In Vitro and In Planta Botanical Control of Banana Postharvest Disease Causing Fungi
Afsana Hossain, Farjana Akter, Pallab Ghosh, Shah Mohammad Naimul Islam, Md. Abdullahil Baki Bhuiyan, Shaikh Sharmin Siddique
TL;DR
This study finds that a mix of Aloe vera and garlic can reduce banana postharvest diseases without harming fruit quality.
Contribution
Identifies Aloe vera and garlic as effective botanical agents for controlling banana postharvest fungal diseases in Bangladesh.
Findings
Aloe vera and garlic extracts reduced fungal growth in vitro.
The botanical combination reduced crown rot and brown spot in banana fruit.
No adverse effects on banana physiochemical properties were observed.
Abstract
Postharvest brown spot (Lasidiplodia theobromae) and crown rot (caused by a pathogen complex) are the most important postharvest issues in Bangladesh. Research information regarding banana postharvest disease control is limited in Bangladesh. Thus, this research aimed to identify the causal agent, and tested certain botanical extracts for their antifungal properties to reduce banana postharvest infections. These two symptoms of local banana provided 37 fungal isolates through standard isolation method. Later, L. theobromae, Colletotrichum fructicola, and Fusarium equiseti were identified morphologically and molecularly. Lasidiplodia theobromae (Lt1) was selected for further disease control studies as this pathogen causes both crown rot and brown spot simultaneously. For the antifungal efficacy tests, several botanical extracts (from Aloe vera , garlic bulb, onion bulb, and moringa leaf…
Genes, proteins, chemicals, diseases, species, mutations and cell lines named across the full text — each resolved to its canonical identifier and authoritative record.
Click any figure to enlarge with its caption.
FIGURE 1
FIGURE 2
FIGURE 3
FIGURE 4
FIGURE 5
FIGURE 6
FIGURE 7
FIGURE 8
FIGURE 9
FIGURE 10
FIGURE 11
FIGURE 12
FIGURE 13
FIGURE 14| Name | Scientific name | Family | Parts used | Collection area |
|---|---|---|---|---|
|
|
| Asphodelaceae | Leaf | Local market |
| Garlic |
| Amaryllidaceae | Clove | Local market |
| Onion |
| Amaryllidaceae | Bulb | Local market |
| Moringa |
| Moringaceae | Leaf | Local area |
| Isolate | GenBank accession | Organism | Reference accession | Nucleotides number | Percent pairwise identity | |
|---|---|---|---|---|---|---|
| B‐14 |
| 1100 | 99.50% | |||
| B‐15 |
| 1094 | 98.50% | |||
| B‐16 |
| 1142 | 96.00% |
- —Bangladesh Bureau of Educational Information and Statistics10.13039/100031325
- —Ministry of Education
Peer Reviews
No public reviews on file for this paper yet. If you reviewed it on a platform where reviews are public (OpenReview, ICLR, NeurIPS, ICML), you can paste yours below so the community can read it here.
Videos
No videos yet. Explain this paper in a talk, walkthrough, or lecture? Add one.
Taxonomy
TopicsBanana Cultivation and Research · Food Science and Nutritional Studies · Plant Pathogens and Fungal Diseases
Introduction
1
Banana ( Musa sapientum L; Family Musaceae) is an herbaceous perennial plant which is the second largest produced fruit and eighth most important food crop in the world (Jalawadi et al. 2021; Thangavelu et al. 2021). It is highly nutritive and a rich source of energy (89 kcal/100 g) (Sidhu and Zafar 2018) which contains various bioactive compounds. During 2020, the area under banana production across the world 5.5 Mha, and production was 131.7 MMT. Whereas, Asia contributes 52.8% of the total production, with an average yield 23.70 t/ha (FAOSTAT 2022).
According to Bangladesh Bureau of Statistics (BBS 2022), the yearly area coverage and production of Banana is 0.05 million ha (ranks first among other fruit) and 0.81 million tons (ranks third), respectively. Whereas Kamrul (2010), calculated the yearly postharvest loss is approximately 0.567 billion BDT., almost 24.62% of the total production. This loss may happen due to undesirable physiological changes, weakening of the flesh, and a lack of resistance to microbial attack, during transport and marketing (Akter et al. 2013). Kasso and Bekele (2018), identified postharvest fungal diseases as the major cause of spoilage at all stages of supply chain until consumption. The most common postharvest diseases are crown‐rot (Fusarium spp., Lasiodiplodia theobromae, and Colletotrichum musae), anthracnose ( C. musae ), finger rot/brown rot/fruit rot (L. theobromae), and cigar‐end rot (Verticillium theobromae) reported from different parts of the world. One of the most critical diseases of banana fruits is crown rot, whose causal agents are fungi, including Lasiodiplodia theobromae and Colletotrichum musae (Yagual et al. 2023). It is considered the main disease currently affecting bananas at the postharvest (Yagual et al. 2023). In cases of severe crown rot, it may extend to the pedicel and even the banana pulp. Losses from 10% to 86% have been recorded for treated and untreated bananas, respectively (Lassois and de Lapeyre Bellaire 2014).
Postharvest diseases of banana are commonly controlled using chemical fungicides. However, the extensive application of chemical fungicides has led to environmental pollution, fungicide resistance, and fungicide residue on the fruit surface poses a great health risk to consumers (Ayón‐Reyna et al. 2017). Therefore, the alternatives should have the potential to reduce the fungicide resistance to the pathogen, and the risk related to humans, animals, and the environment (M. Hasan et al. 2012). Recently, natural plant extracts have gained considerable attention due to their ability to prevent pathogenic infections and prolong the fruit shelf life. The use of plant extracts to control perishable postharvest diseases is well advancing (Palou et al. 2015). A number of plant extracts such as Aloe vera , garlic, moringa, and onion have the ability to suppress the growth of disease‐causing pathogens (Abdulkadir et al. 2018; De Rodrıguez et al. 2005; M. U. Hasan et al. 2021; Nakamoto et al. 2020; Sitara et al. 2011).
