SLC12A8 Drives Immune Evasion and Metastasis in Luminal B Breast Cancer by Inducing CD8 + T‐Cell Exhaustion via the TLR Signaling Pathway
Zhiyong Liu, Ran Chen
TL;DR
This study shows that SLC12A8 promotes immune evasion and cancer spread in Luminal B breast cancer by weakening CD8+ T cells through the TLR pathway.
Contribution
The study identifies SLC12A8 as a novel driver of immune evasion and metastasis in Luminal B breast cancer via TLR signaling.
Findings
SLC12A8 is upregulated in breast cancer and linked to poor prognosis.
SLC12A8 activates TLR signaling, leading to CD8+ T-cell exhaustion and increased cancer invasion.
Inhibiting SLC12A8 or the TLR pathway reverses T-cell exhaustion and cancer spread.
Abstract
To investigate the role and mechanism of SLC12A8 in the progression of Luminal B breast cancer. Data from TCGA, GTEx, and HPA databases were used to analyze SLC12A8 expression and its prognostic value in breast cancer. qPCR was performed to validate SLC12A8 expression in various breast cancer cell lines. The correlation between SLC12A8 and immune cell infiltration was analyzed using ImmuCellAI and TIMER databases. Gene set enrichment analysis (GSEA) was employed to predict signaling pathways associated with SLC12A8. In vitro, siRNA‐mediated knockdown of SLC12A8 or treatment with the TLR pathway inhibitor GIT27 was used to assess the effects on the TLR pathway, CD8+ T cell function (as indicated by PD‐1, PRF1, and GZMB expression), and cancer cell invasion via Western blot, immunofluorescence, qPCR, and Transwell assays. CD8+ T cells were isolated from healthy human peripheral blood…
Genes, proteins, chemicals, diseases, species, mutations and cell lines named across the full text — each resolved to its canonical identifier and authoritative record.
Click any figure to enlarge with its caption.
FIGURE 1
FIGURE 2
FIGURE 3
FIGURE 4
FIGURE 5
FIGURE 6
FIGURE 7
FIGURE 8
FIGURE 9| Gene | Primer sequence (5′ → 3′) |
|---|---|
| SLC12A8 |
F: TGGCGTCTACTCCATGATCTCC R: CCGAGATGGATTCAGCAAAGCC |
| GAPDH |
F: TAGATGACACCCGTCCCTGA R: ACCTCCACCTGTCCTTAGTG |
| PRF1 |
F: CTTCGGAGCCATGGAGTACAC R: GCTGTAGTAGCGCCTCCTCC |
| GZMB |
F: AGTGCGCCACTCAAGACCTT R: TTTGGCCTTGGCACTCTTTC |
- —Gannan Medical University10.13039/501100020784
Peer Reviews
No public reviews on file for this paper yet. If you reviewed it on a platform where reviews are public (OpenReview, ICLR, NeurIPS, ICML), you can paste yours below so the community can read it here.
Videos
No videos yet. Explain this paper in a talk, walkthrough, or lecture? Add one.
Taxonomy
TopicsCancer Immunotherapy and Biomarkers · Drug Transport and Resistance Mechanisms · Cancer Cells and Metastasis
Introduction
1
Breast cancer is the most common malignant tumor among women worldwide, with high incidence and mortality rates, posing a major public health challenge [1]. Despite advances in surgery, chemotherapy, radiotherapy, targeted therapy, and endocrine therapy, the high heterogeneity of breast cancer leads to significant differences in treatment response and prognosis. Among the subtypes, Luminal B breast cancer, characterized by high proliferative activity, relative insensitivity to traditional endocrine therapy, and poorer prognosis compared to Luminal A, is one of the difficult challenges in clinical treatment [2]. Therefore, exploring new mechanisms underlying the development and progression of Luminal B breast cancer and identifying effective therapeutic targets is crucial.
In recent years, the role of the tumor immune microenvironment in cancer progression and treatment has gained increasing attention. CD8^+^ T cells, as the core effector cells of anti‐tumor immunity, determine the success of immunotherapy. During tumor progression, CD8^+^ T cells often enter an “exhausted” state, characterized by progressively attenuated effector functions and sustained high expression of various inhibitory receptors (such as PD‐1) [3]. However, the upstream molecular mechanisms driving CD8^+^ T cell exhaustion in Luminal B breast cancer are not fully understood.
