Chorein Regulates Key Osteoblast Genes in UMR-106 Cells
Martina Feger, Anna Tsapara, Sina Hülße, Steffen Rausch, Michelle Barholz, Christos Stournaras, Michael Föller
TL;DR
This study shows that chorein, a protein linked to a rare neurological disease, affects genes related to bone cell development in osteoblast-like cells.
Contribution
The study reveals chorein's novel role in regulating osteoblast and osteoclast-related genes in UMR-106 cells.
Findings
Chorein knockdown reduced fibroblast growth factor 23 (FGF23) gene and protein expression in UMR-106 cells.
Phex was down-regulated and Galnt3 was up-regulated in chorein-knockdown cells.
Chorein modulates genes involved in osteoblast and osteoclast differentiation and function.
Abstract
Chorein is an endoplasmic reticulum protein expressed in many cell types. Loss-of-function mutations of the gene encoding chorein (VPS13A) are the cause of chorea-acanthocytosis, a rare and severe neurodegenerative disease with chorea-like movements, loss of mental function, progressive muscle weakness and misshaped erythrocytes (acanthocytes). Chorein regulates diverse cellular functions including the cytoskeleton, apoptosis, Ca2+ entry, or autophagy. Since its role in bone is enigmatic, we aimed to explore the function of chorein in osteoblasts. To this end, we generated UMR-106 osteoblast-like cells with stable chorein knockdown (KD) using a CRISPR/Cas9-based approach and compared them to cells undergoing CRISPR/Cas9 with a non-targeting sequence (NT). Gene expression was assessed by qPCR and protein by Western blotting and ELISA. Gene and protein expression of chorein and fibroblast…
Genes, proteins, chemicals, diseases, species, mutations and cell lines named across the full text — each resolved to its canonical identifier and authoritative record.
Click any figure to enlarge with its caption.
Figure 1
Figure 2
Figure 3
Figure 4- —Universität Hohenheim (3153)
Peer Reviews
No public reviews on file for this paper yet. If you reviewed it on a platform where reviews are public (OpenReview, ICLR, NeurIPS, ICML), you can paste yours below so the community can read it here.
Videos
No videos yet. Explain this paper in a talk, walkthrough, or lecture? Add one.
Taxonomy
TopicsParathyroid Disorders and Treatments · Genetic Syndromes and Imprinting · Erythrocyte Function and Pathophysiology
Introduction
Chorea-acanthocytosis is a severe neurodegenerative and very rare autosomal recessive genetic disease [1–3]. On the one hand, typical symptoms affect the brain and include hyperkinesia with chorea-like movements, mental deficits and seizures, on the other hand also erythrocytes and muscles may be severely affected; acanthocytosis, i.e. misshaped erythrocytes, is often observed as is myopathy, resulting in loss of skeletal muscle mass and progressive weakness [1, 2]. Muscle decay and hemolysis may, at least in part, contribute to hyperkalemia, another hallmark of chorea-acanthocytosis [1, 2].
The disease is caused by mutations in the gene vacuolar protein sorting 13 homolog A (VPS13A) encoding for chorein protein. It is expressed in many cell types and tissues [2]. It is mainly found in the endoplasmic reticulum, being implicated in intracellular lipid transport [4]. Other functions hitherto identified, include the regulation of phosphatidylinositol 3-kinase (PI3K) signaling [5], the organization of the actin cytoskeleton [5], or interaction with β-adducin or β-actin [6]. The impact of chorein on cytoskeleton may, at least in part, explain the typical changes in red blood cell morphology, i.e. acanthocytosis as does the impact of chorein on erythrocyte deformability [7]. In T lymphocytes, chorein contributes to cell membrane scrambling thereby also controlling immune function [8]. In endothelial cells, chorein affects stiffness by regulating the organization of the actin cytoskeleton [9].