Therefore, plant extract edible coatings could suppress the postharvest pathogens and preserve the fruit quality. For example, natural edible coatings from Aloe vera , Cactus mucilage, and gum Arabic increase the shelf life and reduce the qualitative losses of various fruits, including banana (Alali et al. 2018; Castillo et al. 2010). In addition, Aloe vera gel reduced the growth of fungal mycelia by 22%–38% in Colletotrichum, Rhizoctonia, and Fusarium, and reduced the viability of fungal spores by 15%–20% in Botrytis, Penicillium, and Alternaria (Nabigol and Asghari 2013). Allium sativum (garlic) contains an important biologically active substance called allicin (Ankri and Mirelman 1999; Bagiu et al. 2012; Josling 2001; Nakamoto et al. 2020). Garlic extract can suppress the growth of L. theobromae causing fruit rot in mango and improve the marketability of fruit without using synthetic chemical fungicides (Nur Fatimma et al. 2018). The garlic essential oil, in combination with Aloe vera gel coating, significantly reduced the incidence of banana anthracnose (Khaliq et al. 2019). Besides, moringa ( Moringa oleifera ) (contained moringin) and onion ( Allium cepa ) (contained allicepin) are rich sources of flavonoids and phenolic compounds that also have antimicrobial activities (Bako et al. 2010; Wang and Ng 2004).
In Bangladesh, perishable postharvest disease control is a less studied area in terms of research and practical operations. Only a few studies have been conducted on the control of banana postharvest diseases. Among the studies, Mandal (2016) used Aloe vera gel, ginger oil, garlic, onion, and neem extracts as natural coatings on banana fruits. According to this study, fruit coatings reduced disease incidence and increased the shelf life of banana. However, there was no clear indication of a specific disease or disease complex, or whether the fruits were naturally infected or artificially inoculated; quality assessment parameters were not consistent with the postharvest disease issues.
Therefore, the present study aimed to evaluate natural fruit coatings against two important banana postharvest diseases in vitro and in planta. For this investigation, plant extracts were chosen as natural coatings because of their affordability, environmental friendliness, and accessibility in the area. Besides the identification of the causal organisms, their morphological characteristics were also studied. The postharvest qualities of banana after the application of natural fruit coatings were also assessed carefully.
Materials and Methods
2
Collection, Sterilization, and Incubation of Banana for Isolation of the Postharvest Disease‐Causing Pathogens
2.1
Banana samples (variety Amrit Sagar) were collected from different retailers' shops at Salna bazar, Gazipur. Four samples were selected from each collected sample and washed with running tap water, surface sterilized with 70% ethyl alcohol for 1 min, 1% NaOCl for 2 min (Jha 1995), rinsed three times with sterilized distilled water (1 min each), and air dried for 10 min inside a laminar airflow cabinet. Sterilized samples were kept separately in a sterilized box (18 cm × 10 cm × 9 cm). To maintain the maximum humidity during disease symptom development, two sterilized and moist paper towels were kept underneath the sample, and sealed boxes were incubated at 25°C in the cycle of 12 h dark and 12 h light for 4 days to develop the desired symptoms.
Isolation of Postharvest Fungi
2.2
Two distinct disease symptoms, brown spot and crown rot, were developed after 4 days of incubation as mentioned above. Pathogens were isolated separately from both these symptoms. To isolate the causal agent, the infected tissues along with healthy tissues were aseptically cut into small pieces (5 × 5 mm^2^). The cut pieces were disinfected with 0.01% NaOCl for 2 min, followed by three washings with distilled water to remove the NaOCl and then left in the laminar airflow to air‐dry for 15 min. Sterilized diseased samples (four cut pieces for each disease symptom) collected from each banana sample were transferred to the Petri dishes containing water agar medium (Difco agar 20 mg + 1 L water, autoclaved at 15 lbs. pressure, 121°C for 15 min) separately and incubated at 25°C and observed daily at 24 h intervals. After the initial emergence of mycelia (approximately 24 h of incubation), every single fungal colony was transferred to fresh PDA plates (potato, 250 g + dextrose, 20 g + Difco agar, 20 g + distilled water 1 L) and incubated at room temperature for 3 days to obtain a pure culture.
Later, pure culture for each isolate was obtained from a single hyphal tip culture (Tutte 1969) of the periphery of the 2–3‐day‐old contamination‐free culture. Colony characters were studied using both stereo and compound microscopes and photographed.
Cultural and Morphological Identification of Fungi
2.3
Both cultural and morphological identification processes were conducted to identify the causal agents. The fungus colonies isolated from the brown spot and crown rot symptoms were preliminarily identified based on visual observation of colony morphology and spore characters using microscopy (Zeiss 3,116,017,489; Heidelberg, Germany) according to prior references (Barnett and Hunter 1987; Huda‐Shakirah et al. 2022; Maciel et al. 2015; Ploetz et al. 1994; Sangeetha et al. 2012; Wallbridge and Pinegar 1975). The identity of test pathogens was further confirmed through molecular characterization. Later, only three isolates (Lt1, Lt2, and Lt3) were selected for the pathogenicity test for brown rot symptoms.
Genomic DNA Extraction, PCR Amplification, and Sequencing
2.4
The genomic DNA of three different pathogen isolates (Lasiodiplodia sp., Colletotrichum sp., and Fusarium sp.) was extracted by the method described by Islam (2018). The Internal transcribed spacer (ITS) region was amplified using ITS1F: CTTGGTCATTTAGAGGAAGTAA and ITS4R: TCCTCCGCTTATTGATATGC by polymerase chain reaction (PCR) (Islam 2018). The thermal profile was as follows: initial denaturation at 90°C for 2 min, followed by 35 cycles of denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, followed by a final extension at 72°C for 15 min. PCR product was electrophoresed in 1% agarose in 1 × TBE buffer at 120 V with GelRed nucleic acid stain and visualized under UV light using a “Molecular Imager” (Gel DocTM). The PCR products were purified using an “Isolate DNA Kit” (Bioline) following the standard manufacturer protocol. The PCR purified product was sent to Macrogen, Korea, for one‐way sequencing using ITS1F primer.
Sequence Processing, Similarity Searching, and Submission
2.5
The Sanger's sequence genomic data of the individual isolate were manually edited by using Geneious V11.1.2. The sequence similarity search was done by Basic Local Alignment Search Tool (BLAST) on National Center for Biotechnology Information (NCBI). The annotated sequences were submitted to NCBI to get accession numbers.