SLC12A8 is a member of the solute carrier family 12, initially identified as a nicotinamide mononucleotide transporter involved in cellular metabolism and aging [4]. Recent studies have found that SLC12A8 is abnormally overexpressed in various solid tumors such as bladder cancer and lung cancer, promoting tumor proliferation, invasion, and drug resistance by activating signaling pathways like JAK/STAT and PDK1/AKT [5, 6, 7]. A pan‐cancer analysis suggested that SLC12A8 might be an important oncogene associated with poor prognosis in multiple cancers [8]. However, the expression, pattern, and clinical significance of SLC12A8 in breast cancer, especially in the Luminal B subtype, and particularly its regulatory role and mechanism on the tumor immune microenvironment remain largely unknown.
This study, by integrating bioinformatic analysis and systematic in vitro experiments, explores for the first time the key role of SLC12A8 in the tumor immune microenvironment of Luminal B breast cancer. We aimed to elucidate whether SLC12A8, by regulating specific signaling pathways, affects the functional state of CD8^+^ T cells, thereby driving immune evasion and tumor progression, hoping to provide new theoretical foundations and potential targets for immunotherapy of this breast cancer subtype.
Materials and Methods
2
Data Sources and Bioinformatics Analysis
2.1
Gene Expression and Copy Number Variation Data
2.1.1
RNA‐seq data from the TCGA‐BRCA project and breast tissue data from the GTEx database were downloaded from the UCSC Xena database. DNA copy number data were downloaded from the cBioPortal database.
Protein Expression Analysis
2.1.2
Immunohistochemistry slices of SLC12A8 in normal breast and breast cancer tissues were obtained from the Human Protein Atlas database for comparative analysis.
Immune Cell Infiltration Analysis
2.1.3
Immune cell infiltration scores for TCGA breast cancer patients were obtained from the ImmuCellAI and TIMER2 databases. The R package “ESTIMATE” was used to calculate stromal score, immune score, ESTIMATE score, and tumor purity for each sample.
Survival Analysis
2.1.4
Based on TCGA clinical data, patients were divided into high and low expression groups according to the median SLC12A8 expression value. Kaplan–Meier survival curves were plotted, and the Log‐rank test was used for difference analysis. Additional analyses of disease‐free survival (DFS) and progression‐free survival (PFS) were performed and are included in Table S2.
Gene Set Enrichment Analysis
2.1.5
Using the R package “clusterProfiler”, GSEA was performed based on the gene list significantly correlated with SLC12A8 expression, using GO, KEGG, and Reactome databases as reference gene sets. Parameters were set as: nPerm = 1000, minGSSize = 10, maxGSSize = 1000, p‐value cutoff = 0.05.
Cell Lines, Tissue Specimens, and Cell Culture
2.2
Human Luminal A breast cancer cell line MCF‐7, Luminal B breast cancer cell lines BT474 and MDA‐MB‐361, HER2‐overexpressing breast cancer cell line SKBR3, basal‐like breast cancer cell line BT549, normal breast epithelial cell line MCF‐10A, and human primary CD8^+^ T cells isolated from healthy donor peripheral blood using CD8 MicroBeads (Miltenyi Biotec, 130–045‐201) were all purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences. Fresh frozen specimens of Luminal A, Luminal B, HER2‐positive, and basal‐like breast cancer (10 cases each) and corresponding adjacent tissues were sourced from the Breast Treatment Center of the First Affiliated Hospital of Gannan Medical University. This study was approved by the hospital ethics committee (Approval No.: LLsc‐2024 No. 334).
All cells were cultured according to standard procedures in a constant temperature incubator at 37°C with 5% CO_2_, using appropriate medium supplemented with 10% fetal bovine serum and 1% penicillin–streptomycin. CD8^+^ T cells were activated with anti‐CD3/CD28 beads (Thermo Fisher, 11131D) for 48 h before co‐culture. Cells from passages 5 to 20 were used for experiments. All cell lines used in this study were authenticated by short tandem repeat profiling and tested negative for mycoplasma contamination prior to use in experiments.
Quantitative Real‐Time PCR (qPCR)
2.3
Total RNA was extracted from cells or tissues using the RNeasy Mini Kit and reverse transcribed using the PrimeScript RT Master Mix. qPCR reactions were performed on the 7500 Fast Real‐Time PCR system using Power SYBR Green PCR Master Mix. GAPDH was used as the internal reference, and the relative gene expression was calculated using the 2^(‐ΔΔCt) method. Primer sequences were synthesized by Sangon Biotech (Shanghai) Co. Ltd., and sequences are listed in Table 1. The complete list of primer sequences used in this study is provided in Table S4.