Chorein may also play a role in autophagy and the symptoms of chorea-acanthocytosis may, at least in part, be due to impaired autophagy [10]. Apoptosis is also influenced by chorein, and enhanced apoptosis may particularly be responsible for neurodegeneration in chorea-acanthocytosis [11]: In neurons from patients with chorea-acanthocytosis, Ca^2+^ entry through Ca^2+^ release-activated Ca^2+^ channel (CRAC) Orai1 is reduced, an effect paralleled by accelerated apoptosis [12]. Chorein deficiency also impairs Na^+^/K^+^ pump activity [13]. Chorein protects against cell stress by interacting with histone deacetylase 6 and α-tubulin [14].
In bone, the actin cytoskeleton is critical to mechano-transduction and hence for bone remodeling [15, 16]. Moreover, Orai1 is indispensable for maintaining bone mass [17]. Given that chorein has emerged as a powerful regulator of the actin cytoskeleton as well as Orai1 and nothing is known about the function of chorein in bone cells to the best of our knowledge, we sought to explore the role of chorein in bone cells.
UMR-106 osteoblast-like cells are a common and versatile cell model to study osteoblast function since they share many osteoblast properties despite also having bone tumor characteristics [18]. In particular, they produce bone-derived hormone fibroblast growth factor 23 (FGF23) [19] or exhibit bone-like growth hormone signaling [20]. For this reason, we considered them as an adequate model to study the role of chorein in bone biology and knocked down chorein in UMR-106 cells by means of a CRISPR/Cas9-dependent approach and determined the expression of key bone cell genes compared to UMR-106 cells exhibiting normal chorein expression levels.
Materials and Methods
Generation of Vps13a Knockdown UMR-106 Clones Using CRISPR/Cas9 System
TransEDIT CRISPR gRNA target gene set for Vps13a Rattus norvegicus bacterial glycerol stock (CARS1001-309243) using pCLIP-All-EFS-Puro V59 vector was bought from transOMIC technologies (Huntsville, AL, USA). The product contained three sequences targeting Vps13a (TEVR-1141939, TEVR-1209081, TEVR-1074797) and a control non-targeting sequence (TELA1011). Sequences are provided in suppl. Table 1. To assess the off-targeting potential of the predesigned gRNAs, sequences were checked with CRISPR-Cas9 guide RNA design checker (https://eu.idtdna.com/site/order/designtool/index/CRISPR_SEQUENCE; Integrated DNA Technologies, Coralville, IA, USA). According to the analysis, all three gRNAs were expected to be “good”.
For the production of lentiviral particles, HEK293T cells were co-transfected with the appropriate CRISPR/Cas9 construct together with packaging plasmids pVSV-G and pΔ8.1 using attractene transfection reagent (Qiagen, Hilden, Germany), and culture supernatants containing viral particles were collected 24 and 48 h after transfection.
To transduce osteoblast-like UMR-106 cells (CRL-1661; American Type Culture Collection (ATCC), Manassas, VA, USA) with viral particles, cells plated into 12-well plate were incubated with the appropriate viral supernatant for 48 h. Subsequently cells were trypsinized, suspended to a single cell population, passed through a 35 µm cell strainer and seeded at 50,000 cells/dish in 100 mm dishes in the presence of the selection antibiotic (puromycin 1 µg/mL) until visible individual colonies were obtained. Colonies were picked, expanded and Vps13a mRNA transcript levels were assessed by quantitative real-time polymerase chain reaction (qPCR) using the following primers (5’→3’ orientation): Vps13a_KD (58 °C): GGAATTAGGGGAAACGTCTG and CTGCAAGGTAATAATATCTTCATTC.
The 2^-ΔCt^ method, using β-actin (Actb) as the internal reference gene, was applied to calculate relative Vps13a mRNA transcription.
Culture Conditions
Vps13a clones were cultured in Dulbecco’s Modified Eagle Medium (DMEM) with 4.5 g/L D-glucose supplemented with 10% fetal bovine serum (FBS), 100 U/mL penicillin and 100 µg/mL streptomycin, and 1 µg/mL puromycin (all from Thermo Fisher Scientific, Darmstadt, Germany) at 37 °C in a humidified atmosphere containing 5% CO_2_.