Pathogenicity Test
2.6
Pathogenicity test against three fungal isolates and screening of the most virulent isolate was carried out on healthy looking banana fruit (variety Amrit Sagar) by wounding method and non‐wounding method. Six surface sterilized banana fruits were selected for each of these tests. A single wound was made at the center of three fruits with a sterilized needle to a depth of 1–2 mm and inoculated with a mycelial plug (5 mm) of L. theobromae (Lt1) from a 3‐day‐old culture separately. The rest of the three banana fruits were inoculated similarly except for any wounding at the peel. Inoculated fruits were incubated for 11 days. Disease development was checked, and symptom diameter was measured at every 24 h intervals. This experiment was repeated twice.
In Vitro Antifungal Efficacy of L. Theobromae (Lt1) Against Selected Botanical Extracts
2.7
Four botanicals (Table 1) were selected for the in vitro antifungal efficacy.
Preparation of Botanical Extracts
2.8
Fresh Aloe vera leaf, garlic clove, onion, and moringa leaf were collocated in a local area of Gazipur, Bangladesh. Plant parts were washed and sterilized with 0.01% NaOCl for 2 min, followed by three washes with distilled water to remove the NaOCl, and then left in the laminar airflow to air‐dry for 15 min.
Aloe vera gel was obtained by grounding the soft, colorless inner parenchyma by a blender (Waring Commercial Blender, Waring Products). This fresh Aloe vera gel was kept in an airtight box and remained in the fridge for 1 h for further in vitro test. Garlic and onion extract was prepared by blending 300 g of garlic clove or 70 g onion bulb in 150 mL of sterile distilled water. Then the extract was filtered through two folds of sterilized cheesecloth and stored in an airtight box at room temperature until further use (Nur Fatimma et al. 2018). Moringa leaves ( Moringa oleifera ) extract was prepared by blending 200 g of fresh leaves with 50 mL water using a blender and filtered with two folds of cheesecloth and stored for further experiments. Therefore, 100% concentration was considered as 300 g/150 mL of sterile water (SW) for garlic, 70 g/150 mL SW for onion, and 200 g/50 mL SW of moringa leaf.
In Vitro Botanical Control of the Selected Postharvest Fungi
2.9
In vitro antifungal efficacy was tested individual and combined applications of Aloe vera (gel), garlic (pulp), onion (bulb), and moringa (leaf) extracts at concentrations ranging from 100% (v/v) in PDA against the most virulent pathogenic isolate of L. theobromae such as L. theobromae (Lt1). The combination of plant extracts (50% v/v of each extracts with PDA) were evaluated for their synergistic inhibitory activity against the selected postharvest pathogen. Sterilized PDA media infused with different concentrations of the mentioned botanical extracts was used for this In vitro test.
Approximately 20 mL of botanical/botanical mixture infused media were poured into a Petri dish for in vitro antifungal assay. Five mm discs were collected from the periphery of a 3 days old actively growing pure culture of L. theobromae (Lt1) and inoculated at the center of a Petri dish containing selected botanicals or botanical mixtures separately. PDA plates without any plant extract and inoculated with pathogen plug were considered as a negative control. Meanwhile, PDA plates infused with Carbendazim (Autostin 50 WDG, Auto crop care limited) 2 g/L were treated as the positive control. The fungicide was selected for its efficacy against the mentioned pathogen according to previous reference (Bhure et al. 2023). All the inoculated Petri dishes were incubated at 25°C ± 2°C for 3 days. Mycelial growth was observed every 24 h intervals until fungal growth in the control filled the Petri dishes completely. There were three replications for each treatment, and the experiment was repeated twice (indicated two independent experiments conducted on separate days later). Based on the in vitro radial mycelial growth inhibition efficacy, the effective botanical extracts were selected for the further in planta test.
Accordingly, three botanical extracts: Aloe vera gel (500 mL/L), garlic bulb extract (100 mL/L), and Aloe vera gel + garlic bulb extract [250 (ml/L) + 50 (ml/L)] were selected as fruit coatings for in planta test.
In Planta Antifungal Efficacy of the Selected Botanicals
2.10
The In planta test was conducted against brown spot L. theobromae (Lt1) of banana at three different conditions of disease development on banana fruit. Effect of selected botanicals in fruit quality and naturally infected postharvest disease symptoms, the protective efficacy of the selected treatment in an artificially pathogen inoculated fruit, and curative efficacy of the selected treatment in an artificially pathogen inoculated fruit.
L. theobromae (Lt1) was artificially inoculated with a 2‐day‐old mycelial plug of (L. theobromae (Lt1)) before and after the botanical treatments in planta, respectively. The selected three botanical treatments with selected concentrations were applied as fruit coatings in these experiments. The severity of naturally occurring crown rot symptoms was also assessed during these three in planta experiments and analyzed as well.
For every in planta experiment, banana fruit (variety Amrit Sagar) were collected from the local market of Gazipur (24 h before marketing) with an average length of 12–14 cm, width of 2.5–3.5 cm, weight 100–130 g, firmness of 1.6–2.1 (10^5^pa), and color grade 1 according to the color chart referred by Morita et al. (1992) and (Soltani et al. 2010) with modification. There were three replication per treatment (fruit used from same batch which is technical replication) and the experiment, each replication contains four fruit and the experiment was repeated twice (indicated two independent experimental conducted on separate days later using different batches of fruit). However, fruits were assigned randomly for treatment groups (e.g., randomized allocation within batches).
Effect of Selected Fruit Coatings on Quality and Naturally Occurred Postharvest Disease Symptoms of Banana In Planta
2.11
After surface sterilization and air drying, fruit were then immersed in the three selected fruit coating solutions for 5 min separately. Fruit dipped in sterile distilled water was considered as the negative control. Whereas fruit dipped in carbendazim 2 g/L was considered as the positive control. There were three replications in each treatment, and four dipped fruit were considered a separate replication. Each replication was treated separately, air dried in the laminar airflow for 40 min, and placed in a sterilized plastic box (30 × 15 × 15 cm^3^) with a sterilized and moist paper towel inside the box. All the replications were incubated at 25°C in a Thermostatic cabinet (Lovibond) incubator for 7 days. The effect of each treatment on postharvest disease development and qualities (such as fruit firmness, fruit color, fruit weight) of the fruit was assessed at 24 h intervals. The experiment was repeated twice (as mentioned in Section 2.10).