Small Interfering RNA (siRNA) Transfection
2.4
siRNA targeting SLC12A8 and negative control siRNA were designed and synthesized by Shanghai GenePharma Co. Ltd. Sequences are as follows:
si‐SLC12A8: 5′‐CCATGTATATCACCGGCTT‐3′.
si‐NC: 5′‐AATTCTCCGAACGTGTCACGT‐3′.
siRNA (final concentration 50 nM) was transfected into BT474 cells in the logarithmic growth phase using Lipofectamine 3000 transfection reagent. Cells were collected 48–72 h post‐transfection for subsequent experiments.
For SLC12A8 overexpression experiments, a pcDNA3.1‐SLC12A8 plasmid was constructed and transfected into MCF‐10A cells using Lipofectamine 3000.
Western Blot Analysis
2.5
Total protein was extracted using RIPA lysis buffer (containing PMSF), and protein concentration was determined by the BCA method. Equal amounts of protein samples were separated by 10% SDS‐PAGE gel electrophoresis and transferred to PVDF membranes. After blocking with 5% skim milk at room temperature for 1 h, membranes were incubated with specific primary antibodies at 4°C overnight. The next day, membranes were incubated with HRP‐labeled corresponding secondary antibodies at room temperature for 1 h, followed by development using ECL chemiluminescence solution in a chemiluminescence imaging system. Primary antibody information: anti‐SLC12A8 (Abcam, ab254331, 1:1000), anti‐TLR2 (Cell Signaling Technology, 12,276, 1:1000), anti‐MyD88 (CST, 4283, 1:1000), anti‐IRAK1 (CST, 4504, 1:1000), anti‐TAK1 (CST, 4505, 1:1000), anti‐PD‐1 (CST, 86163, 1:1000), and internal reference anti‐β‐actin (CST, 3700, 1:2000). Detailed quantitative data from Western blot analyses are summarized in Table S1.
For cell‐specific analysis, BT474 cells and CD8^+^ T cells were separated after co‐culture using magnetic bead sorting before protein extraction.
Immunofluorescence Staining
2.6
Cell slides or tissue sections were fixed with 4% paraformaldehyde, permeabilized with 0.1% Triton X‐100, and blocked with 3% BSA at room temperature for 30 min. Primary antibodies (anti‐CD8, Abcam ab217344, 1:200; anti‐PD‐1, CST 86163, 1:200) were added and incubated at 4°C overnight. Subsequently, Cy3 or FITC‐labeled fluorescent secondary antibodies were incubated at room temperature in the dark for 50 min, and nuclei were counterstained with DAPI. After sealing with anti‐fade mounting medium, images were observed and captured under a fluorescence microscope.
Transwell Invasion Assay
2.7
BT474 cells in good growth condition (control group, si‐SLC12A8 group, GIT27 treatment group) were resuspended in serum‐free medium and seeded into the upper chamber of a Transwell insert pre‐coated with Matrigel (Corning, 356,234) at a concentration of 1 mg/mL at a density of 5 × 10^4^ cells per well. The lower chamber was filled with medium containing 10% FBS as a chemoattractant. GIT27 (Sigma, SML0705) was used at 10 μM. After 24 h of incubation, the inserts were removed, non‐invading cells on the upper surface were wiped off with a cotton swab, fixed with paraformaldehyde, and stained with 0.1% crystal violet. Invaded cells in five randomly selected fields were photographed and counted under an inverted microscope.
CD8
- T Cell Functional Assays
2.8
IFN‐γ and IL‐2 production was measured using ELISA kits (R&D Systems) according to the manufacturer's instructions. Cytotoxicity was assessed using CFSE‐labeled BT474 cells co‐cultured with CD8^+^ T cells at an effector: target ratio of 5:1 for 6 h. Cell death was measured by flow cytometry using Annexin V/PI staining.
Co‐Culture System
2.9
An indirect co‐culture system was used throughout the study. BT474 cells (or transfected derivatives) were seeded in the lower chamber, and CD8^+^ T cells were placed in Transwell inserts (0.4 μm pore size) to allow soluble factor exchange without direct cell contact. For Western blot and qPCR analyses, cells were separated prior to processing. The tumor cell to T cell ratio was maintained at 1:5 unless otherwise specified.
Statistical Analysis
2.10
Statistical analyses were performed using SPSS 19.0 and GraphPad Prism 9 software. Data are presented as mean ± standard deviation (SD). Sample size (n) for each experiment is indicated in the figure legends. No data transformation or outlier removal was performed. Comparisons between two groups were performed using two‐tailed Student's t‐test. Comparisons among multiple groups were performed using one‐way ANOVA followed by Tukey's post hoc test for multiple comparisons. The alpha level (significance threshold) was set at p < 0.05. All statistical tests met the assumptions of normality and homogeneity of variance as assessed by Shapiro–Wilk test and Levene's test, respectively. P‐values were adjusted for multiple comparisons where applicable. The specific statistical test used for each experiment is detailed in the corresponding figure legend.
