miR-214-3p exacerbates mitochondrial dysfunction in parkinson's disease: a multi-omics and mechanistic study
Xinyu Wang, Dan Wang, Caiyun Zhang, Hongmei Zhang, Wenhui Wang, Wenxian Qian, Jin Zhou, Yunli Zhao, Jinghan Gao, Zheng Hu, Jiamin Qin, Zhizhong Wang, Yishan Zheng, Guoping Yin, Hui Dong
TL;DR
This study shows that miR-214-3p worsens mitochondrial problems in Parkinson's disease, especially in dopaminergic cells by targeting GFM1.
Contribution
The study identifies miR-214-3p's role in mitochondrial dysfunction and reveals a cell-type specific mechanism involving GFM1 in Parkinson's disease.
Findings
miR-214-3p upregulation reduces GFM1, leading to mitochondrial bioenergetic impairment in dopaminergic cells.
Restoring GFM1 reverses mitochondrial deficits and neuronal dysfunction caused by miR-214-3p.
miR-214-3p impairs respiratory chain complexes in mouse neurons independently of GFM1.
Abstract
Parkinson’s disease (PD) involves the loss of dopaminergic neurons, and prodromal PD exhibits elevated miR-214-3p, suggesting its role as a biomarker and pathogenic factor. This study investigated miR-214-3p’s effects on mitochondrial function in dopaminergic SH-SY5Y cells and mouse primary cortical neurons. In SH-SY5Y cells, proteomic/transcriptomic analyses and target prediction confirmed GFM1 as a direct target of miR-214-3p. miR-214-3p upregulation downregulated GFM1, causing severe mitochondrial bioenergetic impairment: increased reactive oxygen species (ROS), reduced oxygen consumption, diminished ATP production, and decreased respiratory chain complexes (RCC) I/IV expression. Critically, restoring GFM1 reversed these mitochondrial deficits and neuronal dysfunction. In mouse primary cortical neurons, miR-214-3p overexpression also impaired RCC I/IV but did not affect GFM1,…
Genes, proteins, chemicals, diseases, species, mutations and cell lines named across the full text — each resolved to its canonical identifier and authoritative record.
Click any figure to enlarge with its caption.
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5- —Nanjing Overseas Students Science and Technology Innovation Project Funding Category C
- —Nanjing Health Science and Technology Development Project
- —Leading Talent Project of Jiangsu Province Traditional Chinese Medicine
- —Nanjing Health Science and Technology Development Special Fund Project
- —General Program of the Jiangsu Commission of Health
- —Nanjing Health Science and Technology Development General Project
- —Project of Nanjing Infectious Disease Clinical Medical Center Construction
- —Talent Lift Project of Nanjing Second Hospital
- —the Natural Science Foundation Project of Nanjing University of Chinese Medicine
Peer Reviews
No public reviews on file for this paper yet. If you reviewed it on a platform where reviews are public (OpenReview, ICLR, NeurIPS, ICML), you can paste yours below so the community can read it here.
Videos
No videos yet. Explain this paper in a talk, walkthrough, or lecture? Add one.
Taxonomy
TopicsParkinson's Disease Mechanisms and Treatments · Amyotrophic Lateral Sclerosis Research · Nuclear Receptors and Signaling
Introduction
The global population aged 65 years or older is projected to experience sustained growth in the coming decades, concomitant with a rising prevalence of age-correlated neurodegenerative diseases. Parkinson's disease (PD) has become a significant global health concern, ranking as the second most common neurodegenerative disorder worldwide. Epidemiological projections estimate the PD patient population will escalate to 12–17 million by 2040, reflecting a 150% increase from 2015 levels. While current dopamine replacement therapies provide symptomatic relief, they fail to address the underlying neurodegeneration, leading to inevitable progression toward severe disability characterized by postural instability, rigidity, and loss of autonomy (Xicoy et al. 2019).
A significant challenge in PD management is the delay in diagnosis, which is typically diagnosed upon motor symptom onset, which occurs after approximately 60–80% of dopaminergic neurons degenerate in the substantia nigra pars compacta (Braak et al. 2003; Titze-de-Almeida et al. 2021). This diagnostic latency underscores the imperative for developing biomarkers capable of detecting neurodegeneration during the premotor phase. Emerging evidence identifies microRNAs (miRNAs) as promising molecular signatures (Li et al. 2021a).
Through comprehensive translational investigations, we have elucidated the critical regulatory implication of miR-214-3p in the pathogenic mechanisms underlying PD. Cross-sectional analysis of serum samples revealed a distinctive expression pattern: miR-214-3p was significantly overexpressed in prodromal PD subjects, contrasting with downregulated expression in advanced-stage patients (Li et al. 2021a). This biphasic expression profile was recapitulated across experimental models (Zhou et al. 2020). Functional studies demonstrated that miR-214-3p overexpression exacerbates dopaminergic neuron loss through autophagy dysregulation, while its inhibition conferred neuroprotection in vitro (Dong et al. 2024).