In Planta Curative Antifungal Efficacy of the Selected Botanical/Botanical Mixtures Against Postharvest Diseases of Banana Fruit
2.12
Surface sterilized banana fruit were uniformly wounded at two points (a 3–4 cm distance) with a sterilized needle to a depth of 1–2 mm. Each wound site was then inoculated with a 5 mm fungal disc of L. theobromae (Lt1) from a 3 days old culture plate. Pathogen inoculated bananas were kept in an airtight box with a sterilized moist paper towel for incubation 24 h on the laboratory table. This incubation period was to ensure the pathogen infection and symptom development initiation. After 24 h of incubation, the artificially pathogen inoculated bananas fruit were immersed in selected botanical and botanical mixtures for 5 min as mentioned above. Fruit dipped in sterile distilled water was considered as a negative control. Whereas fruit dipped in carbendazim 2 g/L was considered as the positive control. There were four replications per treatment. All treated fruit were air dried in the laminar airflow for 40 min and kept at 25°C on the laboratory table for 7 days. The effect of each treatment on disease development and postharvest qualities (such as weight loss, firmness, and color) of the fruit was assessed at 24 h intervals.
The curative treatment was conducted only against the postharvest brown spot disease, and the effect of selected treatments against natural crown rot infection was also assessed. The entire experiment was repeated once. There were three replications per treatment and the experiment; each replication contains 4 fruit, and the experiment was repeated twice (as mentioned in Section 2.10).
In Planta Protective Antifungal Efficacy of the Selected Botanicals Against Postharvest Diseases of Banana
2.13
After sterilization and air drying, fruits were treated with the selected three botanicals and botanical mixtures for 5 min, as mentioned above. Fruit dipped in sterile distilled water was considered as the negative control. Whereas fruit dipped in carbendazim 2 g/L was considered as the positive control. There were four replications per treatment. Immediately after treatment, all the fruit were air dried in the laminar airflow for 40 min. Three‐day‐old actively growing culture of L. theobromae (Lt1) was used for artificial fruit inoculation. The botanical extract treated banana fruit were uniformly wounded at three points (at 3–4 cm distance) with a sterilized needle to a depth of 1–2 mm. Each wound site was then inoculated with 5 mm fungal disc of L. theobromae (Lt1). Pathogen inoculated bananas were incubated as mentioned above. for 7 days for disease development. The effect of each treatment on disease development and postharvest qualities (such as weight loss, firmness, and color) of the fruit was assessed at 24 h intervals as mentioned above. The experiment was repeated once. There were three replication per treatment and the experiment, each replication contains four fruit and the experiment was repeated twice (as mentioned in Section 2.10).
Assessment of Postharvest Disease Development
2.14
Postharvest Brown Spot Development
2.14.1
To assess the treatment effect on postharvest brown spot development, the diameter of the spot size was measured with a measuring scale (cm) at 24 h intervals for both the artificially inoculated fruit (both curative and protective treatment). Brown spot disease severity was measured according to the mean spot size around the fungal plug. The average of a spot was calculated from the length and width of each spot separately. Finally, disease severity was expressed as the average length (cm) of two wounds/fruit per 24 h interval.
Postharvest Crown Rot Development
2.14.2
The development of the crown rot symptom was assessed according to a 0–7 scale (Figure S1) referred to at D. G. Alvindia et al. (2004) and D. G. J. C. P. Alvindia (2012) with some modification, where 0 = no discoloration or mycelial growth on the crown, 1 = discoloration or mycelial growth limited to the surface of the cut crown, 2 = discoloration or mycelial growth less than 10% of the crown area, 3 = 11%–40% discoloration or mycelial growth on the crown area, 4 = 41%–70% discoloration or mycelial growth on crown area, 5 = 71%–100% discoloration or mycelial growth on the crown area, 6 = discoloration or mycelial growth advanced to finger stalks, 7 = finger‐stalk rot occurs, causing the fingers to drop off when handled.
Assessment of Physical and Chemical Qualities of the Fruit
2.15
Weight Loss
2.15.1
Weight loss was determined by weighing individual fruit with a digital weight scale initially and on the last day of observation. The weight of each fruit was measured separately. Finally, the weight loss per fruit was calculated according to the following formula and expressed as the percent loss of initial weight.
Fruit Firmness
2.15.2
Fruit firmness was evaluated by using a cylindrical probe (11 mm) of a penetrometer (Model GY‐3) at 24 h intervals. The firmness was measured from three points of the equatorial region of the fruit. The firmness was expressed as 10^5^ pa (Palafox‐Carlos et al. 2012).
Color Change
2.15.3
The changes in the peel color of banana were observed and recorded at 1–7 scale according to the color chart referred by Morita et al. (1992) and (Soltani et al. 2010) with modification (Figure 11); where 1 = all green, 2 = green with a trace of yellow, 3 = more green than yellow, 4 = more yellow than green, 5 = more yellow than green, 6 = all yellow; 7 = all yellow with brown speckles. The observation was done at 24 h intervals.
Soluble Solids Concentration (SSC)
2.15.4
SSC of banana juice was determined using a Hand‐Held Refractometer during the last days of observation. The refractometer was calibrated with distilled water to give a 0% reading before each sample analysis (Sharmin et al. 2015). A drop of banana juice (squeezed from the fruit pulp of each fruit) was placed on the prism glass of the refractometer to obtain the %SSC reading directly from the instrument. The SSC from each fruit was measured separately and expressed as %Brix.
pH
2.15.5
To measure the pH, the whole fruit obtained from each replication of each treatment was homogenized using an electric kitchen blender. Finally, the pH was measured using a digital pH meter.
