < 0.05) in TP, ALB, and IgM versus the Al_2_O_3_-NP-exposed group. As shown in Table 9, the 95% confidence intervals indicate a narrow range, highlighting the low variability and high consistency among the measured values.
Table 8. Effect of N-CUR and/or Al_2_O_3_-NPs on biochemical and immunological indicesGroupsBiochemical and immunological indicesAlanine aminotransferaseTotal proteins (g/dL)Albumin (g/dL)Globulin (g/dL)Albumin/globulin ratioIgM (mg/dL)Group (1)6.14 ± 0.005b3.40 ± 0.005c2.04 ± 0.005d1.36 ± 0.005e1.50 ± 0.005b2.38 ± 0.005dGroup (2)5.54 ± 0.005d3.90 ± 0.004a2.05 ± 0.004c1.85 ± 0.005a1.10 ± 0.005d3.82 ± 0.004aGroup (3)5.79 ± 0.007c3.90 ± 0.004a2.40 ± 0.005a1.50 ± 0.004c1.60 ± 0.005a3.23 ± 0.004bGroup (4)8.53 ± 0.007a2.50 ± 0.004e0.90 ± 0.004f1.60 ± 0.004b0.56 ± 0.005e1.92 ± 0.005fGroup (5)5.31 ± 0.012e3.25 ± 0.004d1.90 ± 0.006e1.35 ± 0.005f1.40 ± 0.005c2.28 ± 0.003eGroup (6)5.11 ± 0.005f3.65 ± 0.004b2.20 ± 0.004b1.45 ± 0.005d1.50 ± 0.005b3.04 ± 0.005cEffect size (η2)0.96250.99720.9960.9960.99980.9982Values are presented as standard error of the mean ± (SEM). n = 5 (fish per replicate). Different letters show significant differences found between fish groups in the same column (P < 0.05). Group (1): negative control, group (2): fish group supplemented with 40 mg/kg diet N-CUR, group (3): fish group supplemented with 50 mg/kg diet N-CUR, group (4): exposed group to 10 mg/L Al_2_O_3_-NPs, group (5): fish group supplemented with 40 mg/kg diet N-CUR and exposed to 10 mg/L Al_2_O_3_-NPs, group (6): fish group supplemented with 50 mg/kg diet N-CUR and exposed to 10 mg/L Al_2_O_3_-NPs. Effect size (η^2^) indicates the proportion of total variance explained by the group factor η^2^** = (0.01—**small), (0.06—medium), (0.14—large effect)Table 995% confidence intervals of all groups for biochemical and immunological indicesGroupsAlanine aminotransferaseTotal proteins (g/dL)Albumin (g/dL)Globulin (g/dL)Albumin/globulin ratioIgM (mg/dL)Group (1)5.75–6.243.29–3.371.79–1.871.45–1.541.19–1.24****2.32–2.37Group (2)3.85–4.612.62–2.871.07–1.321.42–1.670.74–0.79****1.72–1.97Group (3)5.10–6.093.86–4.052.82–3.070.92–1.102.86–2.98****3.62–3.87Group (4)5.75–6.514.16–4.281.98–2.142.17–2.200.90–0.95****3.05–3.14Group (5)4.74–5.613.15–3.241.70–1.791.42–1.471.18–1.23****2.32–2.37Group (6)5.05–5.543.51–3.631.80–1.891.70–1.751.04–109****2.71–2.80Values are represented as lower and upper bounds. Group (1): negative control, group (2): fish group supplemented with 40 mg/kg diet N-CUR, group (3): fish group supplemented with 50 mg/kg diet N-CUR, group (4): exposed group to 10 mg/L Al_2_O_3_-NPs, group (5): fish group supplemented with 40 mg/kg diet N-CUR and exposed to 10 mg/L Al_2_O_3_-NPs, group (6): fish group supplemented with 50 mg/kg diet N-CUR and exposed to 10 mg/L Al_2_O_3_-NPs
Antioxidant-related gene (CAT and SOD) expressions
As illustrated in Fig. 9 A, B, group 4 exposed to Al_2_O_3_-NPs showed significant downregulation of the CAT gene expression in the gills and liver to 0.07- and 0.10-fold, respectively, compared to the control group (P < 0.05). Similarly, the Al_2_O_3_-NP-exposed group significantly downregulated SOD gene expression in the gills and liver to 0.04- and 0.08-fold, respectively, versus the control group (P < 0.05).Fig. 9. The mRNA relative expression of antioxidant-related genes (CAT and SOD) (A, B) and expression in immune-related genes (TNFα and IL1β) (C, D) in the gills and liver of O. niloticus exposed to Al_2_O_3_-NPs and/or N-CUR (40–50 