Albiflorin Relieves Intervertebral Disc Degeneration Through Inhibiting Nucleus Pulposus Cell via the p38 MAPK/NF‐κB Pathway

TL;DR

Albiflorin, a compound from Paeonia lactiflora, may help treat intervertebral disc degeneration by reducing cell death and inflammation through a specific signaling pathway.

Contribution

This study is the first to demonstrate that albiflorin protects against intervertebral disc degeneration via the p38 MAPK/NF-κB pathway.

Findings

Albiflorin reduced cell death and improved cell survival in nucleus pulposus cells.

Albiflorin decreased inflammation and extracellular matrix degradation in disc cells.

Albiflorin's effects were mediated through suppression of the p38 MAPK/NF-κB pathway.

Abstract

As a chronic musculoskeletal disorder, intervertebral disc degeneration (IDD) is a leading cause of low back pain. Inflammatory response plays a key role in the IDD progression. Albiflorin (AF), a bioactive compound derived from Paeonia lactiflora, exhibits anti‐inflammatory effects in various diseases. However, the effects of AF on IDD remain unexplored. This study explored the protective effect of AF against IDD and elucidate its possible mechanisms.

Nucleus pulposus (NP) cells were stimulated with lipopolysaccharide (LPS
) for 24 h to establish the IDD cell model, followed by AF or p38MAPK agonist (P79350) treatment. Cell viability and apoptosis were evaluated using 5‐ethynyl‐2'‐deoxyuridine (EdU) assay and flow cytometry analysis, respectively. Levels of the Inflammatory cytokines (tumor necrosis factor alpha, TNF‐α; interleukin‐1beta, IL‐1β; IL‐6) were assessed by enzyme‐linked immunosorbent assay (ELISA). The mRNA levels of B‐cell lymphoma‐2 (Bcl‐2), Bcl‐2‐Associated X (Bax), aggrecan, and collagen type II was analyzed by reverse transcriptase‐quantitative polymerase chain reaction (RT‐qPCR), while their protein levels were determined by western blot assay.

LPS induction remarkably inhibited NP cell proliferation (p < 0.001) and induced apoptosis (p < 0.001), which were significantly reversed by AF dose‐dependently. Furthermore, AF treatment dose‐dependently decreased extracellular matrix (ECM) degradation and inflammatory factors secretion in LPS‐induced NP cells, evidenced by enhanced aggrecan and collagen type II protein expression (all p < 0.01), and reduced TNF‐α, IL‐1β, and IL‐6 section (all p < 0.05). Mechanistically, AF exerted its protective effects by suppressing the p38 mitogen‐activated protein kinase (MAPK)/nuclear factor κB (NF‐κB) signaling pathway, as evidenced by reduced phosphorylation of p38 and p65 (all p < 0.01). Notably, co‐treatment with P79350 partially abolished the protective effects of AF against LPS‐induced NP cell damage.

AF relieved IDD through repressing NP cell apoptosis, inflammatory response, and ECM degradation through the p38 MAPK/NF‐κB pathway, indicating that it is a potential IDD therapeutic agent.

Figures

Effects of AF and P79350 on the proliferation of LPS‐treated NP cells. LPS (10 ng/mL)‐induced NP cells were treated with AF (5, 10, and 20 μM) or 20 μM AF + 50 µM P79350. Cell proliferation was determined by EdU staining. n = 3. *p < 0.001 vs Control group; ##, #### p < 0.01, 0.0001 vs LPS group; && p < 0.01 vs LPS+albiflorin‐20 group; ns p > 0.05.

Effects of AF and P79350 on the apoptosis of LPS‐treated NP cells. LPS (10 ng/mL)‐induced NP cells were treated with AF (5, 10, and 20 μM) or 20 μM AF + 50 µM P79350. (A and B) Cell apoptosis was tested by flow cytometry analysis. (C,D) The protein expression of Bax and Bcl‐2 was determined via western blotting. (E) Bax and Bcl‐2 mRNA levels were measured by RT‐qPCR. n = 3. *, p < 0.001, 0.0001 vs Control group; #, ##, #### p < 0.05, 0.01, 0.0001 vs LPS group; & &, & & & & p < 0.01, 0.0001 vs LPS+albiflorin‐20 group.