Data Analysis
2.16
A standard parametric statistical test, namely Analysis of Variance, was conducted utilizing the recorded data on disease lesion, and fruit quality parameters through the IBM SPSS STATISTIX 22 software. No significant differences were noticed among the distinct sets of experiments (the main experiment and two repetitions); therefore, the mean was aggregated from all replications throughout the three experiments. Subsequently, the analysis assessed the presence of any significant differences among the individual treatments. Significance was set at p < 0.05. Data are shown as mean ± standard error of the mean (SEM) unless otherwise stated. The means were compared following DMRT3 | RESULTS.
Study of the Disease Symptoms
2.17
Following 48 h of incubation, small brown spots or freckles on the green banana grew and formed blackish‐brown blotches on the yellow peel under favorable moisture and temperature. The banana crown rot symptom began with cottony mycelia growth at the crown zone and spread to the peduncle and main fruit, in addition to brown patches. After 2–3 days, the afflicted tissues turned dark brown, softened, darkened, and moved toward the fruit stalks.
Cultural and Morphological Characterization
2.18
Three distinct colony growths were documented when the purified mycelia were grown on PDA media and classified into Groups 1, 2, and 3. A grayish‐white, thin mycelium colony emerged after 24 h of incubation on the PDA plates from the pure cultures of Group 1 fungal isolates. Grayish, cotton‐like mycelia enveloped the PDA plates within 4 d of inoculation. Subsequently, after 7 days of incubation, the colony developed a dense, dark gray hue (Figure 1a). During this period, black pigmentation manifested on the reverse side (Figure 1b). Under microscopic view (40 ×), young conidia were noted to be white, possessing thin walls and lacking septation (Figure 1c–e). The mature conidia exhibited a brownish hue, characterized by two cells, a septate center, and a thicker wall (Figure 1f,g). However, the detailed morphometrics were not captured and will be included in future work for all the pathogen isolates.
Morphological characteristics of Group 1 fungi (Lasiodiplodia theobromae) isolated from the brown spot symptom of banana. (a) Thick and Grayish cottony mycelia of a 7 days old culture. (b) Reverse view of a 7‐day‐old culture. (c) Immature conidia of L. theobromae. (d) comparison of mature and immature conidia. (e) Conidiogenous cells developing conidia. (f) Septate and thick‐walled mature conidia. (g) Conidia with conidiophore. scale bar = 10 μm.
White aerial mycelia developed on the PDA plates after 48 h of incubation from the Group 2 fungal isolates. Dense whitish mycelia covered the PDA plates after 8th day of incubation with a light pink colored center of the mycelia. Later the colony developed grayish pink colored conidiomata after 11th day of incubation. Hyaline, cylindrical, aseptate conidia, and ovoid appressoria were observed under a light microscope (40 ×) (Figure 2a, to 2 days).
Morphological characteristics of Group 2 fungi (Colletotrichum fructicola) isolated from the crown rot symptom of banana. (a) Conidiation. (b) Development of a lesion at the inoculation point by mycelial plug. (c) and (d) Formation of appressoria. Co, Conidium; Gt, Germ tube; Ap, Appressorim; IH, Initial hypha; scale bar = 10 μm.
The Group 3 pathogen developed whitish mycelia within 24 h of incubation. The colony became fluffy at 7 days of incubation, while a pinkish white color developed at the reverse at this time period (Figure 3a,b). Both micro and macro conidia were observed under a light microscope (40 ×). Macro conidia were hyaline, septate (5 septation), and sickle shaped (Figure 3c,d). Micro conidia were hyaline, aseptate, and cylindrical in shape (Figure 3e).
Morphological characteristics of Group 2 fungi (Fusarium spp.) isolated from the crown rot symptom of banana. (a) Thick and pinkish cottony mycelia of a 7‐day‐old culture. (b) Reverse view of a 7‐day‐old culture. (c) Macro conidia with hyphae. (d) Septation of macro conidia. (e) Micro and macro conidia. scale bar = 10 μm.
Molecular Identification
2.19
In addition to the cultural and morphological parameters, the identity of all three fungal groups was further confirmed by molecular identification. The ITS sequence data were processed and submitted to NCBI. The accession numbers of the isolates and similarity search proved that the isolated pathogens were putative F. equiseti, putative L. theobromae, and putative C. fructicola (Table 2).
Pathogenicity Test
2.20
Banana postharvest brown spot symptoms varied significantly (p = 0.022–0.032) between inoculation methods (Figure 4a). Both wounding and nonwounding procedures showed no brown spot symptoms until the 5 days of inoculation (Figure 4a).
Pathogenicity test of L. theobromae.(a) Development of brown spot over time through wounding and nonwounding method. (b) Development of brown spot by three isolate of L. theobromae (n = 9, and bars indicates standard error of the mean).
Significant differences were recorded between the wounding and nonwounding method in the initial days of the symptom appearance (p = 0.03). The brown spot sizes increased over time for both methods (p = 0.029). The wound inoculation approach produced insignificantly (p = 0.32) larger brown spot lesions (3.2 cm) on the 11th day compared with the nonwounding brown spot lesion (1.7 cm). All three specific L. theobromae isolates developed disease symptoms during the pathogenicity test (Figure 4b) and had significant differences (p = 0) in the size of the lesions over time. The first brown spot lesion appeared at the 5th d of inoculation, by (Lt1), whereas the rest two isolates (Isolate 2 and Isolate 3) developed initial lesions after the 6th d of inoculation. However, lesions developed by all three isolates increased over time. The highest lesion size (2.78 cm) was recorded by the (Lt1) (Figure 4b). Therefore, this isolate was selected for further in vitro and in planta experiments.
In Vitro Antifungal Efficacy of Selected Botanicals
2.21
All selected botanicals effectively diminished the colony diameter in comparison to the control until the second day of inoculation (Figure 5). At the third day, there was no statistically significant difference in the colony growth of onion (p = 0.191) and Aloe vera
- onion treated plates (p = 0.53) compared with the negative control. The plates treated with Garlic (0.53 cm) and Garlic + Aloe vera (0.78 cm) exhibited the lowest colony growth relative to the negative control (Figure 5). The colony growth of the positive control (0.45 cm) was statistically comparable to that of the garlic and garlic + Aloe vera treatments. The PDA enriched with Aloe vera and moringa (individually) decreased colony growth (3.08 and 2.07 cm) relative to the negative control. Nonetheless, it significantly exceeded the colony growth of the positive control (Figure 5).