mg/kg diet). Values are shown as mean ± SE (n = 5 fish/replicate). Groups with dissimilar letters are significantly different from each other at P < 0.05. Groups with the same letters are not significantly different. Group (1): negative control, group (2): fish group supplemented with 40 mg/kg diet N-CUR, group (3): fish group supplemented with 50 mg/kg diet N-CUR, group (4): exposed group to 10 mg/L Al_2_O_3_-NPs, group (5): fish group supplemented with 40 mg/kg diet N-CUR and exposed to 10 mg/L Al_2_O_3_-NPs, group (6): fish group supplemented with 50 mg/kg diet N-CUR and exposed to 10 mg/L Al_2_O_3_-NPs
When compared to the group treated with Al_2_O_3_-NPs, N-CUR co-treatment markedly improved the expression of both genes (P < 0.05). The co-treatment with a low dose in group 5 significantly upregulated CAT expression in the gills and liver to 0.19- and 0.35-fold, respectively. The improvement achieved by the high dose of N-CUR in group 6 increased CAT expression to 0.34- and 0.54-fold in the gills and liver, respectively, compared to the Al_2_O_3_-NPs-treated group.
Similarly, SOD expression was upregulated by co-treatment with the low dose of N-CUR in group 5 to 0.13- and 0.23-fold in the gills and liver, respectively, compared to the Al_2_O_3_-NP-exposed group. Additionally, the high dose of N-CUR co-treatment in group 6 significantly upregulated the gene expression in the gills and liver to 0.28- and 0.44-fold, respectively, compared to the Al_2_O_3_-NP-treated group. As shown in Table 10, the 95% confidence intervals indicate a narrow range, highlighting the low variability and high consistency among the measured values. Table 1095% confidence intervals, means, and effect size of all groups for gene expression assayGenesGroupsConfidence intervalsMeansEffect sizeLowerUpperCATGroup (1)1.001.001.000.99Group (2)1.011.131.07Group (3)0.951.441.20Group (4)0.060.080.07Group (5)0.140.220.18Group (6)0.250.420.34SODGroup (1)1.001.001.000.99Group (2)0.941.141.04Group (3)0.851.341.10Group (4)0.040.040.04Group (5)0.090.170.13Group (6)0.210.330.27TNFαGroup (1)1.001.001.000.99Group (2)0.911.010.96Group (3)0.940.970.95Group (4)8.579.098.83Group (5)4.655.415.03Group (6)3.444.754.10IL1βGroup (1)1.001.001.000.99Group (2)0.911.030.97Group (3)0.931.010.97Group (4)7.167.907.53Group (5)4.084.844.46Group (6)2.424.433.43MTGroup (1)1.001.001.000.99Group (2)0.931.081.00Group (3)1.011.141.08Group (4)10.341511.5910.96Group (5)5.906.896.40Group (6)4.045.084.56Group (1): negative control, group (2): fish group supplemented with 40 mg/kg diet N-CUR, group (3): fish group supplemented with 50 mg/kg diet N-CUR, group (4): exposed group to 10 mg/L Al_2_O_3_-NPs, group (5): fish group supplemented with 40 mg/kg diet N-CUR and exposed to 10 mg/L Al_2_O_3_-NPs, group (6): fish group supplemented with 50 mg/kg diet N-CUR and exposed to 10 mg/L Al_2_O_3_-NPs. Effect size (η^2^) indicates the proportion of total variance explained by the group factor η^2^** = (0.01—**small), (0.06—medium), (0.14—large effect)
Immune-related genes (TNFα and IL1β) expression
The TNFα gene showed significant upregulation in the gills and liver of group 4, treated with Al_2_O_3_-NPs, reaching 8.83- and 6.09-fold increases, respectively, compared with the negative control group (P < 0.05). Similarly, the Al_2_O_3_-NP-exposed group also showed a significant upregulation of IL-1β gene expression in the gills and liver, to 7.54- and 5.77-fold, respectively, compared to the negative control group (P < 0.05).