Effects of AF and P79350 on inflammatory cytokine levels in LPS‐treated NP cells. LPS (10 ng/mL)‐induced NP cells were treated with AF (5, 10, and 20 μM) or 20 μM AF + 50 µM P79350. Levels of (A) TNF‐α, (B) IL‐1β, and (C) IL‐6 in the cell supernatant were determined by ELISA. n = 3. p < 0.0001 vs Control group; #, ##, ###, #### p < 0.05, 0.01, 0.001, 0.0001 vs LPS group; & & p < 0.01 vs LPS+albiflorin‐20 group; ns p > 0.05.

Effects of AF and P79350 on ECM degradation in LPS‐treated NP cells. LPS (10 ng/mL)‐induced NP cells were treated with AF (5, 10, and 20 μM) or 20 μM AF + 50 µM P79350. (A–C) Expression levels of collagen II and aggrecan were examined by western blot assay. (D,E) Collagen II and aggrecan mRNA levels were detected by RT‐qPCR. n = 3. p < 0.0001 vs Control group; #, ##, ###, #### p < 0.05, 0.01, 0.001, 0.0001 vs LPS group; & & & & p < 0.0001 vs LPS+albiflorin‐20 group; ns p > 0.05.

Effects of AF and P79350 on p38 MAPK/NF‐κB signaling pathway in LPS‐treated NP cells. LPS (10 ng/mL)‐induced NP cells were treated with AF (5, 10, and 20 μM) or 20 μM AF + 50 µM P79350. (A) The protein expression of p‐p65, p65, p‐p38 and p38 was examined using western blotting. (B,C) Quantification of p‐p65/p65 and p‐p38/p38 ratios. n = 3. p < 0.0001 vs Control group; #### p < 0.0001 vs LPS group; & & & & p < 0.0001 vs LPS+albiflorin‐20 group.

Tables

Table 1. Primer sequences used in qRT‐PCR.

Gene	Forward primer (5′−3′)	Reversed primer (5′−3′)
H‐ACTIN	GTCCACCGCAAATGCTTCTA	TGCTGTCACCTTCACCGTTC
H‐Bax	TCTGAGCAGATCATGAAGACAGG	ATCCTCTGCAGCTCCATGTTAC
H‐Bcl‐2	AGGATTGTGGCCTTCTTTGAG	AGCCAGGAGAAATCAAACAGAG
H‐aggrecan	TGTCATATAAGGAATCCCATTAAAG	CAGTCCAAGGGTTATAATAAGTTTG
H‐collagen II	ATGCCACACTCAAGTCCCTCA	GTCTCGCCAGTCTCCATGTTG

Full text

Introduction

1

Lower back pain (LBP) is the leading cause of activity limitation in individuals under 45 years of age, with approximately 80% of adults experiencing LBP during their lifetime, resulting in substantial socioeconomic burdens [1]. Intervertebral disc degeneration (IDD), the main pathological basis of LBP, is closely related to nucleus pulposus (NP) dysfunction [2]. The intervertebral disc (IVD) consists of a central NP, a peripheral annulus fibrosus, and upper and lower cartilage endplates [3]. Several studies have demonstrated that an imbalance between anabolic and catabolic metabolism leads to disc degeneration, with characteristic pathological changes including increased pro‐inflammatory cytokines, extracellular matrix (ECM) degradation, reduced numbers of NP cells, and cellular senescence [4, 5]. Currently, the therapeutic options remain limited to symptomatic relief through pharmacological or surgical interventions, with no disease‐modifying treatments available [6]. In this context, rehabilitation interventions, including targeted exercise and physical therapy, play a crucial role in alleviating symptoms and improving functional outcomes in patients with disc degeneration, while early implementation of scientific rehabilitation strategies may delay the progression of disc degeneration and reduce the need for invasive treatments. Therefore, elucidating the underlying molecular mechanisms of IDD pathogenesis is critical for developing novel therapeutic strategies.