In vitro botanical control of the highly pathogenic Lasiodiplodia theobromae isolate (Lt1) caused postharvest brown spot of banana. (n = 9, and bars indicates standard error of the mean).
In Planta Antifungal Efficacy of the Selected Botanicals
2.22
Effect of Selected Fruit Coatings on Quality and Postharvest Diseases of Banana in Planta
2.22.1
Among the selected botanical fruit coatings, garlic extract reduced the crown rot symptoms significantly in comparison with both negative (p = 0.003) and positive control (p = 0.009) after 7 days of the treatment (Figure 6a).
Effect of selected botanical fruit coatings on fruit quality and crown rot symptoms of banana fruit. (a) Effect of botanical fruit coatings on crown rot symptom (b) Effect of botanical fruit coatings on fruit firmness. (c) Effect of botanical fruit coatings on fruit color. (d) Effect of botanical fruit coatings on initial and final fruit weight (g). and (e) Effect of botanical fruit coatings % weight loss of fruit. (n = 36, and bars indicates standard error of the mean).
There was no significant difference recorded between the firmness of fruit treated with different fruit coatings. The fruit firmness ranged from 1.6 to 1.9 (× 10^5^ pa) during the 1st day of treatment. At the 7th day of treatment, the firmness ranged from 0.5 to 0.8 (× 10^5^ pa) at the 7th day of treatment (Figure 6b). Similarly, the effect of the botanical fruit coatings on the color (p = 0.4 and 0.107 for the 1st day and 7th day of the treatment, respectively) of the fruit during the treatment period was insignificant (Figure 6c). In addition, the treatment effect was insignificant on both initial weight and final weight (p = 0.26 and 0.306 for initial and final fruit weight), and % weight loss (p = 1.44) of the fruit (Figure 6d,e). Therefore, it is concluded that the selected botanical fruit coating did not adversely affect different postharvest qualities of banana.
Effect of Different Botanical Fruit Coating as a Protective Treatment
2.22.2
All the botanical fruit coating significantly reduced (p = 0.001) the brown spot diameter in comparison with the negative control at the 12th day of inoculation (Figures 7a and 9). The mean spot size developed by the negative control was 1.93 cm in diameter. Whereas the mean spot sizes varied from 1 to 1.13 cm for the botanical treatments. The positive control completely inhibited the brown spot development (Figures 7a and 9). In addition, a significant difference was recorded between the treatments (p = 0.016) in reducing crown rot symptom up to 6th day of incubation (Figures 7b and 9), where the lowest crown rot disease scale (0.5) was recorded by the Aloe vera treatment. The treatment effects reduced subsequently with the advancement of time. Later (at the 12th day of infection), no treatment was effective in reducing postharvest crown rot symptoms (Figures 7b and 9).
Effect of botanical fruit coatings as a protective treatment to reduce artificially inoculated postharvest brown spot (L. theobromae) symptom and crown rot (naturally infected) symptom in planta. (a) Effect of fruit coating against artificially inoculated brown spot symptom. (b) Effect of fruit coating against naturally infected crown rot symptom. (n = 36, and bars indicates standard error of the mean).
Effect of Different Botanical Fruit Coating as a Curative Treatment
2.22.3
All the botanical fruit coatings significantly reduced (p = 0.001) the brown spot diameter in comparison to the negative control at the 12th day of inoculation (Figures 8a, 9a, and 9b). The mean spot size developed by the negative control was 2.049 cm in diameter at the 12th day of treatment. Whereas the mean spot sizes varied from 1.21 to 1.46 cm for the botanical treatments at the 12th day of treatment. The positive control (fungicide treatment) completely inhibited the brown spot development (Figures 8a, 9a, and 9b). In addition, a significant difference was recorded between the treatments (p = 0.001) in reducing crown rot symptom up to 4th day of incubation (Figures 8b, 9a, and 9b). The lowest crown rot disease scale (0.13) was recorded by the Aloe vera treatment at the 6th d of treatment. The treatment effects reduced subsequently with the advancement of time. Later (at the 12th day of infection), no treatment was effective in reducing postharvest crown rot symptom (Figures 8b, 9a, and 9b).
Effect of botanical fruit coatings as a curative treatment to reduce artificially inoculated postharvest brown spot (L. theobromae) symptom and crown rot (naturally infected) symptom in planta. (a) Effect of fruit coating against artificially inoculated brown spot symptom. (b) Effect of fruit coating against naturally infected crown rot symptom. (n = 36, and bars indicates standard error of the mean).
Effect of botanical fruit coatings as a protective and a curative treatment to reduce artificially inoculated postharvest brown spot (L. theobromae) symptom and crown rot (naturally infected) symptom in planta. (a) Effect of fruit coating at 7th day of treatment. (b) Effect of fruit coating at 12th day of infection.
Effect of Different Botanical Fruit Coating as a Curative Treatment on the Postharvest Fruit Quality of Banana
2.23
The effect on different postharvest quality parameters such as fruit firmness (Figures 10a and 10b), fruit color (Figures 11a and 11b), fruit weight (Figures 12a and 12b), fruit weight loss (Figures 12a and 12d), fruit pulp pH (Figures 13a and 13b), and fruit pulp soluble solid concentration (%Brix) (Figures 14a and 14b) after different botanical fruit coating treatment was insignificant in comparison to the untreated control (Figures 10, 11, 12, 13, 14).
Effect of botanical fruit coatings as both curative and protective treatment on postharvest fruit firmness in planta. (a) Effect of fruit coating as a curative treatment on postharvest fruit firmness. (b) Effect of fruit coating as a protective treatment on postharvest fruit firmness. (n = 36, and bars indicates standard error of the mean).
Effect of botanical fruit coatings as both curative and protective treatment on postharvest fruit color in planta. (a) Effect of fruit coating as a curative treatment on postharvest fruit color. (b) Effect of fruit coating as a protective treatment on postharvest fruit color. (n = 36, and bars indicates standard error of the mean).