To elucidate the mechanistic basis, we established stable miR-214-3p gain/loss-of-function models using lentiviral transfection in SH-SY5Y dopaminergic cells. Bioinformatics prediction identified G Elongation Factor Mitochondrial 1 (GFM1) as a direct target, with miR-214-3p binding to 3'UTR. Subsequent proteomic analysis confirmed a reduction in GFM1 expression upon miR-214-3p overexpression, impairing mitochondrial translation efficiency as evidenced by a decrease in nascent mitochondrial protein synthesis. This implies that miR-214-3p may be a promising candidate for early disease detection and as an intervention target to enhance mitochondrial adaptive capacity in PD progression.
Materials and methods
Proteomics
For data-independent acquisition (DIA) proteomics detection, we utilized lentivirus to either overexpress (n = 3) or inhibit miR-214-3p (n = 3) in SH-SY5Y cells, while the control group (n = 3) involved mutating the stem ring sequence (Shanghai Media Biological Technology Co., Ltd.). Following the calculation of the P value, multiple hypothesis tests and corrections were conducted. To meet the screening criteria, candidates were required to have an adj-P (Q value) < 0.05, along with a log_2_FC > 1 or < -1. The differentially expressed proteins (DEPs) were visualized using heatmaps and volcano plots, and the differences in protein expression were analyzed against the DAVID database (https://david.ncifcrf.gov/). GO and KEGG enrichment analyses were performed by accessing the DAVID database, with results visualized via "ggplot2". Fisher's exact two-tailed test was performed, with P < 0.05 regarded as significant. The DAVID database was used to predict the networks of these DEPs. Protein–protein interaction (PPI) networks of DEPs were developed via Cytoscape v3.6.1.17a, and key subnetworks were identified via the MCODE plugin: MCODE score > 5, node cutoff = 0.2, degree cutoff = 2, max depth = 100, and k-score = 2.
Transcriptomics
Stably transfected SH-SY5Y cells overexpressing (n = 5), inhibiting miR-214-3p (n = 5), or harboring a control vector with a mutated stem-loop sequence (n = 5) were submitted to Ouyi Co., Ltd. for DIA transcriptomics. Differentially expressed genes (DEGs) were identified by selecting genes downregulated in the miR-214-3p overexpression group unlike the control. In transcriptomic analyses, adj-P < 0.05 indicated significance. GO and KEGG analyses were performed using the DAVID database, with visualization achieved via the "ggplot2". Fisher's exact two-tailed test (P < 0.05) was applied for significance testing. The PPI networks of DEGs were developed in the same line as outlined in Sect. "Proteomics".
Selection of key genes
The TargetScan (https://www.targetscan.org/) was accessed to predict the miR-214-3p target genes. For proteomics analysis, key proteins associated with the selection of key intersecting genes were selected, and the key proteins associated with the regulation of mitochondrial dysfunction by miR-214-3p were obtained.
Concentration and packaging of lentivirus
Lentiviral vector plasmids (LV3[H1/GFP&Puro]-shNC, LV3[H1/GFP&Puro]-hsa-miR-214-3p inhibitor, and LV3[H1/GFP&Puro]-hsa-miR-214-3p mimics) were designed and produced by Shanghai GenePharma Pharmaceutical Technology Co., Ltd. HEK-293 T cells were seeded in six-well plates and incubated at 37 °C with 5% CO₂ for 24 h. Lentivirus particles were generated via transient co-transfection of the recombinant vectors with packaging plasmids psPAX2 and pMD2.G into HEK-293 T cells. After 72 h, the culture medium was replaced with fresh medium supplemented with puromycin and penicillin–streptomycin, followed by an additional 24-h incubation (37 °C, 5% CO₂). Lentiviral supernatant was harvested from the cells, and fluorescence density was monitored at 24, 48, and 72 h post-transfection. Supernatants with fluorescence density exceeding 80% were collected using a 10 mL sterile syringe, filtered with a 0.45 µm syringe filter, and aliquoted into sterile centrifuge tubes for storage.
Lentivirus concentration: After 48 and 72 h of transfection, the viral supernatants were extracted and concentrated for 2 h at 40,000 × g using ultracentrifugation.
Cell viability test
After seeding the cells into 96-well plates (2 × 10^4^ cells/well) for 24 h, the solution was changed, and 1.5 mM MPP^+^ solution was added. Following a 48-h incubation, cell viability was assessed by introducing 10 µL/well of CCK-8 reagent, followed by incubation (37 °C in a 5% CO₂), and measuring absorbance at 450 nm to quantify viability.
Western blot (WB)
Cells were lysed in RIPA buffer that contained PMSF (Biyuntian), incubated on ice for 20 min, thereby centrifuging the lysates (14,000 × g, 4 °C, 3 min), and collecting the supernatant for WB. Protein concentrations were quantified with a BCA assay kit (Yadase), and samples (8 µg protein/lane) were resolved via 12% SDS-PAGE under reducing conditions and transferred to membranes blocked in 5% skim milk for 80 min at room temperature. This was followed by overnight incubation with a rabbit anti-GFM1 polyclonal antibody (Proteintech) at 4 °C, then with a secondary polyclonal goat anti-rabbit IgG (ABclonal) for an additional period. Using an ultrasensitive automatic imaging analyzer (ProteinSimple), the protein bands were identified and subjected to ImageJ software analysis. Protein expression was normalized to that of β-tubulin.