A growing number of reports have shown that the inflammatory response plays a crucial role in the progression of IDD [7]. The p38 MAPK and NF‐κB pathways are key regulators of inflammatory response [8, 9, 10, 11]. The activation of p38 MAPK phosphorylates downstream targets, leading to translocation of NF‐κB into the nucleus, which in turn up‐regulates pro‐inflammatory cytokines, such as IL‐1β, TNF‐α, and IL‐6 [8]. These inflammatory factors not only promote local inflammation but also facilitate ECM degradation by inhibiting collagen and proteoglycan synthesis while activating matrix‐degrading enzymes [9]. Hu et al. found that Gastrodin mitigates IDD through repressing inflammatory response and ECM degradation in NP cells by the inactivation of the NF‐κB and MAPK pathways [10]. Similarly, Li et al. suggested that engeletin reduces inflammation and apoptosis in IDD by suppressing the NF‐κB and MAPK pathways [11]. Therefore, targeting the p38 MAPK/NF‐κB pathway may represent a promising therapeutic strategy for IDD treatment.

Albiflorin (AF) is a major bioactive constituent in Radix Paeoniae Alba. Emerging evidence suggests that AF exerts potent anti‐inflammatory and antioxidant effects on a variety of human diseases, including neurodegenerative and cardiovascular diseases [12]. Wang et al. found that AF mitigated DSS‐induced murine colitis via suppressing NF‐κB and MAPK signaling pathways [13]. In addition, Fang et al found that AF inhibits inflammatory responses in SCI rats via the reduction of oxidative stress through the inactivation of the Nrf2/HO‐1 pathway [14]. Notably, AF exerts a chondroprotective effect by promoting chondrocyte proliferation and suppressing cartilage degradation in osteoarthritis [15]. Given the overlapping pathological mechanisms in cartilage degeneration and IDD, AF may similarly exert therapeutic effects on IDD. However, the role of AF in IDD remains unexplored.

The present study aims to investigate whether AF can protect NP cells from LPS‐induced damage and to explore the underlying molecular mechanisms, so as to provide new insights for IDD therapies.

Materials and Methods

2

Cell Culture and Treatment

2.1

Human NP cells were obtained from ATCC (Manassas, VA, USA) and grown in DMEM (PM150210B, procell), containing1% penicillin/streptomycin (FG101‐01, Transgen) at 37°C with 5% CO_2_. To establish the IDD cell model, NP cells were seeded in 6‐well plates (3 × 10^5^ cells/per well) and stimulated with LPS (10 ng/mL, JS11060, YanJin BioTechnology) for 24 h [16]. To investigate the effects of AF on IDD in vitro cell model, LPS‐treated NP cells were subjected to various concentrations of AF (5, 10, 20 μM) or 20 μM AF + 50 µM P79350 (a p38MAPK agonist) at 37°C for 24 h [17].

EdU Assay

2.2

EdU assay (G1601, Servicebio) was applied for cell proliferation determination. Briefly, NP cells were plated into 96‐well plates (2 × 10^3^ cells per well) and cultured for 24 h, followed by fixation with 4% paraformaldehyde (80096618, Sinopharm Chemical Reagent) for 20 min. Then, the cells were permeabilized with 0.5% Triton X‐100 (30188928, Sinopharm Chemical Reagent) and stained with EdU‐488 green fluorescent staining reaction solution to visualize proliferating cells. Nuclei were counterstained with Hoechst 33342 for 30 min. Fluorescence images were obtained with a confocal microscope (IX51, Olympus).