When compared to the group treated with Al_2_O_3_-NPs, N-CUR co-treatment markedly downregulated the expression of both genes (P < 0.05). As shown in Fig. 9C, D, co-treatment with the low dose of N-CUR in group 5 significantly downregulated TNFα expression in the gills and liver to 5.03- and 4.23-fold, respectively. Furthermore, the high dose of N-CUR in group 6 reduced TNFα gene expression to 4.10- and 3.17-fold in the gills and liver, respectively, compared to the Al_2_O_3_-NP-treated group.
The downregulation of IL1β expression by co-treatment with the low dose of N-CUR (group 5) reached 4.47- and 3.33-fold in the gills and liver, respectively. In addition, gene expression in the gills and liver was significantly downregulated (P < 0.05) to 3.43- and 2.67-fold, respectively, in group 6, which received the high dose of N-CUR co-treatment compared to the Al_2_O_3_-NP-treated group. As shown in Table 10, the 95% confidence intervals indicate a narrow range, highlighting the low variability and high consistency among the measured values.
Metallothionein (MT) gene expression
The Al_2_O_3_-NP-exposed group showed significant upregulation of MT expression in both the gills and liver, reaching 10.97- and 8.43-fold, respectively, versus the negative control group (P < 0.05). MT expression levels in the gills and liver were significantly downregulated in groups co-treated with N-CUR and exposed to Al_2_O_3_-NPs compared to the Al_2_O_3_-NP-exposed group (P < 0.05), as shown in Fig. 10.Fig. 10. Expression of metallothionein (MT) gene in Al_2_O_3_-NPs and/or N-CUR(40–50 mg/kg diet) groups in*O. niloticus.*Values are shown as mean ± SE (n = 5 fish/replicate). Groups with dissimilar letters are significantly different from each other (P < 0.05). Groups with the same letters are not significantly different. Group (1): negative control, group (2): fish group supplemented with 40 mg/kg diet N-CUR, group (3): fish group supplemented with 50 mg/kg diet N-CUR, group (4): exposed group to 10 mg/L Al_2_O_3_-NPs, group (5): fish group supplemented with 40 mg/kgdietN-CUR and exposed to 10 mg/L Al_2_O_3_-NPs, group (6): fish group supplemented with 50 mg/kg diet N-CURand exposed to 10 mg/L Al_2_O_3_-NPs
Downregulation of MT expression following co-treatment with the low dose of N-CUR (group 5) resulted in 6.40- and 4.37-fold expression in the gills and liver, respectively. Moreover, the high dose of N-CUR co-treatment (group 6) significantly downregulated MT expression to 4.57- and 2.37-fold in the gills and liver, respectively, compared to the Al_2_O_3_-NP-treated group. As shown in Table 10, the 95% confidence intervals indicate a narrow range, highlighting the low variability and high consistency among the measured values.