For experiments, 2 × 10^5^ cells per well were plated in 2 mL growth medium into 6-well plates. Unstimulated, UMR-106 cells do not exhibit substantial Fgf23 expression. Therefore, the growth medium was replaced with fresh medium supplemented with 100 nM 1,25(OH)2_D_3 (Tocris, Bio-Techne, Wiesbaden, Germany) after 24 h [21]. The cells were incubated for further 24 h, then the cell culture supernatant was collected and the cells were harvested for RNA isolation.
RNA Isolation and Quantitative real-time Polymerase Chain Reaction
Total RNA was isolated using a phenol-chloroform extraction technique (peqGOLD TriFast reagent, VWR, Darmstadt, Germany). Synthesis of complementary DNA (cDNA) was performed using 1.2 µg (60 ng/µL) of total RNA, random primers, and GoScript Reverse Transcription System (Promega, Mannheim, Germany).
QPCR was conducted using 2 µL cDNA, 0.5 or 0.25 µM primers and 10 µL GoTaq qPCR Master Mix (Promega) in a 20 µL reaction volume. Conditions for qPCR included an initial incubation at 95 °C for 2 min; followed by 40 cycles of 95 °C for 10 s, annealing at primer-specific temperature for 30 s, and 72 °C for 30 s using the CFX Connect Real-Time System with CFX Maestro software (version 2.2, https://www.bio-rad.com/; Bio-Rad Laboratories, Feldkirchen, Germany). Specificity of the qPCR products was verified by melting curve analysis.
The following primers (5’→3’ orientation) and annealing temperatures were used:
Actb (58 °C): CGCCACCAGTTCGCCAT, ATACCCACCATCACACCCTGG;
Fgf23 (58 °C): CCATGTAGACGGAACACCCC, CCGGGCTGAAGTGATACGAT;
Galnt3 (62 °C): TTCCTTTGGCTGGGAGTCAC, GTATGAGGGCTTTTGCTGCG;
Nfkbia (58 °C): AGACTCGTTCCTGCACTTGG, TCTCGGAGCTCAGGATCACA;
Phex (58 °C): ATGGCTGGATAAGCAATAAC, GCTTTTTCAATCGCTTTCTC;
Pth1r (61 °C): GAAGTTCTGCACACAGCAGC, ATGCCTTCTCTTTCCTGGGC;
Runx2 (56 °C): AGAGTCAGATTACAGAT CCC, TGTCATCATCTGAAATAC GC;
Sost (58 °C): AATCATCCCGGGACTCAGAGA, GTCACGAAGCGGGTGTAGTG;
Tbp (58 °C): ACTCCTGCCACACCAGCC, GGTCAAGTTTACAGCCAAGATTCA;
Tnfsf11 (57 °C): CTCATGCAGGAGAATGAAAC, TTCCATCATAGCTGGAACTC;
Vdr (58 °C): CCCGGATCTGTGGAGTGTGT, GCGGCAATCTCCATTGAAGG.
Relative mRNA expression was calculated by the 2^−ΔCt^ method using Actb or Tbp as internal reference gene.
MTT Assay
A final volume of 200 µL of growth medium was used to seed 11,000 cells per well into 96-well plates. The culture medium and conditions used are described above. After 48 h, medium was aspirated, and MTT reagent (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; Sigma-Aldrich, Schnelldorf, Germany) was added to each well at a final concentration of 0.5 mg/mL in DMEM. After incubation for 1 h at 37 °C in a humidified atmosphere containing 5% CO_2_, the MTT solution was replaced by dimethyl sulfoxide (DMSO; AppliChem, Darmstadt, Germany). The absorption was measured with a FluoStar Omega plate reader (BMG Labtech, Ortenberg, Germany) at 550 nm, using 690 nm as reference wavelength. Each cell clone was analyzed in quadruplicate and cell viability of Vps13a knockdown cells was reported compared to the absorbance resulting from NT cells, considered as 100% of viable cells.
Analysis of Secreted FGF23 Protein
The concentration of FGF23 protein in the cell culture supernatant was determined using ELISA kits (mouse/rat FGF23 (C-Term) and mouse/rat FGF23 (intact), both from Quidel, Cologne, Germany). Prior to these measurements, the cell culture supernatant was concentrated using Vivaspin 2 centrifugal concentrators (Sartorius, Göttingen, Germany). MARS data analysis software (version 3.32 R5, https://www.bmglabtech.com/; BMG Labtech) was used for assay analysis.