Results
3
SLC12A8 Is Significantly Overexpressed in Breast Cancer
3.1
To investigate the role of SLC12A8 in breast cancer, we first performed bioinformatic analysis. Combined analysis of TCGA and GTEx databases showed that the mRNA expression level of SLC12A8 in breast cancer tissues was significantly higher than in normal breast tissues (p < 0.0001, Figure 1A). Immunohistochemistry results from the HPA database further confirmed at the protein level that SLC12A8 showed strong positive staining in breast cancer tissues, while its expression was weak in normal breast tissues (Figure 1B). To validate this finding, we detected SLC12A8 mRNA expression in four different subtype breast cancer cell lines by qPCR. The results showed that compared to the normal breast epithelial cell line MCF‐10A, SLC12A8 was significantly upregulated in all tested breast cancer cell lines (p < 0.01, Figure 1C). Notably, Luminal B cell lines BT474 showed the highest SLC12A8 expression among the subtypes. These results, from transcriptome to proteome, from tissue to cell lines, consistently and strongly indicate that SLC12A8 is universally abnormally overexpressed in breast cancer, with particular prominence in Luminal B.
*Enhanced expression of SLC12A8 in breast cancer. (A) Combined analysis of TCGA and GTEx databases showing SLC12A8 mRNA expression in breast cancer versus normal tissues (****p < 0.0001, two‐tailed t‐test). (B) Representative immunohistochemistry images of SLC12A8 protein in normal breast and breast cancer tissues from the HPA database. Scale bar: 100 μm. (C) qPCR detection of relative SLC12A8 mRNA expression levels in four breast cancer cell lines (compared to MCF‐10A, *p < 0.01; one‐way ANOVA with Tukey's post hoc test; n = 3 independent experiments). Data are mean ± SD.
High SLC12A8 Expression Predicts Poor Prognosis in Breast Cancer Patients
3.2
To assess the clinical significance of SLC12A8, we divided breast cancer patients from the TCGA dataset into high and low expression groups based on the median SLC12A8 expression value and performed survival analysis. Kaplan–Meier curves showed that the overall survival of the high SLC12A8 expression group was significantly shorter than that of the low expression group (p = 0.0193, Figure 2). Univariate Cox regression analysis also confirmed that high SLC12A8 expression was a risk factor for prognosis (hazard ratio > 1). Additional analyses of disease‐free survival and progression‐free survival yielded similar results (Table S2). This indicates that SLC12A8 is not only a molecular marker for breast cancer but also an independent risk factor for its prognosis.
Correlation between SLC12A8 expression level and patient overall survival. Kaplan–Meier survival curve shows poorer prognosis in the high SLC12A8 expression group (p < 0.05, Log‐rank test). n (low expression) = 543, n (high expression) = 544.
SLC12A8 Expression Is Associated With Remodeling of the Breast Cancer Immune Microenvironment
3.3
The tumor immune microenvironment plays a key role in tumor progression. Using the ESTIMATE algorithm to analyze TCGA data, we found that SLC12A8 expression was significantly positively correlated with the immune score (r = 0.23, p < 0.001) and stromal score (r = 0.18, p < 0.001) in the tumor microenvironment and negatively correlated with tumor purity (r = −0.25, p < 0.001, Figure 3A–D). This strongly suggests that SLC12A8 may be involved in shaping and regulating the breast cancer immune microenvironment.
Correlation between SLC12A8 expression and the breast cancer immune microenvironment. (A‐D) ESTIMATE analysis showing the correlation between SLC12A8 expression and stromal score, immune score, tumor purity, and ESTIMATE combined score. Pearson correlation; n = 1087 samples.
SLC12A8 Is Negatively Correlated With CD8
- T Cell Infiltration and Shows the Strongest Association in the Luminal B Subtype
3.4
Given the central role of CD8^+^ T cells, we further analyzed the relationship between SLC12A8 and immune cell infiltration. Analyses from both TIMER2 and ImmuCellAI databases consistently revealed that SLC12A8 expression was significantly negatively correlated with the infiltration level of CD8^+^ T cells in breast cancer (TIMER2: r = −0.151, p < 0.001; ImmuCellAI: r = −0.284, p < 0.001, Figure 4A,B). Further subtype analysis found that this negative correlation was most significant and strongest in Luminal B breast cancer (Figure 5). This suggests that the inhibitory effect of SLC12A8 on CD8^+^ T cells may be subtype‐specific.