RT-qPCR assay
Total RNA isolation was performed using an RNA extraction kit (Beibei Biotechnology Co., Ltd.). Reverse transcription of miR-214-3p was executed with a miRNA 1st Strand cDNA Synthesis Kit (Vazyme) per the protocols. RT-qPCR was conducted on an ABI Prism 7500 Sequence Detection System (Thermo Fisher) using a SYBR Green qPCR Kit (Vazyme). Thermocycling conditions were: 95 °C for 30 s (initial denaturation), 40 cycles of 95 °C for 10 s (denaturation), and 60 °C for 30 s (annealing). U6 small nuclear RNA served as the internal reference for miR-214-3p normalization. Primer sequences (synthesized by Sangon Biotech Co., Ltd.) were:
miR-214-3p:
Stem-loop primer: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACTGCC,
F: 5'-GCACAGCAGGCACAGACA-3',
R: 5'-GTGCAGGGTCCGAGGT-3';
U6:
F: 5'-CTCGCTTCGGCAGCACA-3',
R: 5'-AACGCTTCACGAATTTGCGT-3'.
All reactions were carried out in triplicate, and relative miR-214-3p expression was calculated using the 2^⁻ΔΔCt^ method.
Cellular ROS detection
Cells were cultured in 24-well plates (1 × 10^5^ cells/well), followed by adding 200 µL/well of the DHE red fluorescent working solution diluted in PBS and incubated (37 °C, 30–40 min). After removing the staining solution, the samples were incubated twice with 1 × PBS, at which point the samples were examined under a microscope. The emission wavelength was established at 570 nm.
Measurement of oxygen consumption (OC)
SH-SY5Y stable-mutant strains with overexpression/inhibition of miR-214-3p were collected, and a cell OC assay kit (Tonnie Chemistry) was used for the cell OC assay. The treated samples were placed into a temperature-controlled fluorescent enzyme-labeling instrument for detection. The continuous reading mode of the enzyme labeler was used for detection every 10 min for 200 min (Ex: 500 nm, Em: 650 nm, bottom reading mode). The OC rate (OCR) value was calculated by entering the fluorescence intensity using the automatic calculation table of the Tongren Institute of Chemistry. All experiments were performed three times.
ATP measurement
Following the protocols, ATP content was ascertained using an ATP Content Assay Kit (Solarbio, Beijing, China). Before the experiment began, cells were seeded (3 × 10^3^ cells/well) in 96-well plates. Following treatment, the cells were ultrasonically disrupted at 800 × g for 10 min at 4 °C, thereby gathering the supernatant for further analysis. Creatine kinase facilitates the conversion of creatine and ATP into phosphocreatine. To measure ATP levels, the amount of phosphocreatine was quantified using the phosphomolybdic acid colorimetric method at 340 nm. The absorbance at this wavelength was recorded with a microplate reader (Thermo Scientific, Waltham, MA, USA). Total ATP levels were quantified as nmol/mg protein. Protein concentrations in the supernatant used for ATP assays were assessed with a BCA protein assay kit (Solarbio).
Mouse primary cerebral cortical neuron culture and treatment
Primary cerebral cortical neurons were isolated from C57BL/6 mouse pups (postnatal day 0–1) as previously described (Kriks et al. 2011). Briefly, tissues were dissociated enzymatically and mechanically. Neurons were plated on poly-D-lysine-coated plates and maintained in Neurobasal medium supplemented with B-27, GlutaMAX, and penicillin–streptomycin. After 10 days in vitro (DIV10), neurons were infected with lentivirus carrying miR-214-3p mimics or negative control (NC) with a viral titer of 2 × 10^7^pfu/mL. The culture medium was replaced 24 h post-infection, and cells were harvested for subsequent analyses 72 h after infection.
Measurement of mitochondrial respiratory chain complex (RCC) I and IV activities
The activities of mitochondrial RCC I (NADH dehydrogenase) and RCC IV (Cytochrome c oxidase) in mouse primary neurons were measured using specific assay kits (Jianglai Biotechnology, JL-T1241 and JL-T1235, respectively) according to the manufacturer's instructions. Briefly, cells were homogenized, and the enzymatic activities were determined spectrophotometrically by monitoring the oxidation of NADH for Complex I or the oxidation of reduced cytochrome c for Complex IV. Activities were normalized to the total protein concentration determined by BCA assay.
Statistical analysis
All experiments were performed in triplicate, reporting data as mean ± SEM. WB and immunofluorescence data were analyzed and quantified using ImageJ software. Statistical analyses were performed using GraphPad Prism 8.0 (GraphPad Software, Inc.). Comparisons between two groups were conducted through unpaired Student's t-tests, setting statistical significance as follows: *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001.