Protein Isolation and Western Blotting
Total proteins were isolated by using ice-cold RIPA lysis buffer containing complete protease and phosphatase inhibitor cocktail and EDTA (Thermo Fisher Scientific). Protein concentration was determined by the Bradford Plus Protein Assay Kit (Thermo Fisher Scientific). Proteins were boiled in Roti-Load1 buffer (Carl Roth, Karlsruhe, Germany), and 30 µg protein were separated on 4–15% precast polyacrylamide gels (Bio-Rad Laboratories) and then transferred to nitrocellulose membranes (Cytiva, Marlborough, MA, USA). Membranes were incubated with rabbit anti-VPS13A (1:1000, HPA021662; Sigma-Aldrich) or rabbit anti-β-tubulin (1:5000, #2146; Cell Signaling, Leiden, Netherlands) primary antibody and then with secondary goat anti-rabbit IgG, HRP-linked antibody (1:5000, #7074; Cell Signaling). Bands were detected with Westar Supernova (Cyanagen, Bologna, Italy) ECL substrate using C-Digit Blot scanner (Li-Cor, Lincoln, NE, USA) and quantified with Image Studio Lite software (version 5.2, https://www.licorbio.com/; Li-Cor). Data are shown as the ratio of target protein to β-tubulin, normalized to the control cells.
Statistics
Data are shown as arithmetic means ± standard error of the mean (SEM) with n representing the number of independent cell culture experiments. Normal distribution was tested using Shapiro-Wilk normality test. Data were analyzed with unpaired Student’s t-test, Welch’s t-test (for data with significantly different variances) or Mann-Whitney U test. The effect of Vps13a knockdown on viability was analyzed with one-sample t-test. Differences were considered significant if P < 0.05 (with *p < 0.05, **p < 0.01, and ***p < 0.001). Data analyses were performed using Excel (version Microsoft Office Professional Plus 2016, https://www.microsoft.com/; Microsoft Corporation, Redmond, WA, USA). Statistics were made using GraphPad Prism (version 6.01, https://www.graphpad.com/; GraphPad Software, Boston, MA, USA) or IBM SPSS Statistics (version 27.0, https://www.ibm.com/; IBM, Armonk, NY, USA).
Results
It was the aim of our study to unravel the significance of chorein for the regulation of genes required for bone formation, density, and remodeling in UMR-106 osteoblast-like cells. To this end, UMR-106 cells with stable chorein knockdown (KD) were generated by a CRISPR/Cas9-based approach and compared to control cells that underwent a CRISPR/Cas9-based intervention with a non-targeting (NT) sequence.
Initially, we verified the success of the CRISPR/Cas9 intervention by measuring chorein (Vps13a) mRNA levels by qPCR. As expected, chorein expression was indeed significantly down-regulated in KD cells compared to NT cells (Fig. 1A). In contrast, in two other cell clones (KD2 and KD3) generated by using two different gRNAs targeting Vps13a, chorein knockdown was weaker or even absent (suppl. Figure 1). As illustrated in Fig. 1B, also chorein protein was significantly down-regulated in KD cells compared to NT cells. We next employed MTT assay to assess the impact of chorein knockdown on cell viability. As a result, viability was not significantly different between KD and NT cells (Fig. 1C).
Fig. 1. Verification of CRISPR/Cas9-mediated Vps13a knockdown in osteoblast-like UMR-106 cells. (A) Vps13a mRNA (n = 6) expression normalized to β-actin (Actb) in UMR-106 cells with non-targeting (NT) sequence and Vps13a knockdown (KD) cells using CRISPR/Cas9 system. (B) Densitometric analysis (n = 4) and representative Western Blot of Vps13a protein (⁓360 kDa) and loading control β-tubulin in NT and KD cells. (C) Cell viability of KD cells compared to NT cells measured by MTT assay. All data are shown as arithmetic means ± SEM. (A: Unpaired t-test with Welch’s correction; B: Mann-Whitney U test; C: One-sample t-test)
Osteoblasts are not only responsible for bone formation and stability, but also produce paracrine factors as well as classical hormones with effects in distant organs. Fibroblast growth factor 23 (FGF23) is among the latter, regulating vitamin D and phosphate handling in the kidney [22–24]. We measured Fgf23 expression by qPCR and found that KD cells exhibited significantly lower levels compared to NT cells (Fig. 2A). Furthermore, we employed ELISA to determine FGF23 protein (C-terminal) secreted into the cell culture medium. According to Fig. 2B, KD cells also secreted less C-terminal FGF23 protein than NT cells. We were not able to detect full-length (intact) FGF23 in either sample. In line with a weaker effect on chorein knockdown (suppl. Figure 1), KD2 and KD3 cells also exhibited reduced FGF23 expression (suppl. Figure 2).