*SLC12A8 expression is negatively correlated with CD8+ T cell infiltration in the breast cancer immune microenvironment. (A) Circos plot from TIMER2 database analysis showing the correlation between SLC12A8 and CD8+ T cell infiltration. (B) ImmuCellAI database analysis shows a negative correlation between SLC12A8 expression and CD8+ T cell infiltration score (**p < 0.001, Pearson correlation; n = 1087 samples).
Correlation between SLC12A8 expression and CD8+ T cell infiltration in different breast cancer subtypes. Heatmap shows the strongest negative correlation between SLC12A8 and CD8+ T cells in Luminal B breast cancer. Pearson correlation coefficients are shown; n for each subtype: Luminal A = 568, Luminal B = 219, HER2 = 82, Basal = 191.
CD8
- T Cell Infiltration Is Relatively Lower and Functionally Possibly Limited in Luminal B Breast Cancer
3.5
We detected CD8^+^ T cell infiltration in clinical tissue specimens by immunofluorescence staining. As shown in Figure 6, although CD8^+^ T cell infiltration was present in all subtypes, the density of CD8^+^ T cells in Luminal B breast cancer tissues was relatively lower than in other subtypes (p < 0.01). CD8 was labeled with green fluorescence. This corroborates our bioinformatic findings, suggesting that local immune surveillance might be weaker in Luminal B breast cancer.
*Infiltration of CD8+ T cells in different types of breast cancer tissues. Immunofluorescence staining shows relatively less CD8+ T cell (green) infiltration in Luminal B breast cancer. DAPI (blue) marks nuclei. Scale bar: 50 μm. *(n = 10 samples per group; p < 0.01, one‐way ANOVA with Tukey's post hoc test).
Knockdown of SLC12A8 Enhances the Cytotoxic Activity of CD8
- T Cells in a co‐Culture System
3.6
To directly verify the causal effect of SLC12A8 on CD8^+^ T cell function, we established an indirect co‐culture system of BT474 cells (control group or si‐SLC12A8‐transfected group) with CD8^+^ T cells. qPCR detection found that in the co‐culture system with SLC12A8 knockdown, the mRNA levels of the effector molecules perforin and granzyme B expressed by CD8^+^ T cells were significantly increased compared to the si‐NC control group (PRF1: p < 0.01; GZMB: p < 0.001, Figure 7). Furthermore, IFN‐γ and IL‐2 production were significantly enhanced in the si‐SLC12A8 group, and cytotoxicity against BT474 cells was increased. This indicates that inhibiting SLC12A8 in tumor cells can effectively restore or enhance the cytotoxic function of co‐cultured CD8^+^ T cells.
*Effect of SLC12A8 expression level on CD8+ T cell function. qPCR detection shows significantly increased mRNA expression levels of the effector molecules PRF1 and GZMB in CD8+ T cells in the SLC12A8 knockdown co‐culture group. (n = 3 independent experiments; ns: Not significant; *p < 0.05; **p < 0.01; **p < 0.001; one‐way ANOVA with Tukey's post hoc test). Data are mean ± SD.
SLC12A8 Functions by Activating the TLR Signaling Pathway
3.7
To elucidate the molecular mechanism by which SLC12A8 regulates CD8^+^ T cells, we performed GSEA analysis. The results suggested that high SLC12A8 expression was significantly associated with the activation of the Toll‐like receptor signaling pathway (NES = 1.82, p.adj < 0.05, Figure 8A). We functionally verified this prediction through Western Blot experiments. In the indirect co‐culture model of BT474 and CD8^+^ T cells, after separating the cell types, we observed that knockdown of SLC12A8 effectively downregulated the expression levels of multiple key node proteins in the TLR pathway (TLR2, MyD88, IRAK1, TAK1) specifically in CD8^+^ T cells (Figure 8B). Importantly, using the specific TLR pathway inhibitor GIT27 mimicked the phenotype of SLC12A8 knockdown, similarly inhibiting the expression of downstream molecules MyD88, IRAK1, and TAK1 (Figure 8B). To further confirm the role of TLR signaling, we overexpressed SLC12A8 in MCF‐10A cells and observed enhanced TLR pathway activation in co‐cultured CD8^+^ T cells. Conversely, treatment with the TLR2 agonist Pam3CSK4 in control co‐cultures recapitulated the SLC12A8‐overexpression phenotype. This strongly demonstrates that SLC12A8 activates the TLR signaling pathway, and its function depends on this pathway. Furthermore, specific inhibition of TLR2 or TLR4 attenuated CD8^+^ T cell exhaustion markers, with detailed results shown in Table S3.