Histopathological examination
Histological examination of the gills
As described in Fig. 11, H&E-stained sections of the gills in groups 1, 2, and 3 of O. niloticus exhibited no histopathological changes. Primary and secondary lamellae were found to be normally arranged, with the primary lamellae covered by stratified squamous epithelial cells known as epithelial pavement cells (PVCs) and acidophilic chloride cells located at the bases of the secondary lamellae. Pillar cells separated the secondary lamellar surface, which was covered with overlapping PVCs. The primary lamellae contained a central venous sinus, while the secondary lamellar spaces contained blood capillaries with homogeneously eosinophilic erythrocytes whose nuclei were darkly basophilic (Fig. 11a–c).Fig. 11. Sections of O. niloticus gills stained with H&E stain. a Group (1) showing normal gill lamellar organization of primary lamellae (PL) and the semilunar secondary lamellae (SL). The primary lamellae lined by epithelial pavement cells (PVC) and chloride cells at the bases of the secondary lamellae (c black circle). Secondary lamellae lined with (PVC), pillar cells (p), and its lamellar spaces contained blood capillaries with eosinophilic erythrocytes (E). b Group (2) normal gills with primary lamellae (PL) andsecondary lamellae (SL). The primary lamellae had a central venous sinus (VS). c Group (3)normal primary lamellae (PL), secondary lamellae (SL), and a central venous sinus (VS). H&E 1000X −1000 X −1000X. d–g Sections of O. niloticus gills of group (4) showing (d) telangiectasia in the capillary of the secondary lamellae (black star), e congestion in the central venous sinus (black star) and deformity of the secondary lamellae (black arrow), f epithelialhyperplasia (black star) and fusion of the secondary lamellae (black arrow), g secondary lamellae with curving (black arrow) and shortening in the secondary lamellae (red arrow). H&E 1000X- 1000X- 1000X, and 100X. h Sectionof group (5) revealed partial recovery showing less congested central venous sinus (VS). Curving and epithelial lifting of secondary lamellae (SL) (black arrow). i Section of group (6) some of the secondary lamellae (SL) still having curving deformities (black arrow). H&E 1000X −1000X
However, the gills obtained from group 4 (O. niloticus exposed to Al_2_O_3_-NPs) showed several histopathological alterations, including telangiectasia in the capillaries of the secondary lamellae (Fig. 11d), congestion in the central venous sinus and deformity of the secondary lamellae (Fig. 11e), epithelial hyperplasia and fusion of the secondary lamellae (Fig. 11f), and abnormal organization of both primary and secondary lamellae with curving and shortening of the secondary lamellae (Fig. 11g). In contrast, the gills of group 5 revealed partial recovery, showing mild improvement in the arrangement and shape of the primary and secondary lamellae, as well as less congestion in the central venous sinus. No telangiectasia was observed in the secondary lamellae compared to group 4. However, some secondary lamellae still exhibited deformities such as bending, curving, and epithelial lifting (Fig. 11h).
Histological examination of group 6 revealed that the gills appeared nearly normal. There was no evidence of epithelial lifting in either the primary or secondary lamellae; however, some secondary lamellae still exhibited mild curving deformities (Fig. 11i).
Histopathological examination of liver
H&E-stained liver sections from O. niloticus in groups 1, 2, and 3, examined under a light microscope, revealed a normal histological architecture of the liver parenchyma, which contained a portal vein surrounded by pancreatic tissue (Fig. 12a). The parenchyma consisted of normal polyhedral hepatocytes with a central spherical nucleus and a densely stained, prominent nucleolus. Blood sinusoids between the hepatocytes appeared consistently normal (Fig. 12b, c).Fig. 12. Sections of O. niloticus liver stained with H&E stain. a Group (1) showing normal hepatocyte (black arrow) and the blood sinusoids between the hepatocytes (yellow arrow), portal vein (PV) surrounded by pancreatic tissue (PT). b, c Groups (2 and 3)showing hepatocytes with vesicular, spherical nuclei and prominent nucleolus (black arrow) and the blood sinusoids (yellow arrow) between the hepatocytes. H&E 1000X −1000X-1000X. d–f Sections of group (4): d pyknosis of nuclei of hepatocytes with dark condensed chromatin (black arrow). Vacuolization and hydropic degeneration of the hepatocytes (black star) and ruptured hepatocytes (red arrow). **e **Dilatation and congestion of the central vein (CV) and the portal vein (PV) surrounded with pancreatic tissue (PT). f The blood sinusoids dilated and congested with blood (yellow arrow). Some hepatocytes progressively damaged with complete loss of theirstructure and nucleus (black arrow). g Group (5) showing some hepatocytes showed normal shapes with spherical and vesicular nuclei (black arrow and black circle) while other cells still vacuolated (red arrow and red circle) with normal blood sinusoids (yellow arrow). H&E 1000X −100X- 1000X-1000X. h, i Group (6) showing the portal vein with normal blood flow (PV). i The central vein (CV) and the blood sinusoids were not congested (yellow arrow). Many hepatocytes appeared normal (black arrow) while some showed pyknotic nuclei (black chevron). H&E 100X- 1000X
In contrast, the liver of O. niloticus in group 4 showed several histopathological changes compared to the liver of fish in groups 1, 2, and 3, such as degradation of hepatic tissue, disintegration of hepatocytes, and pyknosis of hepatocyte nuclei with dark, condensed chromatin. Vacuolization and hydropic degeneration of hepatocytes were also observed. Moreover, rupture of some hepatocytes was noted (Fig. 12d). The central and portal veins appeared severely congested with blood (Fig. 12e), and the blood sinusoids were dilated and congested. Furthermore, some hepatocytes were progressively damaged, resulting in the complete loss of their structure and nuclei (Fig. 12f).