Results
Generation and validation of miR-214-3p stable strains and proteomic profiling
A three-plasmid system was utilized to transfect 293 T cells, achieving transfection efficiencies exceeding 90% for miR-214-3p mimics, NC, and inhibitor constructs. High transfection efficiency and successful lentivirus packaging were confirmed. Stable miR-214-3p-overexpressing and -inhibited SH-SY5Y strains were validated via qPCR, demonstrating significant upregulation (mimics group) and downregulation (inhibitor group) of miR-214-3p compared to controls (Fig. 1A).Fig. 1. Generation and Validation of Stable miR-214-3p-Modified SH-SY5Y Cells and Associated DEP A miR-214-3p expression validation: qPCR analysis confirming stable miR-214-3p overexpression/inhibition in SH-SY5Y cells. B Heatmap of DEPs: Hierarchical clustering of DEPs (red: upregulated; blue: downregulated) following miR-214-3p modulation. C Volcano plot (Overexpression): DEPs with logFC > 1 and p < 0.05 (red: upregulated; blue: downregulated) upon miR-214-3p overexpression. D Volcano plot (Inhibition): DEPs with logFC > 1 and p < 0.05 (red: upregulated; blue: downregulated) following miR-214-3p inhibition
Proteomic analysis of these stable strains identified DEPs through heatmaps and volcano plots (Figs. 1B–D). In the miR-214-3p-overexpression group, 221 proteins were downregulated and 72 upregulated. Conversely, miR-214-3p inhibition resulted in 128 downregulated and 119 upregulated proteins. These findings establish a robust model for investigating miR-214-3p-mediated regulatory networks.
Differential protein enrichment analysis
Biological process (BP), molecular function (MF), and cell component (CC) analyses of the proteomic results were performed. In the miR-214-3p overexpression group, the BPs that were enriched included mitochondrial translation, cell division, proteasome-mediated ubiquitin-dependent protein catabolism, negative regulation of apoptosis, and chromatin organization. The enriched CCs were mitochondrial large ribosomal subunits, mitochondria, cytoplasm, nucleoplasm, nucleus, mitochondrial matrix, centrosome, mitochondrial intima, intracellular binding organelles, nucleosomes, cytoplasmic perikaryotic regions, macromolecular complexes, cytoplasmic vesicles, and exosomes. Enriched MFs included protein binding, transcription suppressors of ATP binding, small G protease binding, tubulin binding, same protein binding, and chromatin binding (Supplementary Figs. 1–3). The enriched pathways included metabolic pathways, amyotrophic lateral sclerosis, Alzheimer's disease, and PD. This implies that miR-214-3p overexpression exerts a strong effect on mitochondrial composition and function and affects ubiquitin proteins, ATP binding, and chromatin, among others. Some of these differential proteins are related to neurodegenerative diseases: PD, amyotrophic lateral sclerosis, and Alzheimer's disease. These differential proteins are primarily mitochondrial ribosomal subunits and proteasome subunits (Fig. 2A). In the miR-214-3p inhibition group, the enriched BPs were positive transcriptional regulation of the RNA polymerase II promoter and positive transcriptional control of DNA templating. In contrast, the enriched cellular components were early endosomes, cytoplasm, cellular exosomes, mitochondrial matrix, mitochondria, adhesive plaques, and cell membranes. Similar protein binding, metal ion binding and protein binding were the enriched MFs. The enriched pathways included the innate immune system and neutrophil degranulation. Collectively, miR-214-3p inhibition significantly affects mitochondrial composition and function, as well as transcription and translation (Fig. 2B).Fig. 2. Integrated Analysis of Differential Enrichment in Proteins and Genes A–B. Bubble diagram: Functional (BP, MF, CC) and pathway enrichment analyses for DEPs upon miR-214-3p overexpression or inhibition. Significant terms (p < 0.05) with ≥ 10 proteins are shown, where bubble size reflects protein count and shapes denote categories. C PPI network constructed via STRING (score > 0.4) and Cytoscape, comprising 352 nodes and 788 edges. D MCODE analysis identified 19 key proteins using thresholds: score > 5, node cutoff = 0.2, degree cutoff = 2. E Bubble plot summarizes enrichment analyses for DEGs post-miR-214-3p overexpression, filtered at p < 0.05 and ≥ 10 genes. F–G PPI network for DEGs (181 nodes, 214 edges) from STRING/Cytoscape, with MCODE highlighting 9 key genes. H TargetScan-predicted miR-214-3p targets intersected with transcriptomic/proteomic data identified GFM1, a critical regulator of mitochondrial dysfunction
A PPI network with 352 nodes and 788 edges was constructed (the screening criterion was a network interaction score greater than 0.4). Protein interaction data were obtained using the STRING online database for the DEPs in the miR-214-3p overexpression group (Fig. 2C). Nodes represent proteins; edges represent the links between proteins, and the radius of the protein nodes reflects the strength of protein interaction. The number of proteins used by the MCODE plugin to identify key proteins included KIF14, GFM1, MRPL13/21/23/33/38/40, INCENP, GTSE1, SPAG5, NUSAP1, ZWINT, PCLAF, NDC80, MTERF4, HELLS, KNSTRN, and CDCA8 (Fig. 2D). Mitochondrial translation, mitosis, and the cell cycle are all functions of these proteins. Altogether, miR-214-3p upregulation might have a major impact on mitochondria activity and cell proliferation.