Fig. 2. Effect of CRISPR/Cas9-induced Vps13a knockdown on FGF23 production. (A) Fgf23 mRNA (n = 7) expression normalized to β-actin (Actb) in control cells transfected with non-targeting (NT) sequence and Vps13a knockdown (KD) cells using CRISPR/Cas9 system. (B) C-terminal FGF23 protein concentration (n = 8) in the cell culture supernatant of NT and Vps13a knockdown cells. All data are shown as arithmetic means ± SEM. (A: Unpaired Student’s t-test; B: Mann-Whitney U test)
Phex is an important suppressor of FGF23 gene expression in osteoblasts [25]. As displayed in Fig. 3A, Phex expression was lower in KD cells compared to NT cells, suggesting that chorein knockdown did not suppress FGF23 through Phex. Galnt3 is an O-glycosylase and posttranslational regulator of FGF23 in osteoblasts that is required for secretion of bioactive, intact FGF23 [26]. Galnt3 gene expression was higher in KD cells than in NT cells (Fig. 3B).
Fig. 3. Knockdown of Vps13a influences mRNA expression of FGF23 regulators**.** Relative mRNA expression of Phex (A, n = 6) and Galnt3 (B, n = 8) mRNA normalized to β-actin (Actb) in non-targeting (NT) control cells and Vps13a knockdown (KD) cells. All data are shown as arithmetic means ± SEM. (A: Unpaired t-test with Welch’s correction; B: Unpaired Student’s t-test)
Vitamin D receptor (Vdr) gene expression was lower in KD than NT cells (Fig. 4A) as was parathyroid hormone receptor (Pth1r) gene expression (Fig. 4B). The expression of Rankl (encoded by Tnfsf11) that induces osteoclastogenesis was also lower in KD cells compared to NT cells (Fig. 4C). Also, mRNA abundance of Sost encoding sclerostin, a protein suppressing osteoblast activity [27], was down-regulated (Fig. 4D) whereas Runx2, a transcription factor that induces osteoblast differentiation [28], was up-regulated in KD cells compared to NT cells (Fig. 4E). Gene expression of Nfkbia encoding IκBα, an inhibitor of pro-inflammatory transcription factor NFκB, was not significantly different between NT and KD cells (Fig. 4F).
Fig. 4. Impact of Vps13a knockdown on genes regulating osteoblast and osteoclast differentiation. Arithmetic means ± SEM of mRNA expression of Vdr (A, n = 8), Pth1r (B, n = 6), Tnfsf11 (C, n = 6), Sost (D, n = 6), Runx2 (E, n = 6), and Nfkbia (F, n = 6) mRNA normalized to β-actin (Actb) in non-targeting (NT) control cells and Vps13a knockdown (KD) cells. (A and F: Mann-Whitney U test; B-E: Unpaired Student’s t-test)
Discussion
We generated for the first time UMR-106 osteoblasts with stable knockdown of chorein (KD cells). Compared to wild type UMR-106 cells (NT cells), the regulation of essential osteoblast genes was deeply altered in KD cells.