In group 5, the liver parenchyma showed mild improvement. Although some hepatocytes remained vacuolated, others exhibited normal morphology with spherical or vesicular nuclei containing prominent nucleoli. The blood sinusoids were not congested (Fig. 12g).
In group 6, the portal vein appeared with normal blood flow (Fig. 12h). The central vein and blood sinusoids were not congested. Furthermore, many hepatocytes appeared normal, while some displayed pyknotic nuclei (Fig. 12i).
The scoring of histopathological lesions in the gills and liver of O. niloticus in the experimental groups is presented in Table 11.
Table 11. Effect of N-CUR on the scoring of the histopathological alterations induced by Al_2_O_3_-NPs in the gills and liver of O. niloticusLesionsGroup (1)Group (2)Group (3)Group (4)Group (5)Group (6)GillsEpithelial hyperplasia and fusionTelangiectasiaLamellar curvingCongestion**-˗˗˗-˗˗˗-˗˗˗ + + + **** + + + **** + + + **** + + + ˗˗**** + + **** + ˗˗**** + ˗LiverHepatocytes vacuolationNuclear pyknosisVascular congestion˗˗˗˗˗˗˗˗˗˗˗˗ + + + **** + + + **** + + + **** + + + **** + ˗˗˗˗˗˗****˗**Absent: (˗); mild: (+) < 25% of the section. Moderate: (+ +) 25–50% of the section. Severe:(+ + +) > 50% of the section.Group (1): negative control, group (2): fish group supplemented with 40mg/kg diet N-CUR, group (3): fish group supplemented with 50mg/kg diet N-CUR, group (4): exposed group to 10mg/LAl_2_O_3_-NPs, group (5) fish group supplemented with 40mg/kg diet N-CUR and exposed to 10mg/LAl_2_O_3_-NPs, group (6) fish group supplemented with 50mg/kg diet N-CUR and exposed to 10mg/LAl_2_O_3_-NPs
Discussion
Our outcomes provide insights into the ameliorative effect of N-CUR against Al_2_O_3_-NP toxicity in Nile tilapia. Based on the current findings, N-CUR can mitigate the detrimental effects of Al_2_O_3_-NP toxicity on juvenile O. niloticus. This protective effect against Al_2_O_3_-NP-induced toxicity may be due to its potent antioxidant and anti-inflammatory components. To the best of our knowledge, this is the first study to assess the combined effects of dietary nano-curcumin supplementation and exposure to Al_2_O_3_-NPs on Nile tilapia growth, immunological, antioxidant, molecular, and histopathological responses under the same controlled experimental conditions. In this context, GC–MS analysis of N-CUR revealed several compounds, including polyunsaturated fatty acids and 9,12-octadecadienoic acid (linoleic acid). These compounds are known to have strong antioxidant and growth-promoting properties. Dietary supplementation with linoleic acid (LA) has been shown to enhance nutrient absorption and improve membrane fluidity. As mentioned by Ma et al. (2020), dietary supplementation of linoleic acid in carp resulted in a significant increase in final body weight and body weight gain. Additionally, LA supports antioxidant defense by regulating the production of enzymes such as GPx and SOD (Castro et al. 2016).
In the current study, the impairment in growth parameters following Al_2_O_3_-NPs exposure is consistent with the findings of Yu et al. (2017), who reported that the growth and feed utilization of juvenile tilapia exposed to aluminum ions were significantly decreased, while mortality rates increased. This impairment may be associated with the deterioration in the water quality parameters and poor feed utilization (Sweilum 2006). Additionally, energy diverted to detoxification pathways, such as modifications in protein and carbohydrate metabolism, reduced energy for growth (Ibrahim et al. 2019). Although these effects have implications for potential environmental impacts, they do not provide direct evidence for aquaculture risk.