Differential gene enrichment analysis
The DEG functions and pathway enrichment of the transcriptomics results were studied using the DAVID 6.8 by performing BP, MF, and CC analyses, as well as pathway analyses. The enriched BP terms after overexpression of miR-214-3p included mitochondrial translation, protein deubiquitination, cell division, protein polyubiquitination, and DNA repair, while the enriched CC terms were mitochondrial large ribosomal subunits, mitochondria, cytoplasm, nucleoplasm, centrosome, mitochondrial matrix, mitochondrial inner membrane, nucleosome, nucleus, inner membrane binding organelles, intermediates, and macromolecular complexes. The enriched MF terms were protein binding and protein C-terminal binding, and pathways were associated with transcriptional inhibitory factor activity and DNA binding (Supplementary Figs. 4–6); enriched pathways included spinocerebellar ataxia, prion disease, and Alzheimer's disease. Collectively, miR-214-3p overexpression may have significant effects on mitochondrial composition and function, protein ubiquitination, and gene binding processes through transcription. Some of the DEGs are mostly related to mitochondrial ribosomal subunits and mitochondrial matrix (Fig. 2E), with some related to neurodegenerative diseases: spinocerebellar ataxia and Alzheimer's disease.
A PPI network with 181 nodes and 214 edges was established for the downregulated DEGs in the miR-214-3p overexpression group using transcriptomic analysis via the STRING online database (the screening criterion was that the network interaction score was greater than 0.4) (Fig. 2F). Genes are depicted as nodes, while representing the connections between them as edges, with the strength of gene interactions indicated by the size of the nodes. Key genes were determined using the MCODE plugin. Among the nine genes involved in mitochondrial translation were MRPL13/21/28/33/38/40, HMGN1, GFM1, and MRPS30 (Fig. 2G). Altogether, miR-214-3p overexpression may have a substantial effect on mitochondrial function.
TargetScan was employed to predict miR-214-3p target genes, which were subsequently cross-referenced with proteomic and transcriptomic datasets to identify overlapping candidates. Bioinformatics integration of these three datasets (predicted targets, proteomics, transcriptomics) revealed GFM1 as a critical miR-214-3p downstream effector, strongly associated with mitochondrial dysfunction (Fig. 2H).
GFM1 mediates miR-214-3p-induced mitochondrial dysfunction and cytotoxicity
The WB results confirmed an inverse relationship between miR-214-3p and GFM1 protein levels in stable SH-SY5Y strains. GFM1 expression was significantly reduced upon overexpressing miR-214-3p and elevated following knocking down miR-214-3p (Figs. 3A–B), validating GFM1 as a miR-214-3p target.Fig. 3miR-214-3p Modulates GFM1 Expression, Dopaminergic Neuronal Activity, and Mitochondrial Dysfunction in SH-SY5Y Cells A WB: GFM1 protein levels in SH-SY5Y cells stably overexpressing/inhibiting miR-214-3p. B Quantification of relative GFM1 protein expression normalized to controls. C–D. Cell viability assessment via CCK-8 assay in miR-214-3p-overexpressing/inhibited MPP^+^-treated cells at 24 and 48 h. E ROS generation, F Cellular OCR, G ATP content, and H–I. Human mitochondrial RCCs I/IV in SH-SY5Y stable transplants transfected with overexpressed/inhibited miR-214-3p
Treatment with miR-214-3p revealed time-dependent cytotoxic effects. At 24 h, miR-214-3p-overexpressing cells exhibited significantly reduced viability, whereas miR-214-3p-inhibited cells showed enhanced viability (Fig. 3C). By 48 h, viability continued to decline in the overexpression group but increased further in the inhibition group (Fig. 3D), implicating miR-214-3p in dopamine neuron damage.
Reactive oxygen species (ROS) levels, mitochondrial OCR, ATP content, and mitochondrial complex expression were assessed to evaluate mitochondrial function. miR-214-3p overexpression significantly elevated ROS production (Fig. 3E), reduced OCR (Fig. 3F), decreased ATP levels (Fig. 3G), and downregulated mitochondrial RCCs I/IV (Figs. 3H–I). Conversely, miR-214-3p inhibition mildly reversed these effects. These data demonstrate that miR-214-3p overexpression disrupts mitochondrial oxidative phosphorylation, leading to energy deficiency and oxidative stress.