Effect of botanical fruit coatings as both curative and protective treatment on postharvest fruit weight loss in planta. (a) Effect of fruit coating as a curative treatment on postharvest fruit weight loss. (b) Effect of fruit coating as a protective treatment on postharvest fruit weight loss. (c) Effect of fruit coating as a curative treatment on % weight loss of fruit. (d) Effect of fruit coating as a protective treatment on % weight loss of fruit. (n = 36, and bars indicates standard error of the mean).
Effect of botanical fruit coatings as both curative and protective treatment on postharvest fruit pulp pH in planta. (a) Effect of fruit coating as a curative treatment on postharvest fruit pulp pH. (b) Effect of fruit coating as a protective treatment on postharvest fruit pulp pH. (n = 36, and bars indicates standard error of the mean).
Effect of botanical fruit coatings as both curative and protective treatment on postharvest fruit pulp TSS in planta. (a) Effect of fruit coating as a curative treatment on postharvest fruit pulp TSS. (b) Effect of fruit coating as a protective treatment on postharvest fruit pulp SSC (n = 36, and bars indicates standard error of the mean).
Discussion
3
Both the brown spot and crown rot symptoms developed during the present study. A number of authors reported similar brown spot, fruit rot symptoms (Nath et al. 2015; Salaemae et al. 2022), and crown rot symptoms of banana (Azeem et al. 2016; Ekhuemelo and Yaaju 2017; Jahan et al. 2019) previously. However, the most common pathogens associated with these symptoms include Colletotrichum musae, Fusarium spp. (F. roseum, F. pallidoroseum), Lasiodiplodia theobromae and some other (Cephalosporium sp., Verticillium theobromae, Ceratocystis paradoxa, Phomopsis sp., Nigrospora sphaerica, Penicillium spp., and Aspergillus spp.) (Azeem et al. 2016; Jahan et al. 2019; Jaramillo‐Aguilar et al. 2024; Sangeetha et al. 2012, 2011).
The morphological study aligns with prior publications on the colony and conidia descriptions for Lasiodiplodia theobromae (Huda‐Shakirah et al. 2022; Maciel et al. 2015; Salaemae et al. 2022; Sangeetha et al. 2012); for Colletotrichum fructicola reported previously (Huang et al. 2021; Jiang et al. 2014); and for Fusarium equiseti reported previously (Abd Murad et al. 2017; Kosiak et al. 2005). The molecular identification also verifies the selected isolates as F. equiseti, L. theobromae, and C. fructicola based only on ITS sequencing. This ITS‐based sequencing is not sufficient for robust species‐level resolution in these genera. Therefore, multi‐locus phylogeny is needed for definitive identification, and that only ITS was used in this study. Moreover, this morphological identification lacked some important information, such as the length and width of conidia, the structure of the fruiting body, or the structure of sclerotia or chlamydospores or image clarity and scale bars. Therefore, further studies were recommended to generate this basic information.
The observation of the pathogenicity test was consistent with Lim et al. (2002). The author conducted a pathogenicity test of C. musae ST‐01, with both mycelial disc and conidial suspension either through the wound or without wound against green banana, apple, and pepper. Later, the wound‐inoculation method was proved to be a more effective method (in comparison with the nonwound inoculation method) for the pathogenicity test.
The prolonged storage conditions often increase the microbial development in fresh produce, causing tissue softening, nutrient loss, and decomposition, making the product unsuitable for consumers (M. U. Hasan et al. 2021). It is obvious that once the fruits pass the climacteric stage, fruit senescence starts, and fruits become more susceptible to fungal invasion, which leads to fruit degradation by cell death (Parven et al. 2020). Consequently, a natural fruit coating may serve to diminish microbial growth and extend the shelf life of perishable goods.
The present research demonstrated successful reduction of selected banana postharvest L. theobromae growth by botanicals in vitro, Moreover, coating with Aloe vera (alone), and incorporation with garlic, reduced two postharvest diseases such as brown spot and crown rot of banana. even after 12th day of infection at room temperature. This result is consistent with previous reports (Karunarathna et al. 2021; Khaliq et al. 2019; Mendy et al. 2019) where Aloe vera gel (at 50%) achieved complete suppression of many postharvest fungus, including, that is, Fusarium sp., Aspergillus niger, and C. gloeosporioides, Pestalotiopsis sp., Phomopsis sp., and L. theobromae. In addition, Khaliq et al. (2019) reported improved in vitro and in vivo antifungal activity when Aloe vera added with higher concentrations of garlic oil. Similarly, inhibition was more pronounced with a rise in the gel concentration of the PDA medium (Sitara et al. 2011; Zapata et al. 2013). Likewise, (Kumar and Bhatnagar 2015) reported a significant decrease in natural postharvest microbial infection and shelf‐life increase of banana after being coated with 40% Aloe vera gel. In addition, Jodhani and Nataraj (2021) treated bananas with Aloe gel (50%) + Lemon Peel Extract (10%–15%) to check the postharvest disease in naturally infected fruit. A comparatively better appearance, and with no or minimum pathogenic lesions (compared to untreated control) was recorded in this investigation. Interestingly, the efficacy also increased with the increase in Lemon Peel extract concentration (Jodhani and Nataraj 2021). The edible coating prepared from the combination of Aloe vera gel and basil oil could be a promising postharvest treatment for maintaining the quality of strawberry fruit during cold storage (Mohammadi et al. 2021). To the author's knowledge, information regarding the postharvest banana brown spot and crown rot disease management by raw Aloe vera gel (with or without another compound) is limited. According to the present study, 33.33% Aloe vera gel reduced both the symptoms in banana. Therefore, it recommended to check the effect higher concentration of Aloe vera gel to reduce the postharvest disease severity of banana for future investigation. In addition, Aloe vera , with other available medicinal plants, could also be tested as a safe and edible fruit coat to decrease banana postharvest diseases in future.