Cell Apoptosis Detection

2.3

The Annexin V‐FITC Apoptosis Detection kit (556547; BD) was used to analyze cell apoptosis according to the manufacturer's protocol. In brief, NP cells (1 × 10^6^ cells/well) were harvested, rinsed with PBS, and reconstituted in 100 μL of binding buffer. After being stained with 5 μL of Annexin V‐FITC and 5 μL PI buffer at room temperature under dark conditions, the NP cell apoptosis was assessed using a flow cytometer (CytoFLEX, Beckman). The data were analyzed by the FlowJo 10.8.1 software.

ELISA Assay

2.4

The levels of TNF‐α (ELK1190, ELK Biotechnology), IL‐6 (ELK1156, ELK Biotechnology), and IL‐1β (ELK1270, ELK Biotechnology) were determined by ELISA kits as per the manufacturer's manual. A microplate reader device (Cmaxplus, Molecular Devices) was used to detect the absorbance of 450 nm.

RT‐qPCR

2.5

The TRIpure Total RNA Extraction Reagent (EP013, ELK Biotechnology) was applied for the isolation of total RNA from the human NP cells in line with the manufacturer's protocol. Reverse transcription was applied with the EntiLink 1st Strand cDNA Synthesis Kit (EQ. 003, ELK Biotechnology). Subsequently, real‐time PCR was performed using the EnTurbo SYBR Green PCR SuperMix (EQ. 001, ELK Biotechnology) on a CG Real Time PCR system (QuantStudio 6 Flex, Life technologies). The mRNA expression data were analyzed by the 2^−∆∆Ct^ method. Table 1 showed the primers used for PCR.

Western Blot Assay

2.6

Total protein extraction was conducted by RIPA Lysis Buffer (AS1004, ASPEN). The BCA protein assay kit (AS1086, ASPEN) was employed to determine the protein concentrations. An equivalent concentration of protein was loaded onto SDS‐PAGE gels and transferred onto PVDF membranes (IPVH00010, Millipore), followed by blocking with 5% dry skimmed milk. Next, the membranes were treated with the specific primary antibody, including anti‐Bax (#2772, CST, 1:1000; Source: rabbit), Bcl‐2 (12789‐1‐AP, Proteintech, 1:2000; Source: rabbit), aggrecan (ab3778, abcam, 1:500; Source: mouse), Collagen Ⅱ (ab307674, abcam, 1:500; Source: rabbit), p‐p38 (#4511, CST, 1:500; Source: rabbit), p38 (AF6456, Affbiotech, 1:3000; Source: rabbit) p‐p65 (#3033, CST, 1:500; Source: rabbit), p65 (#8242, CST, 1:2000; Source: rabbit) and β‐Actin (TDY051, Tiande Yue, 1:10000; Source: rabbit) overnight at 4°C. Subsequently, the membranes were incubated with matching secondary antibody (AS1106/AS1107, ASPEN, 1:10000), and the protein bands were visualized using an ECL solution (AS1059, ASPEN).

Statistical Analysis

2.7

Data were given as means ± standard deviation (SD) and statistical analyses were performed using SPSS software (version 23.0, IBM, Armonk, NY, USA). Comparisons among multiple groups were analyzed by one‐way ANOVA followed by Tukey's test. Prior to ANOVA, the normality of data distribution was verified using the Shapiro‐Wilk test, and the homogeneity of variances was confirmed via Levene's test. Tukey's test was selected because it is optimal for pairwise comparisons between all groups with equal sample sizes, and it effectively controls the family‐wise error rate for multiple comparisons. Effect sizes (partial η ^2^) were interpreted as small (< 0.06), moderate (< 0.14), or large (≥ 0.14). All experiments were performed with three independent biological replicates. p‐value less than 0.05 was considered as statistical significance.