GFM1 overexpression rescues miR-214-3p-induced mitochondrial dysfunction
SH-SY5Y cells transfected with a GFM1 overexpression plasmid exhibited significantly elevated GFM1 protein levels compared to empty vector controls, as confirmed by Western blot (Figs. 4A–B), demonstrating successful GFM1 upregulation.Fig. 4GFM1 Overexpression Reverses miR-214-3p-Mediated Suppression of Dopaminergic Neuronal Activity and Mitochondrial Function A. WB: GFM1 protein levels in transfected SH-SY5Y cells. B Relative GFM1 protein expression. C–D. CCK8 assays: Cell viability at 24 and 48 h post-GFM1 overexpression. E ROS generation in SH-SY5Y-transfected cells with miR-214-3p and GFM1 overexpression. F OCR in miR-214-3p-overexpressing cells transfected with GFM1 or NC plasmid. G ATP content in miR-214-3p-overexpressing cells with or without GFM1 overexpression. H–I ELISA: Mitochondrial RCCs I/IV protein levels in cells co-overexpressing miR-214-3p and GFM1
Unlike control plasmid-transfected cells, in miR-214-3p-overexpressing cells treated with 1.5 mM MPP^+^, GFM1 co-overexpression significantly restored cell viability at 24 and 48 h (Figs. 4C–D). This reversal of cytotoxicity suggests that GFM1 mitigates miR-214-3p-mediated damage to dopamine neurons.
Mitochondrial function was assessed by measuring ROS, OCR, ATP content, and mitochondrial respiratory chain complex (RCC) expression. GFM1 overexpression in miR-214-3p-overexpressing cells reduced ROS production (Fig. 4E), increased OCR (Fig. 4F), elevated ATP levels (Fig. 4G), and restored mitochondrial RCCs I/IV expression (Figs. 4H–I). These findings indicate that GFM1 overexpression counteracts miR-214-3p-induced mitochondrial dysfunction by enhancing oxidative phosphorylation efficiency and reducing oxidative stress.
Validation in mouse primary cerebral cortical neurons reveals a context-dependent regulatory axis
To further validate our findings in a more physiologically relevant model, we employed mouse primary cerebral cortical neurons (Supplementary Fig. 7). Consistent with our results in SH-SY5Y dopaminergic cells, lentivirus-mediated overexpression of miR-214-3p in primary cortical neurons led to a significant decrease in the activities of mitochondrial RCC I and IV (Figs. 5D-E), reinforcing the conserved detrimental impact of miR-214-3p on mitochondrial oxidative phosphorylation across different neuronal cell models. However, intriguingly, Western blot analysis revealed an unexpected increase in GFM1 protein levels in the miR-214-3p overexpression group compared to the NC group (Figs. 5A-C). This finding stands in stark contrast to the downregulation of GFM1 observed in the SH-SY5Y dopaminergic cell model, demonstrating that the regulatory effect of miR-214-3p on GFM1 expression is strictly cell type-dependent, and the miR-214-3p → GFM1 repression axis identified in SH-SY5Y cells is not recapitulated in mouse primary cerebral cortical neurons. This cell type-specific regulatory pattern suggests the presence of distinct compensatory mechanisms or differential miRNA-mediated regulatory networks in primary cortical neurons that are absent in the SH-SY5Y dopaminergic cell line.Fig. 5. Effects of miR-214-3p overexpression on related indicators. A Overexpression efficiency of miR-214-3p mediated by lentivirus, as detected by qPCR. B Representative Western blot images showing GFM1 protein expression, with GAPDH as the loading control. C Quantitative statistical analysis of relative GFM1 protein expression. D Enzymatic activity of mitochondrial respiratory chain complex I. E Enzymatic activity of mitochondrial respiratory chain complex IV. Data are presented as mean ± SD; *p < 0.05, ***p < 0.001 vs. NC group
Discussion
Building on prior findings, our previous work demonstrated that miR-214-3p suppresses autophagy, a critical cellular degradation pathway, thereby compromising the functional integrity of dopaminergic neurons in PD. This autophagy inhibition exacerbates neuronal vulnerability, aligning with the current study's focus on miR-214-3p-mediated mitochondrial dysfunction. Nonetheless, oxidative stress, inflammation, mitochondrial malfunction, apoptosis, and autophagy are only a few of the many variables that affect the degeneration of dopaminergic neurons. All of PD's progression is largely dependent upon these factors (Hald and Lotharius 2005; Dias et al. 2013).
In this study, our proteomic and transcriptomic analyses revealed that miR-214-3p overexpression caused significant alterations in mitochondrial structure and function. Additionally, our enrichment analysis revealed a reduction in the expression of proteins linked to mitochondrial ribosomal large subunits, the mitochondrial matrix, and the mitochondrial membrane. This decline led to significant disturbances in mitochondrial translation processes. Furthermore, our PPI network analysis of the combined proteomic and transcriptomic data highlighted several key proteins, including MRPL13/21/33/38/40 and GFM1. Among these, MRPS30 and MRPL28 emerged as particularly interactive genes linked to mitochondrial functions, whereas the other proteins were categorized as mitochondrial ribosomal proteins.