The specific antifungal mode of action of Aloe vera gel is not fully understood (Khaliq et al. 2019). A recent review (M. U. Hasan et al. 2021) summarized that Aloe vera gel coating has antimicrobial properties with an intrinsically higher range of anthraquinones, polysaccharides, minerals, vitamins, antioxidants, and phenolic compounds. Those compounds act synergistically and lower the postharvest disease and decay incidence of fresh produce. According to (Serrano et al. 2006), this gel operates through combined mechanisms: firstly forms a protective layer against the oxygen and moisture present in the air. Secondly, it has a number of antimicrobial (antibacterial/antifungal) compounds and inhibits food‐borne diseases (Brishti et al. 2013; Mendy et al. 2019). Therefore, this tasteless, colorless, odorless natural product is safe for human consumption. It could be considered as a potential environmentally friendly alternative candidate to synthetic preservatives such as sulfur dioxide (Misir et al. 2014; Parven et al. 2020; Sharmin et al. 2015). Zapata et al. (2013), suggest that harvesting season, soil, location, and processing method may impact Aloe vera gel composition and efficacy. For several Aloe spp., aloin or barbaloin (fungicidal component in Aloe vera gel) concentrations increase more than 10‐fold from winter to summer (Zapata et al. 2013). The gel utilized in this study was thought to include the above components. Those chemicals may have been the key fungicidal component. Further research is needed to identify components in local Aloe vera preparations. Future research should also examine the presence and concentration of each chemical in Aloe vera leaves from different regions of the country.
The major visual and physical quality characters (such as fruit shape/size, peel color, smoothness, firmness) control the consumer's choice and purchase of any perishable (Parven et al. 2020). It is known that the perishables often shriveled and lost their firmness during storage and handling, due to their rapid moisture loss tendency (M. U. Hasan et al. 2021). However, in the present study, the different postharvest quality parameters of banana, such as weight loss, firmness, color, pulp pH, or % brix were similar to the untreated control. Whereas a number of previous studies (Khaliq et al. 2019; Quoc 2021; Ratra et al. 2016) mentioned the slower deterioration of postharvest banana qualities after Aloe vera fruit coating (with or without incorporation of any other coating compound). The natural deterioration of the physical quality of the present investigation could be due to the high incubation temperature (25°C ± 2°C). Whereas, in the above‐mentioned experiments, the bananas were stored at comparatively lower temperatures after postharvest treatment. It was mentioned earlier that the mechanism for the reduction of water loss is based on the hygroscopic water pressure between the fruit and the environment. Therefore, it was assumed that at a lower temperature, Aloe vera gel film on the banana surface reduced or slowed the moisture loss and retained postharvest qualities (Khaliq et al. 2019). Therefore, future experiments are recommended to integrate different storage temperatures along with Aloe vera gel treatment and check the postharvest qualities of banana. Other climacteric and nonclimacteric fruit can also be tested in further investigation.
In summary, this study highlights that botanicals have a high probability to be used as biocontrol agents against postharvest diseases of banana. Among the botanicals, Aloe vera was found as most promising to control the most aggressive pathogen L. theobromae (Lt1) without adversely affecting the qualities (color, firmness, weight, pH, TSS) of banana (Amrit Sagar) both In vitro and In planta experiment. These findings suggest that botanical formulations may serve as cost‐effective, practical, eco‐friendly substitutes to synthetic fungicides for managing banana postharvest diseases in Bangladesh.
Author Contributions
Afsana Hossain: conceptualization, methodology, data curation, formal analysis, validation, software, investigation, writing – original draft. Shah Mohammad Naimul Islam: validation, formal analysis, visualization.
Funding
The research was supported under the project “Natural coatings and atmospheric cold plasma treatments against the postharvest diseases of banana” funded by BANBEIS (Bangladesh Bureau of Educational Information and Statistics), through the Ministry of Education, Bangladesh.
Disclosure
The manuscript is original, and it was not published or submitted elsewhere. All the authors approved and consented to the final version for publication.
Ethics Statement
The authors have nothing to report.
Conflicts of Interest
The authors declare no conflicts of interest.
Supporting information
Data S1: fsn371557‐sup‐0001‐FigureS1.docx.
The reference list from the paper itself. Each links out to its DOI / PubMed record.
- 1Abd Murad, N. , N. Mohamed Nor , S. Shohaimi , and N. J. Mohd Zainudin . 2017. “Genetic Diversity and Pathogenicity of Fusarium Species Associated With Fruit Rot Disease in Banana Across Peninsular Malaysia.” Journal of Applied Microbiology 123, no. 6: 1533–1546.28891270 10.1111/jam.13582 · doi ↗ · pubmed ↗
- 2Abdulkadir, A. R. , M. M. Hasan , and M. S. Jahan . 2018. “Antimalarial, Antioxidant, Antimicrobial Properties of Moringa Oliefera Lam: A Review.” Australian Journal of Crop Science 12, no. 6: 905–908.
- 3Akter, H. , M. K. Hassan , M. Rabbani , and A. J. Mahmud . 2013. “Effects of Variety and Postharvest Treatments on Shelf Life and Quality of Banana.” Journal of Environmental Science and Natural Resources 6, no. 2: 163–175.
- 4Alali, A. A. , M. A. Awad , A. D. Al‐Qurashi , and S. A. Mohamed . 2018. “Postharvest Gum Arabic and Salicylic Acid Dipping Affect Quality and Biochemical Changes of ‘Grand Nain'bananas During Shelf Life.” Scientia Horticulturae 237: 51–58.
- 5Alvindia, D. G. , T. Kobayashi , K. T. Natsuaki , and S. Tanda . 2004. “Inhibitory Influence of Inorganic Salts on Banana Postharvest Pathogens and Preliminary Application to Control Crown Rot.” Journal of General Plant Pathology 70: 61–65.
- 6Alvindia, D. G. 2012. “Revisiting Hot Water Treatments in Controlling Crown Rot of Banana cv. Buñgulan.” Crop Protection 33: 59–64.
- 7Ankri, S. , and D. Mirelman . 1999. “Antimicrobial Properties of Allicin From Garlic.” Microbes and Infection 1, no. 2: 125–129.10594976 10.1016/s 1286-4579(99)80003-3 · doi ↗ · pubmed ↗
- 8Ayón‐Reyna, L. E. , A. González‐Robles , J. G. Rendón‐Maldonado , M. E. Báez‐Flores , M. E. López‐López , and M. O. Vega‐García . 2017. “Application of a Hydrothermal‐Calcium Chloride Treatment to Inhibit Postharvest Anthracnose Development in Papaya.” Postharvest Biology and Technology 124: 85–90.