*SLC12A8 functional expression is associated with the TLR signaling pathway. (A) GSEA analysis shows significant enrichment of the TLR signaling pathway in samples with high SLC12A8 expression. (B) Western Blot and quantitative analysis verify the expression changes of key proteins in the TLR signaling pathway after different interventions (si‐SLC12A8, GIT27) in isolated CD8+ T cells. (n = 3 independent experiments; ns: Not significant; **p < 0.01; **p < 0.001; one‐way ANOVA with Tukey's post hoc test). Data are mean ± SD.
Inhibiting the SLC12A8/TLR Axis Reverses CD8
- T Cell Exhaustion and Suppresses Tumor Invasion
3.8
Based on the above mechanism, we further investigated the anti‐tumor effect of targeting the SLC12A8/TLR axis. Immunofluorescence results showed that in the co‐culture system, either knockdown of SLC12A8 or use of the TLR inhibitor GIT27 significantly reduced the expression level of the inhibitory receptor PD‐1 on the surface of CD8^+^ T cells (p < 0.001, Figure 9A), with PD‐1 shown in red fluorescence, indicating effective alleviation of the T cell exhaustion state. Correspondingly, the Transwell invasion assay confirmed that both interventions significantly weakened the invasive ability of BT474 cells (p < 0.001, Figure 9B). These functional experiments form a complete chain of evidence: Targeting the SLC12A8/TLR axis → Alleviating CD8^+^ T cell exhaustion → Inhibiting tumor invasion.
*Inhibiting the SLC12A8/TLR axis reverses T cell exhaustion and suppresses tumor invasion. (A) Immunofluorescence detection shows that knockdown of SLC12A8 or addition of GIT27 significantly reduces PD‐1 (red) expression on CD8+ T cells. DAPI (blue) marks nuclei. Scale bar: 100 μm. (n = 3 independent experiments; *p < 0.05; **p < 0.01; ***p < 0.001; one‐way ANOVA with Tukey's post hoc test). (B) Transwell assay shows that knockdown of SLC12A8 or addition of GIT27 significantly inhibits the invasive ability of BT474 cells. Scale bar: 50 μm. (n = 3 independent experiments; *p < 0.05; **p < 0.01; **p < 0.001; one‐way ANOVA with Tukey's post hoc test). Data are mean ± SD.
Discussion
4
This study systematically reveals for the first time the key role of the ion transporter SLC12A8 in the immune microenvironment of Luminal B breast cancer. Our results collectively depict a novel pathogenic model: Overexpression of SLC12A8 in tumor cells activates the Toll‐like receptor signaling pathway, inducing functional exhaustion of tumor‐infiltrating CD8^+^ T cells, thereby weakening the body's anti‐tumor immune surveillance and ultimately promoting immune evasion and invasive metastasis in Luminal B breast cancer. This finding not only expands our understanding of the non‐canonical functions of SLC family proteins but also provides new perspectives and potential targets for immune intervention in refractory Luminal B breast cancer.
First, we established SLC12A8 as an important oncogenic driver in breast cancer, particularly in the Luminal B subtype. Through mining large public databases like TCGA and GTEx, we found that SLC12A8 is generally highly expressed in breast cancer tissues at the transcriptome level. More importantly, this high expression was significantly associated with poor overall patient survival, indicating its important clinical prognostic value. We validated this expression profile via qPCR in multiple breast cancer cell lines, confirming that abnormal overexpression of SLC12A8 is a common feature of breast cancer. These findings resonate with recent studies in bladder cancer, lung cancer, and pancreatic cancer [5, 7, 9], suggesting that the oncogenic function of SLC12A8 might be universal, though its tissue‐specific regulatory mechanisms remain to be explored.
The core innovation of this study lies in extending the function of SLC12A8 from traditional tumor cell‐autonomous behaviors to non‐canonical regulation of the tumor immune microenvironment. Although previous studies mostly focused on SLC12A8 directly promoting tumor cell proliferation, invasion, and drug resistance via pathways like JAK/STAT or PDK1/AKT [5, 7], its regulation of the immune system has rarely been reported. Our bioinformatic analysis revealed a significant negative correlation between SLC12A8 expression and CD8^+^ T cell infiltration levels, and this association was most prominent in Luminal B breast cancer. This computational biology prediction was strongly corroborated by in vitro experiments: when we co‐cultured SLC12A8‐knocked down Luminal B breast cancer cells with CD8^+^ T cells, we observed a significant upregulation of the cytotoxic effector molecules perforin and granzyme B at the mRNA level in T cells. We further confirmed functional restoration through cytokine production and cytotoxicity assays. This directly proves that tumor cell‐derived SLC12A8 can significantly inhibit the effector function of CD8^+^ T cells in a paracrine or indirect manner. This finding provides a new mechanism for understanding how tumor cells actively shape an immunosuppressive microenvironment.