In particular, gene expression and protein production of FGF23 was lower in KD cells compared to NT cells. We were only able to detect C-terminal FGF23, not full-length (intact) FGF23. However, since the measurement of C-terminal FGF23 yields the sum of intact and cleaved FGF23, it is a measure of total FGF23 production and therefore reflects the impact of chorein deficiency on FGF23 production. FGF23 is a powerful regulator of phosphate and vitamin D homeostasis under physiological conditions, alterations of mineral metabolism are conceivable in states of chorein deficiency or malfunction, i.e. chorea-acanthocytosis. However, such alterations have not been reported thus far as typical symptoms of chorea-acanthocytosis, to the best of our knowledge. It appears to be possible that such alterations do occur, but that they may be subclinical and overridden by the severe consequences of neurodegeneration. Importantly, negative transcriptional FGF23 regulator Phex was also down-regulated by chorein knockdown and therefore cannot explain suppressed FGF23 formation. However, down-regulated Sost may, at least in part, contribute to suppression of FGF23 production in KD cells as sclerostin is a direct inducer of FGF23. It therefore appears possible that suppressed Sost overrode the effect of down-regulated Phex on FGF23, suggesting that Sost may be more important for FGF23 regulation, at least in UMR-106 cells following chorein knockdown.
Our experiments revealed further changes in key osteoblast genes that may suggest that bone formation, remodeling and/or resorption are altered by chorein deficiency in chorea-acanthocytosis. In detail, down-regulated Sost and up-regulated Runx2 following chorein knockdown can be expected to enhance osteoblast activity and differentiation. In addition, lower Rankl (Tnfsf11) expression in KD cells can be expected to suppress bone resorption by reducing osteoclast formation and lower FGF23 production can be expected to diminish renal phosphate excretion. Hence, all alterations of the four key osteoblast genes analyzed are likely to favor bone formation and stability over bone breakdown. Hence, it can be hypothesized that patients with chorea-acanthocytosis rather have higher bone density and stability, and indeed, to the best of our knowledge, no reports on bone-related health issues in chorea-acanthocytosis are published. However, it has to be kept in mind that higher bone density in chorea-acanthocytosis is merely speculative, and no clinical evidence currently supports this hypothesis. Further research is therefore needed to verify this hypothesis.
Clearly, our study revealed that chorein is a powerful and extensive regulator of key osteoblast genes in osteoblast-like UMR-106 cells. Chorein knockdown resulted in broad transcriptional effects on several genes relevant for bone formation, stability, and resorption. Studies addressing the physiological and pathophysiological relevance of chorein for bone are warranted. A major limitation of our study is that the results were not obtained in primary osteoblasts but in a cell line with osteoblast-like properties that is based on rat osteosarcoma cells. Further studies are therefore needed to verify the results in primary osteoblasts since it cannot be ruled out that the origin of UMR-106 cells influences the impact of chorein deficiency. Another limitation is that for most genes, only transcription was analyzed which does not necessarily reflect protein abundance. Moreover, osteoblast or bone biology cannot be predicted on the basis of transcriptional activity only. Therefore, further studies are needed involving also animals in order to draw safe conclusions.
In summary, chorein knockdown resulted in the up-regulation of Runx2 and down-regulation of Sost, Rankl (Tnfsf11), and Fgf23 gene expression in UMR-106 osteoblast-like cells. The changes in these key osteoblast genes can be expected to enhance bone formation and suppress bone resorption in states of chorein deficiency.
Supplementary Information
Below is the link to the electronic supplementary material.
Supplementary Material 1
The reference list from the paper itself. Each links out to its DOI / PubMed record.
- 1Ryoden, Y., Segawa, K., & Nagata, S. (2022). Requirement of Xk and Vps 13a for the P 2X 7-mediated phospholipid scrambling and cell Lysis in mouse T cells. Proceedings of the National Academy of Sciences of the United States of America 119.10.1073/pnas.2119286119 PMC 885151935140185 · doi ↗ · pubmed ↗
- 2Scott, A. F. (2024). Characterization of the rat osteosarcoma cell line UMR-106 by Long-Read technologies identifies a large block of amplified genes associated with human disease. Genes 15.10.3390/genes 15101254 PMC 1150722939457378 · doi ↗ · pubmed ↗
- 3Komori, T. (2019). Regulation of Proliferation, differentiation and functions of osteoblasts by Runx 2. International Journal of Molecular Sciences 20.10.3390/ijms 20071694 PMC 648021530987410 · doi ↗ · pubmed ↗