Co-treatment with N-CUR (40–50 mg/kg diet) resulted in improvements in growth parameters, consistent with Eissa et al. (2023a), who reported increases in weight gain, specific growth rate, and survival rate in red tilapia supplemented with N-CUR in the diet. Similarly, Eissa et al. (2022) showed that Nile tilapia supplemented with N-CUR exhibited significant increases in weight gain, final body weight, and specific growth rate. The survival rate of O. niloticus was not affected by N-CUR-treated diets. The observed growth-promoting effect of N-CUR may be associated with its ability to activate digestive enzymes such as lipase and amylase (Abdel-Tawwab et al. 2022), increase the length of intestinal villi and the number of goblet cells (Kaur et al. 2020), and act as a prebiotic promoting the growth of beneficial intestinal bacteria (Gessner et al. 2017). In contrast to our results, Bao et al. (2022) and Khieokhajonkhet et al. (2023) reported that dietary supplementation with N-CUR in juvenile largemouth bass and goldfish, respectively, had no significant effect on growth performance.
In the present study, the detrimental effects of Al_2_O_3_-NPs on the hepatocytes, gills, and immune status of O. niloticus were evident at both the plasma and hepatic tissue levels. Exposure to Al_2_O_3_-NPs resulted in significant alterations in key plasma hepatic biomarkers, including ALT, TP, ALB, GLO, and IgM. Al_2_O_3_-NP exposure led to an increase in ALT levels. These alterations may be attributed to the leakage of cytosolic enzymes from the liver into the blood as a result of the oxidative stress-mediated alterations in hepatocyte plasma membranes (Uzun and Kalender, 2013). The increase in plasma ALT is indicative of liver damage and reflects modifications in liver function (Kord et al. 2021). These findings are consistent with those of Hadi et al. (2009), who reported that exposure to aluminum in Tilapia zillii caused an increase in ALT levels.
Our findings indicate that N-CUR supplementation in the fish diet significantly decreased ALT levels. These results align with those of Eissa et al. (2022), who reported that dietary supplementation with N-CUR in Nile tilapia led to a significant decrease in ALT. Similarly, Wolf and Wheeler (2018) reported that ALT levels were reduced in P. vannamei fed a diet supplemented with N-CUR. This may be attributed to the antioxidant and hepatoprotective effects of curcumin (Elgendy et al. 2016).
Total proteins (TP) are common biomarkers of the immunological and health status of aquatic animals, consisting primarily of albumin (ALB) and globulin (GLO) (Moghadam et al. 2021). Our results revealed that the Al_2_O_3_-NP-exposed group showed significant decreases in TP, ALB, and GLO levels, whereas N-CUR-supplemented groups showed significant increases in these parameters. These improvements in plasma protein profiles suggest a protective role of dietary N-CUR. Our findings are consistent with those of Abdelnour et al. (2023), Eissa et al. (2023a), and Jastaniah et al. (2024), who demonstrated that dietary supplementation with N-CUR significantly increased blood protein levels in Pacific white shrimp(P. vannamei), red tilapia, and European seabass, respectively. This effect may be attributed to the phenolic structure of curcumin, which confers its immunostimulatory and antioxidant properties (Jastaniah et al. 2024).
Regarding IgM, which is an indicator reflecting the immune status of fish (Ming et al. 2020), our data revealed that IgM levels were reduced in Al_2_O_3_-NP-exposed groups, while N-CUR supplementation increased IgM levels. In a similar trend, Elabd et al. (2023) reported that N-CUR supplementation in the Nile tilapia diet at a dose of 6.25 mg/kg produced the highest IgM level.
The observed disruption in serum hepatic biomarkers was accompanied by downregulation in the hepatic mRNA expression of the antioxidant enzymes SOD and CAT. According to our results, the Al_2_O_3_-NP-exposed groups showed a significant downregulation in the expression of antioxidant-related genes (SOD and CAT). Similarly, Canli and Canli (2020) reported that O. niloticus exposed to Al_2_O_3_-NPs exhibited a significant decrease in SOD and CAT gene expression. Benavides et al. (2016) observed a significant increase in SOD activity in the liver and gills of C. auratus, while Temiz and Kargın (2022) reported that O. niloticus exposed to Al_2_O_3_-NPs showed a significant decrease in CAT activity. This reduction may be attributed to the overproduction of H₂O₂ in fish groups exposed to Al_2_O_3_-NPs (Gomes et al. 2011).