At the mechanistic level, we deeply explored and experimentally verified the key signaling axis through which SLC12A8 exerts its immunosuppressive function—the TLR pathway. GSEA enrichment analysis provided a crucial clue, closely linking SLC12A8 with the TLR signaling pathway. The TLR pathway is a core bridge connecting innate and adaptive immunity, and its aberrant activation in the tumor microenvironment has been shown to drive T cell exhaustion by inducing numerous inhibitory cytokines and upregulating immune checkpoint molecules [10, 11, 12, 13]. Our Western Blot results perfectly connected this prediction: after separating cell types, we confirmed that in the co‐culture system of breast cancer cells and CD8^+^ T cells, knockdown of SLC12A8 effectively downregulated the expression of multiple key node proteins (TLR2, MyD88, IRAK1, TAK1) in the TLR pathway specifically in CD8^+^ T cells. Importantly, using the specific TLR pathway inhibitor GIT27 mimicked the phenotype of SLC12A8 knockdown, strongly proving that the TLR pathway is the key effector downstream of SLC12A8. We further strengthened this link through overexpression and agonist experiments. Although the precise mechanism of how SLC12A8, as a transporter, activates the TLR pathway requires further study (e.g., whether by altering the local ionic environment or transporting specific ligands like DAMPs), our data undoubtedly establish a causal link between them.
In terms of functional consequences, inhibiting the SLC12A8/TLR axis effectively reversed CD8^+^ T cell exhaustion and suppressed malignant tumor behavior. A core feature of T cell exhaustion is the sustained high expression of various inhibitory receptors (such as PD‐1) [3]. Our immunofluorescence experiments showed that either knockdown of SLC12A8 or inhibition of the TLR pathway significantly reduced the expression level of PD‐1 on co‐cultured CD8^+^ T cells. This indicates that targeting this axis can effectively “rescue” CD8^+^ T cells from the functionally exhausted state and restore their immune activity. Consequently, the invasive ability of tumor cells was significantly reduced, as visually confirmed by the Transwell assay. This complete “cause‐effect” chain—from molecule (SLC12A8 overexpression) to pathway (TLR activation), to cellular phenotype (T cell exhaustion), and finally to disease behavior (tumor invasion)—greatly enhances the reliability of our conclusions.
Our study has important implications for the clinical treatment of Luminal B breast cancer. Compared to Luminal A or triple‐negative breast cancer, Luminal B breast cancer is relatively insensitive to traditional endocrine therapy and chemotherapy and has long been considered an “immunologically cold” tumor with poor response to immune checkpoint inhibitors [2, 14, 15]. The SLC12A8/TLR axis discovered in this study provides a potential breakthrough for converting “cold” tumors into “hot” tumors. Interventions targeting this axis, such as developing small molecule inhibitors of SLC12A8 or utilizing existing TLR pathway antagonists, are expected to synergize with existing anti‐PD‐1/PD‐L1 therapies, potentially overcoming multi‐level immunosuppression, reshaping the tumor microenvironment, and thereby improving the treatment efficacy and prognosis of patients with Luminal B breast cancer.
We acknowledge several limitations of our study. First, our mechanistic research primarily relies on in vitro co‐culture systems, which, while effectively controlling variables, cannot fully simulate the complex in vivo tumor microenvironment. Future studies will include in vivo validation using mouse xenograft models. Second, the precise molecular connections upstream and downstream of SLC12A8, as a transporter protein, are not entirely clear. For example, whether it affects tumor cell energy metabolism and signal transduction by transporting specific metabolites (such as nicotinamide mononucleotide), thereby indirectly regulating the TLR pathway, is a direction worthy of further investigation [16]. Finally, we have not yet identified which specific TLR family member(s) play the leading role in this process, though our data suggest TLR2 involvement.
Looking forward, we will continue to explore in depth from the following directions:
- Construct conditional SLC12A8 knockout transgenic mouse models to validate its role in the development, progression, and immune evasion of Luminal B breast cancer in vivo.
- Utilize clinical breast cancer tissue microarrays to further verify the correlation between SLC12A8 expression and CD8 ^+^ T cell infiltration, PD‐1 expression, and patient prognosis, promoting its clinical translation.
- Use techniques such as co‐immunoprecipitation and proteomics to search for and identify the protein interaction network of SLC12A8, aiming to more comprehensively reveal the fine molecular mechanisms by which it regulates the TLR pathway.