Mitochondrial proteins are produced from mitochondrial (mtDNA) and nuclear DNA. Dysfunction in the proteins regulating mitochondrial activities, particularly those involved in dynamics, respiration, metabolism, autophagy, and protein import, can result in mitochondrial dysfunction. Mitochondrial dysfunction-related diseases include cardiovascular diseases (Kumar et al. 2019; Nunes et al. 2021), cancer (Wang et al. 2017), age-related metabolic diseases (Natarajan et al. 2020; Harrington et al. 2023), neurological disorders (Wang et al. 2022), and insulin-resistant type 2 diabetes (Gomes et al. 2022). GFM1 is essential for tRNA translocation and plays a critical role in mitochondrial translation during the elongation phase. Mitochondria employ distinct mechanisms for protein synthesis. A reduction in the expression of genes encoding mitochondrial elongation factors can lead to significant problems with mitochondrial translation. Mitochondria are central to ATP production through oxidative phosphorylation (OXPHOS), which is dependent on five multi-subunit enzyme complexes (I–V). Notably, complexes I, III, IV, and V contain mtDNA-encoded subunits. Dysfunction in mitochondrial elongation factors—critical for mtDNA translation—can impair these OXPHOS complexes' assembly or stability, thereby disrupting mitochondrial energy metabolism and triggering cellular dysfunction. This mechanism underscores the interdependence of mtDNA expression, OXPHOS efficiency, and mitochondrial homeostasis (Wallace 2013; Boczonadi and Horvath 2014).
Typically, miRNAs are short, conserved noncoding RNAs, 22 nucleotides in length, that regulate gene expression post-transcriptionally by binding to complementary sites within target mRNAs, thereby mediating mRNA degradation or translational repression (O'Brien et al. 2018). Specific miRNAs, including miR-210 (Chen et al. 2010), miR-338 (Aschrafi et al. 2008), and miR-34a (Sarkar et al. 2016), have been found to suppress enzymes that are crucial for OXPHOS. Neurons mainly produce ATP through OXPHOS. Disruptions in this pathway can greatly affect the energy supply needed for neuronal function, potentially leading to neuronal apoptosis. Additionally, miR-16-5p (Kim et al. 2020), and miR-195 (Zhang et al. 2016) have been linked to the disruption of the integrity and potential of the mitochondrial membrane. The OXPHOS system is made up of complexes I through IV, which collaborate to generate a proton gradient across the inner mitochondrial membrane. Increased oxidative stress, mainly caused by ROS, significantly contributes to the degradation of dopaminergic neurons (Hattori et al. 1991; Schapira 1993). In the SH-SY5Y dopaminergic cell model used in this study, overexpressed miR-214-3p heightened ROS production, decreased OC, lower ATP levels, as well as the downregulation of the RCCs I/IV in the mitochondria, which causes mitochondrial malfunction. Importantly, the overexpression of GFM1 appears to counteract this mitochondrial impairment and the reduced dopaminergic neuronal activity caused by miR-214-3p in this cell model. This intervention not only decreases ROS production but also restores cellular OCRs and ATP levels alongside an upregulation of mitochondrial RCCs I/IV. Altogether, in SH-SY5Y dopaminergic cells, miR-214-3p targets and silences GFM1, and increasing GFM1 protein levels may help restore the function of mitochondria and dopaminergic neurons in this cell type. This suggests that miR-214-3p may inhibit mitochondrial activity by silencing GFM1 in dopaminergic cells, thereby decreasing the function of dopaminergic neurons. These data offer new cell type-specific treatment approaches to the management of PD, with the miR-214-3p/GFM1 axis representing a potential therapeutic target for dopaminergic neuron damage in PD.
Our study incorporated an important validation step using mouse primary cerebral cortical neurons to assess the conservation of miR-214-3p-mediated mitochondrial dysfunction. A critical conserved finding across both the SH-SY5Y dopaminergic cell line and mouse primary cerebral cortical neuron models was the impairment of mitochondrial RCC I and IV activities upon miR-214-3p overexpression, which confirms that miR-214-3p-induced mitochondrial oxidative phosphorylation dysfunction is a universal effect in neuronal cells and represents a core pathogenic mechanism of miR-214-3p in PD-related neuronal damage. However, the regulatory relationship between miR-214-3p and GFM1 was found to be markedly cell type-dependent: in SH-SY5Y dopaminergic cells, miR-214-3p directly targets and silences GFM1 to mediate mitochondrial dysfunction, while in mouse primary cerebral cortical neurons, miR-214-3p overexpression does not suppress GFM1 expression and instead leads to a compensatory upregulation of GFM1 protein levels. This discrepancy invalidates a universal miR-214-3p → GFM1 repression axis and highlights that the GFM1-mediated regulatory pathway is specific to the SH-SY5Y dopaminergic cell model.