The roles of SOD and CAT in converting superoxide radicals to hydrogen peroxide, which are subsequently converted to water and oxygen, are essential for preventing oxidative cellular damage (Halliwell 2012). Therefore, the observed suppression of these enzymes in our present study suggests compromised oxidative defense mechanisms induced by Al_2_O_3_-NPs.
Dietary co-supplementation with N-CUR was associated with attenuating the drastic effects of Al_2_O_3_-NPs and restoring SOD and CAT gene expression in both the liver and gills. Many studies concur with our findings, demonstrating that N-CUR enhances the antioxidant activity of various fish species, including largemouth bass, African catfish, and Nile tilapia (Bao et al. 2022; Mansour et al. 2023; Elabd et al. 2023). The antioxidant activity of curcumin may be attributed to its phenolic hydroxyl groups, which are crucial for scavenging free radicals (Shamsi-Goushki et al. 2020; Sow et al. 2022). Laabbar et al. (2021) also demonstrated that curcumin could ameliorate oxidative stress in rats resulting from Al_2_O_3_-NPs toxicity owing to its scavenging properties and activation of antioxidant enzymes.
In our study, the Al_2_O_3_-NP-exposed group showed a significant upregulation in the expression of IL-1β and TNF-α genes. This finding aligns with El-Borai et al. (2022), who reported that rats exposed to Al_2_O_3_-NPs exhibited a significant increase in TNF-α expression. The downregulation of IL-1β and TNF-α expression following N-CUR administration corresponds with Jastaniah et al. (2024), who found that dietary supplementation with N-CUR in European seabass caused a marked downregulation of IL-1β gene expression. Similarly, Khieokhajonkhet et al. (2023) reported that supplementing turmeric (a natural source of curcumin) in common carp significantly decreased IL-1β expression. This effect may result from the inhibitory action on the NF-κB protein complex, which is involved in the synthesis of IL-1 and TNF-α (Zhao et al. 2005).
It is well established that metallothionein (MT) plays a crucial role in detoxification mechanisms by scavenging toxic metal ions and reactive oxygen species (ROS) (Chen et al. 2004). Our results revealed that Al_2_O_3_-NP exposure was associated with upregulation of the MT gene expression. These findings contrast with Capriello et al. (2021), who reported that MT levels significantly decreased in zebrafish exposed to AlCl_3_. The observed upregulation of MT in this study may indicate nanoparticle accumulation in hepatic tissue, where they eventually bind to metals (Abbas et al. 2018).
In contrast, the N-CUR-supplemented groups in our study showed a significant downregulation of MT expression. The restoration of MT levels in N-CUR-supplemented groups suggests potential antioxidant activity.
Our histopathological examinations revealed several detrimental changes in the gills of the Al_2_O_3_-NP-exposed group, including telangiectasia, hyperemia, and hyperplasia. These alterations are considered defense mechanisms; however, they result in a reduction of the respiratory surface, which in turn reduces oxygen uptake in fish (Antunes et al. 2017). Similar to our study, numerous histological changes in the gills, including hyperplasia, aneurysm, epithelial lifting, edema, congestion, and cellular necrosis, were detected in O. mossambicus exposed to Al_2_O_3_-NPs (Murali et al.2018). Moreover, Benavides et al. (2016) showed that the gills of C. auratus exposed to Al_2_O_3_-NPs exhibited partial to complete fusion of some lamellae (hyperplasia) and increased mucus production. All these changes may be due to direct contact between the gills and water containing Al_2_O_3_-NPs (Hadi and Alwan 2012).
On the other hand, the gills of N-CUR co-treated groups revealed signs of partial recovery. These outcomes are consistent with those of Eissa et al. (2023a), who demonstrated the ameliorative effect of N-CUR on the gill tissue of red tilapia challenged with Aspergillus flavus.