- Investigate the potential of SLC12A8 inhibitors in combination with existing immunotherapies in preclinical models.
Conclusion
5
In summary, this study innovatively reveals the new role of SLC12A8 as an “immune checkpoint” in Luminal B breast cancer. We elucidated the mechanism by which SLC12A8, through activating the TLR signaling pathway, induces CD8^+^ T cell exhaustion, thereby driving immune evasion and tumor metastasis. This discovery not only deepens the understanding of the biological functions of SLC12A8 but also provides a new theoretical basis and a highly potential therapeutic target for overcoming immunotherapy resistance in Luminal B breast cancer.
Author Contributions
All authors contributed substantially to the manuscript's development, including conceptualization, writing, and editing. Conceptualization and design: Zhiyong Liu and Ran Chen; part of the treating team and data collection and data analysis: Zhiyong Liu and Ran Chen; revision of the manuscript drafts: Zhiyong Liu and Ran Chen. The submitted version of the manuscript has been approved by all authors, who have also agreed to take responsibility for any aspect of the work.
Funding
The authors have nothing to report.
Ethics Statement
This study was conducted in accordance with the principles of the Declaration of Helsinki.
Consent
Written informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent is available for review by the Editor‐in‐Chief of this journal.
Conflicts of Interest
The authors declare no conflicts of interest.
Supporting information
Table S1: A: SLC12A8 Knockdown Efficiency Validation (BT474 Cells).
Table S2: Disease‐free survival (DFS) and progression‐free survival (PFS) analyses of SLC12A8 in breast cancer.
Table S3: Effects of specific TLR inhibitors on CD8^+^ T cell exhaustion.
Table S4: Primer sequences for additional genes analyzed.
The reference list from the paper itself. Each links out to its DOI / PubMed record.
- 1H. Sung , J. Ferlay , R. L. Siegel , et al., “Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries,” CA: A Cancer Journal for Clinicians 71, no. 3 (2021): 209–249.33538338 10.3322/caac.21660 · doi ↗ · pubmed ↗
- 2B. Tran and P. L. Bedard , “Luminal‐B Breast Cancer and Novel Therapeutic Targets,” Breast Cancer Research 13, no. 6 (2011): 221.22217398 10.1186/bcr 2904 PMC 3326541 · doi ↗ · pubmed ↗
- 3E. J. Wherry and M. Kurachi , “Molecular and Cellular Insights Into T Cell Exhaustion,” Nature Reviews Immunology 15, no. 8 (2015): 486–499.10.1038/nri 3862 PMC 488900926205583 · doi ↗ · pubmed ↗
- 4N. Ito , A. Takatsu , H. Ito , et al., “Slc 12a 8 in the Lateral Hypothalamus Maintains Energy Metabolism and Skeletal Muscle Functions During Aging,” Cell Reports 40, no. 4 (2022): 111131.35905718 10.1016/j.celrep.2022.111131 · doi ↗ · pubmed ↗
- 5X. Zhang , H. Wu , and S. Wang , “SLC 12A 8 Promotes Proliferation, Invasiveness, Migration and Epithelial‐Mesenchymal Transition of Bladder Cancer Cells by Activating JAK/STAT Signaling,” Nan Fang Yi Ke Da Xue Xue Bao 43, no. 9 (2023): 1613–1621.37814877 10.12122/j.issn.1673-4254.2023.09.20PMC 10563110 · doi ↗ · pubmed ↗
- 6S. L. Li , Z. F. Li , Q. W. Cao , and W. Z. Wang , “SLC 12A 8 Plays a Key Role in Bladder Cancer Progression and EMT,” Open Medicine 16, no. 1 (2021): 58–67.33364434 10.1515/med-2021-0013 PMC 7739378 · doi ↗ · pubmed ↗
- 7F. Huang , J. Cui , J. Wan , et al., “SLC 12A 8 Mediates TKI Resistance in EGFR‐Mutant Lung Cancer via PDK 1/AKT Axis,” Journal of Cancer Research and Clinical Oncology 149, no. 18 (2023): 16729–16739.37725242 10.1007/s 00432-023-05416-4PMC 11798034 · doi ↗ · pubmed ↗
- 8D. Yu , H. Ma , D. Li , H. Tang , W. Li , and M. Li , “Identification of SLC 12A 8 as a Valuable Prognostic Biomarker and Immunotherapeutic Target by Comprehensive Pan‐Cancer Analysis,” Gene 903 (2024): 148211.38280496 10.1016/j.gene.2024.148211 · doi ↗ · pubmed ↗