Results

3

P79350 Reversed the Effects of AF on the Proliferation and Apoptosis of LPS‐Induced NP Cells

3.1

Firstly, NP cells were induced by 10 ng/mL LPS for 24 h to construct an in vitro model of IDD. Compared with the control group, LPS significantly inhibited NP cell proliferation (Figure 1, p < 0.001, from 72.24 ± 5.49 to 26.57 ± 1.99) and induced NP cell apoptosis (Figure 2A,B, p < 0.0001, from 5.07 ± 1.50 to 40.08 ± 4.54) after 24 h of induction, indicating that the IDD model was successfully constructed. RT‐qPCR and western blotting revealed that LPS induction enhanced the expression of Bax and declined Bcl‐2 expression at both the protein and mRNA levels (Figure 2C–E). We further evaluated the effects of AF on LPS‐induced proliferation and apoptosis in NP cells, and found that AF promoted cell proliferation and inhibited apoptosis in a dose‐dependent manner in LPS‐stimulated NP cells. Through bioinformatics analysis, we determined that the signaling pathway through which AF acts in IDD may be the MAPK pathway (see Supporting materials for details). Thus, a p38MAPK agonist P79350, was used in this study. As expected, P79350 treatment significantly reversed the effects of AF on LPS‐stimulated NP cell proliferation (p = 0.0015, from 56.93 ± 6.26 to 36.97 ± 5.20) and apoptosis (p < 0.0001, from 12.84 ± 1.27 to 29.24 ± 2.81). Our findings demonstrated that AF enhanced proliferation and inhibited apoptosis in LPS‐induced NP cells by regulating p38 MAPK/NF‐κB pathway.

*Effects of AF and P79350 on the proliferation of LPS‐treated NP cells. LPS (10 ng/mL)‐induced NP cells were treated with AF (5, 10, and 20 μM) or 20 μM AF + 50 µM P79350. Cell proliferation was determined by EdU staining. n = 3. **p < 0.001 vs Control group; ##, #### p < 0.01, 0.0001 vs LPS group; && p < 0.01 vs LPS+albiflorin‐20 group; ns p > 0.05.

*Effects of AF and P79350 on the apoptosis of LPS‐treated NP cells. LPS (10 ng/mL)‐induced NP cells were treated with AF (5, 10, and 20 μM) or 20 μM AF + 50 µM P79350. (A and B) Cell apoptosis was tested by flow cytometry analysis. (C,D) The protein expression of Bax and Bcl‐2 was determined via western blotting. (E) Bax and Bcl‐2 mRNA levels were measured by RT‐qPCR. n = 3. ***, ***p < 0.001, 0.0001 vs Control group; #, ##, #### p < 0.05, 0.01, 0.0001 vs LPS group; & &, & & & & p < 0.01, 0.0001 vs LPS+albiflorin‐20 group.

AF Suppressed Inflammatory Cytokines Secretion in LPS‐Stimulated NP Cells by Regulating p38 MAPK/NF‐κB Pathway

3.2

The accumulation of multiple inflammatory factors is important causes of IDD [18]. We then evaluated the effect of AF on inflammatory response in LPS‐treated NP cells using ELISA. As shown in Figure 3A–C, the levels of TNF‐α (p < 0.0001, from 41.52 ± 17.91 to 269.14 ± 33.63), IL‐6 (p < 0.0001, from 21.69 ± 14.38 to 219.84 ± 33.58), and IL‐1β (p < 0.0001, from 11.93 ± 1.81 to 129.99 ± 10.99) in NP cells were elevated after LPS stimulation, but AF attenuated this effect in a concentration‐dependent manner. However, co‐treatment with P79350 led to elevated TNF‐α (p = 0.0013), IL‐1β (p = 0.0047), and IL‐6 (p = 0.0056) levels, indicating that AF exerted its anti‐inflammatory effects through regulating the p38 MAPK/NF‐κB signaling pathway.

*Effects of AF and P79350 on inflammatory cytokine levels in LPS‐treated NP cells. LPS (10 ng/mL)‐induced NP cells were treated with AF (5, 10, and 20 μM) or 20 μM AF + 50 µM P79350. Levels of (A) TNF‐α, (B) IL‐1β, and (C) IL‐6 in the cell supernatant were determined by ELISA. n = 3. ***p < 0.0001 vs Control group; #, ##, ###, #### p < 0.05, 0.01, 0.001, 0.0001 vs LPS group; & & p < 0.01 vs LPS+albiflorin‐20 group; ns p > 0.05.