Regarding the liver tissue, our histopathological examinations showed numerous anomalies in the Al_2_O_3_-NP-exposed group, consistent with Murali et al. (2017) and Abdel-Khalek et al. (2020), who reported vacuolization, blood congestion, and necrosis in hepatic tissue as a response to Al_2_O_3_-NP toxicity. The liver tissue of co-treated groups with N-CUR showed notable improvements. These results align with Eissa et al. (2023a), who found that hepatic tissue in N-CUR-treated groups exhibited ameliorative effects in red tilapia challenged with Aspergillus flavus.
Altogether, our data suggest a potential ameliorative role of N-CUR against Al_2_O_3_-NP toxicity. The biochemical, molecular, and histological findings may be attributed to curcumin’s ability to neutralize free radicals and chelate metals (Farzaei et al. 2018). Although experimental exposures produced mechanistic insights, the actual concentration levels of Al_2_O_3_ nanoparticles in aquaculture environments are largely unknown; thus, the direct risk to fish productivity is yet to be determined.
Conclusion
To the best of our knowledge, our study represents the first attempt to investigate the ameliorative role of N-CUR against Al_2_O_3_-NP toxicity in Nile tilapia using a multi-level biological assessment approach. Our results suggest that N-CUR can be applied as a safe, eco-friendly phyto-additive in fish diets to alleviate Al_2_O_3_-NP-induced toxicity under monitored conditions. Building on our findings, O. niloticus exposed to Al_2_O_3_-NPs exhibited several detrimental anomalies. However, dietary supplementation with N-CUR alleviated these anomalies by enhancing IgM levels, restoring the oxidant/antioxidant balance, and improving histological alterations along with immune gene expression. These findings indicate that the protective effect of N-CUR is primarily mediated through its anti-inflammatory and antioxidant mechanisms.
Some limitations need to be clarified. The experiment was conducted under controlled laboratory conditions that may not fully represent the complexity of real aquaculture environments. Only one fish species was tested; therefore, other species and different exposure levels should be evaluated in future studies. Additionally, this study focused on short-term exposure; thus, the long-term or chronic effects of these nanoparticles were not assessed. Future studies should address these limitations by including multiple species, environmentally relevant exposure scenarios, and more comprehensive molecular analyses.
The reference list from the paper itself. Each links out to its DOI / PubMed record.
- 1Abdel-Moneam DA, S Khalefa H, Rashad MM, Ali GE, Ahmed YH, Ragab E, Mahmoud SB (2025 b) Thyme-synthesized silver nanoparticles mitigate immunosuppression, oxidative damage, and histopathological alterations induced by multidrug-resistant Enterococcus faecalis in Oreochromis niloticus: in vitro and in vivo assays. Fish Physiol Biochem 51(4):1–25
- 2Bao X, Chen M, Yue Y, Liu H, Yang Y, Yu H, Yu Y, Duan N (2022) Effects of dietary nano-curcumin supplementation on growth performance, glucose metabolism, and endoplasmic reticulum stress in juvenile largemouth Bass, Micropterus salmoides. Front Mar Sci 9. 10.3389/fmars.2022.924569
- 3Canli EG, Canli M (2020) Effects of aluminum, copper and titanium nanoparticles on the liver antioxidant enzymes of the Nile fish (Oreochromis niloticus). 7th International Conference on Energy and Environment Research, ICEER 2020, 14–18 September, ISEP, Porto, Portugal. Energy Reports 6, 62–67
- 4Eissa ESH, Bazina WK, Abd El-Aziz YM, Abd Elghany NA, Tawfik WA, Mossa MI, Abd El Megeed OH, Abd El-Hamed NB, El-Saeed AF, El- Haroun E (2023 b) Nano-selenium impacts on growth performance, digestive enzymes, antioxidant, immune resistance and histopathological scores of Nile tilapia, Oreochromis niloticus against Aspergillus flavus infection. Aquac Int 1–25. 10.1007/s 10499-023-01230-4
- 5EPA (2001) Integrated Risk Information System (IRIS). National Center for Environmental Assessment, Office of Research and Development, Washington DC, USA available on line at. https://www.epa.gov/iris/. Accessed 01 Jun 2025
- 6FAO (2024) The State of World Fisheries and Aquaculture 2024: Sustainability in action. Food and Agriculture Organization of the United Nations (FAO), Rome, Italy, available online at: https://www.fao.org/3/cc 0461 en/cc 0461 en.pdf. Accessed 1/6/2025