It is plausible that in response to the initial miR-214-3p-induced stress and mitochondrial dysfunction, primary cortical neurons activate an endogenous feedback mechanism that upregulates GFM1 in an attempt to restore mitochondrial translation and function. This compensatory upregulation, however, appears insufficient to fully counteract the severe functional deficits in the respiratory chain complexes, as evidenced by the decreased activities of RCC I and IV. This observation underscores the necessity of validating mechanistic findings in multiple model systems to fully understand the pathophysiological relevance and cell type-specificity of regulatory pathways, and also indicates that miR-214-3p may regulate mitochondrial function through multiple distinct pathways in different neuronal cell types, with the GFM1-dependent pathway being one of the key mechanisms in dopaminergic cells.
The pathophysiological role of miR-214-3p appears to be stage-specific within the PD continuum. Crucially, cross-sectional clinical evidence has revealed a biphasic expression pattern of miR-214-3p: it is significantly upregulated in the prodromal phase (pPD) of the disease, while trending towards downregulation in advanced stages (Li et al. 2021a; Dong et al. 2016). This dynamic profile suggests distinct context-dependent functions. The early upregulation in pPD, potentially serving as a compensatory response to initial cellular stress, positions miR-214-3p as a promising biomarker for early detection. However, miR-214-3p has been shown to exacerbate neuronal damage by inhibiting autophagy, for instance through targeting ATG3, thereby promoting dopaminergic neuron apoptosis (Dong et al. 2024). And the findings of the present study demonstrate that it can also significantly impair mitochondrial bioenergetics. So its sustained dysregulation may ultimately contribute to pathogenesis.
This biphasic mechanism—wherein early upregulation might initiate pathological processes like mitochondrial dysfunction, while late-stage alterations exacerbate autophagic failure and neuronal death—highlights the complex, "double-edged sword" nature of miR-214-3p in PD. Understanding this temporal specificity is paramount for developing stage-specific and cell type-specific therapeutic strategies, such as inhibiting miR-214-3p in the prodromal or early stages to prevent its detrimental effects on mitochondrial function in dopaminergic neurons via the GFM1-dependent pathway, as well as its autophagic inhibitory effects.
Furthermore, miR-214-3p may exacerbate dopaminergic neurodegeneration in Parkinson's disease (PD) by modulating inflammatory responses and mitophagy in a cell type-specific manner. Evidence suggests a pro-inflammatory role for miR-214-3p in various contexts: for instance, miR-214-3p regulates the EMT of renal tubular cells induced by TGF-1 by targeting PTEN and regulating the PI3K/AKT signalling pathway (Hou et al. 2022). Downregulation of miR-214-3p increased PTEN expression and reduced p-JNK and p–c-Jun levels, thereby inhibiting MC proliferation and ameliorating renal lesions in IgAN (Li et al. 2021b). In the context of PD, where neuroinflammation is a core pathological feature, chronic inflammation driven by activated microglia can accelerate oxidative stress and mitochondrial damage (Lawrence et al. 2022). The overexpression of miR-214-3p could, through such pro-inflammatory mechanisms, indirectly exacerbate mitochondrial dysfunction in dopaminergic cells, for example, by increasing reactive oxygen species (ROS) generation and reducing oxidative phosphorylation efficiency, which aligns with the mitochondrial bioenergetics deficits observed in the present study in SH-SY5Y cells.
Concurrently, mitophagy—a critical process for the selective autophagic clearance of damaged mitochondria—is often dysregulated in PD. Our current findings and previous work (Dong et al. 2024) demonstrate that miR-214-3p suppresses basal autophagy, potentially impairing the efficiency of mitophagy specifically. This impairment leads to the accumulation of damaged mitochondria and can trigger apoptotic signaling. This dual impact—whereby miR-214-3p both promotes a pro-inflammatory environment and obstructs mitochondrial quality control—likely creates a vicious cycle that accelerates dopaminergic neuron loss. Therefore, targeting miR-214-3p could not only alleviate mitochondrial defects but also offer a multi-target strategy for early PD intervention by modulating interconnected inflammatory and autophagic pathways.
In summary, this study demonstrates that miR-214-3p is a key regulator of neuronal mitochondrial function in PD, with miR-214-3p-induced mitochondrial RCC I/IV dysfunction being a conserved effect across neuronal cell models. The regulatory pathway by which miR-214-3p mediates mitochondrial dysfunction is cell type-dependent: in SH-SY5Y dopaminergic cells, miR-214-3p directly targets and downregulates GFM1 to impair mitochondrial bioenergetics, and restoration of GFM1 can rescue this mitochondrial dysfunction and dopaminergic neuronal damage; in mouse primary cerebral cortical neurons, miR-214-3p induces mitochondrial dysfunction through a GFM1-independent pathway, with GFM1 expression being upregulated as a compensatory response. These findings identify the miR-214-3p/GFM1 axis as a dopaminergic cell-specific therapeutic target for PD, and highlight the importance of considering cell type specificity in the development of miRNA-based therapeutic strategies for neurodegenerative diseases. miR-214-3p remains a promising early biomarker for PD, and targeting miR-214-3p in the prodromal stage may prevent dopaminergic neuron damage by preserving mitochondrial function via the GFM1-dependent pathway in these cells.
Supplementary Information
Below is the link to the electronic supplementary material.
Supplementary Material 1