AF Inhibited ECM Degradation in LPS‐Stimulated NP Cells by Regulating p38 MAPK/NF‐κB Pathway

3.3

The balance between synthesis and degradation of ECM plays a critical role in IDD by regulating ECM homeostasis and cellular function. Collagen II and aggrecan are key factors associated with ECM synthesis [19]. In LPS‐treated NP cells, the protein and mRNA expression of aggrecan and Collagen II were significantly reduced, whereas AF treatment up‐regulated their expression levels in a dose‐dependent manner, suggesting that AF attenuated ECM degradation in LPS‐treated NP cells. Notably, co‐treatment with P79350 eliminated the AF‐mediated up‐regulation of aggrecan and Collagen II (Figure 4A–E). These findings strongly suggested that the protective effects of AF on LPS‐induced ECM degradation in NP cells at least partly be mediated by the p38 MAPK pathway.

*Effects of AF and P79350 on ECM degradation in LPS‐treated NP cells. LPS (10 ng/mL)‐induced NP cells were treated with AF (5, 10, and 20 μM) or 20 μM AF + 50 µM P79350. (A–C) Expression levels of collagen II and aggrecan were examined by western blot assay. (D,E) Collagen II and aggrecan mRNA levels were detected by RT‐qPCR. n = 3. ***p < 0.0001 vs Control group; #, ##, ###, #### p < 0.05, 0.01, 0.001, 0.0001 vs LPS group; & & & & p < 0.0001 vs LPS+albiflorin‐20 group; ns p > 0.05.

AF Relieved LPS Induced NP Cell Injury by Suppressing the p38 MAPK/NF‐κB Signaling Pathway

3.4

The p38 MAPK/NF‐κB pathway has been identified to play a pivotal role in the progression of IDD [20]. To investigate whether AF mediates its protective effects in LPS‐stimulated NP cells via this pathway, we conducted Western blot assay. As exhibited in Figure 5A–C, LPS notably upregulated the phosphorylation of p38 and p65, as reflected by elevated p‐p38/p38 (p < 0.0001, from 0.104 ± 0.010 to 1.123 ± 0.091) and p‐p65/p65 (p < 0.0001, from 0.213 ± 0.009 to 0.991 ± 0.021) ratios. In contrast, treatment with AF dose‐dependently reduced phosphorylation of p38 and p65, evidenced by reduced p‐p38/p38 and p‐p65/p65 ratios. As expected, the addition of P79350 restored the phosphorylation levels of p38 and p65 in LPS‐induced NP cells. Collectively, these findings indicated that AF exerted a protective effect on NP cells by inhibiting the p38 MAPK/NF‐κB pathway (Supporting Information Figure 1).

*Effects of AF and P79350 on p38 MAPK/NF‐κB signaling pathway in LPS‐treated NP cells. LPS (10 ng/mL)‐induced NP cells were treated with AF (5, 10, and 20 μM) or 20 μM AF + 50 µM P79350. (A) The protein expression of p‐p65, p65, p‐p38 and p38 was examined using western blotting. (B,C) Quantification of p‐p65/p65 and p‐p38/p38 ratios. n = 3. ***p < 0.0001 vs Control group; #### p < 0.0001 vs LPS group; & & & & p < 0.0001 vs LPS+albiflorin‐20 group.

Discussion

4

IDD is a complex pathological condition with pathogenesis involving ECM degradation, dysregulated apoptotic processes, and inflammatory responses [21]. Previous research works have revealed that AF exerts favorable therapeutic effects in various inflammatory diseases [22]. In the present study, we established an in vitro model of IDD using LPS‐induced human NP cells and investigated the effects of AF on NP cell proliferation, apoptosis, inflammatory responses, and ECM degradation. Our results demonstrated that AF effectively reduced apoptosis, inhibited inflammatory response, and repressed ECM degradation in IDD by suppressing the p38 MAPK/NF‐κB signaling pathway. This study is the first to elucidate the key role of AF in the pathological regulation of IDD and its underlying molecular mechanism, offering a potential therapeutic strategy for clinical IDD treatment.

IVD tissue is accompanied by a series of complex pathophysiological changes during degeneration, including abnormal proliferation of NP cells, up‐regulation of pro‐inflammatory factors, and loss of collagen II [23]. In the present study, we found that LPS significantly elevated the levels of IL‐1β, IL‐6, and TNF‐α in NP cells, which is highly consistent with the molecular mechanism of LPS‐induced IDD reported in previous studies [24]. Notably, our results further confirmed that AF was able to effectively reverse the LPS‐induced inhibition of NP cell proliferation and increase in apoptosis in a dose‐dependently, while significantly reduced the release of inflammatory cytokines. The findings indicated that AF played a protective role in IDD by modulating inflammatory responses. The role of ECM degradation is significant in the IDD process, thus, collagen II and aggrecan, the markers of ECM [25], were determined in the current study. In this study, in NP cells, LPS treatment resulted in a significant reduction in expression levels of collagen II and aggrecan, which are key components of disc viscoelasticity. However, AF treatment was effective in counteracting this effect, suggesting a role for AF in maintaining the integrity of the ECM. These finding echoes the findings of Yu et al. who showed that lncRNA MAGI2‐AS3 alleviated LPS‐induced inhibition of NP cell proliferation, increase in apoptosis, inflammatory response, and ECM degradation [26]. In addition, a study by Tian et al. also confirmed that STAT3 overexpression improved NP cell viability, inhibited inflammatory response and apoptosis, and promoted ECM protein deposition [27]. Our study further validates the critical role of inflammatory response in the procession of IDD, and identified AF as a potential anti‐inflammatory therapeutic agent.

Increasing research works have reported that growth factors, inflammatory cytokines, or environmental stresses can activate the p38 MAPK pathway [28]. LPS is a key stimulator of this pathway, which is typically activated through MAPK‐mediated phosphorylation of p38 MAPK and subsequent NF‐κB activation [29]. Zhou et al. found that valsartan relieves LPS‐induced acute lung injury through the inhibition of the NF‐κB and MAPK pathways [30]. Similarly, Li et al. reported that acetylcholine inhibits NF‐κB and MAPK pathways activation leading to the suppression of LPS‐induced endothelial cell activation [31]. Our study further demonstrated that LPS enhanced the phosphorylation of p38 and p65 compared to the controls, while AF treatment reversed these effects in a dose‐dependently. P79350 treatment significantly reversed the effects of AF on LPS‐induced human NP cells. The key finding of this study is that AF exerts a protective effect on LPS‐induced NP cells by inhibiting the p38 MAPK/NF‐κB pathway. These results provide a novel molecular mechanism for the role of AF in IDD.

However, this study also has several limitations. First, the research was conducted in vitro, and the findings need to be validated in in vivo animal models of IDD to confirm the efficacy and safety of AF. Second, it is unclear whether other factors or pathways are involved in the effect of AF on LPS‐induced NP cells, and the specific downstream targets of the p38 MAPK/NF‐κB pathway modulated by AF remain to be further elucidated. Future studies could explore these aspects to gain a more comprehensive understanding of the protective mechanisms of AF in IDD.

In conclusion, AF relieves LPS induced NP cell inflammatory injury by targeting the p38 MAPK/NF‐kB pathway, suggesting its protective role in IDD. AF may be a potential candidate for IDD treatment.

Author Contributions

Kai Yang and Yanping Cheng contributed to the study design, data collection, statistical analysis, data interpretation, and manuscript preparation. Dan Yang contributed to data collection and manuscript preparation. All authors read and approved the final manuscript.

Funding

The authors received no specific funding for this work.

Ethics Statement

The authors have nothing to report.

Consent

The authors have nothing to report.

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

Supplementary Figure 1: A mechanism diagram of the AF effect on the IDD in vitro m.

Supplementary materials.