Protective Effect of Protaetia brevitarsis Larvae Extract on Alcoholic Liver Disease in Mice
Sueun Lee, Young Hye Seo, Yun‐Soo Seo, Hyeon‐Hwa Nam, Jun Lee, Joong‐Sun Kim, Ji Hye Lee
TL;DR
A study found that a water extract from Protaetia brevitarsis larvae may protect mice from alcohol-induced liver damage by reducing inflammation and oxidative stress.
Contribution
This study is the first to investigate the hepatoprotective effects of Protaetia brevitarsis larvae extract in an alcohol-induced liver disease model.
Findings
PBLE reduced hepatic lipid accumulation and liver injury in mice.
PBLE modulated alcohol metabolism-related enzymes and reduced oxidative stress and inflammation.
Six bioactive components were identified in PBLE using ultra-high-performance liquid chromatography.
Abstract
Protaetia brevitarsis larvae (PBLs) are edible insects traditionally used in oriental medicine to manage various liver diseases, including hepatitis, liver cirrhosis, and hepatic cancer. However, the effects of PBL water extract (PBLE) on alcohol‐induced liver disease remain unexplored. This study investigated the hepatoprotective effects of PBLE using a chronic‐plus‐single‐binge ethanol feeding model. PBLE (100 or 200 mg/kg/day) was orally administered in combination with an ethanol diet. Mice were euthanised 9 h post‐binge, and serum and liver tissues were collected for histological, biochemical, and molecular analyses. Six components (adenine, adenosine, hypoxanthine, inosine, benzoic acid, and uridine) were isolated from PBLE by ultra‐high‐performance liquid chromatography. PBLE treatment alleviated hepatic morphological changes, such as lipid droplet accumulation and hepatocytic…
Genes, proteins, chemicals, diseases, species, mutations and cell lines named across the full text — each resolved to its canonical identifier and authoritative record.
Click any figure to enlarge with its caption.
FIGURE 1
FIGURE 2
FIGURE 3
FIGURE 4
FIGURE 5
FIGURE 6| Gene | Accession no. | Primer sequence | Product size (bp) | |
|---|---|---|---|---|
|
| FWD | 5′‐GCCGAAGCGATCTGCTAAT‐3′ | 102 | |
| RVS | 5′‐AGGTGCTGGTGCTGATAAAG‐3′ | |||
|
| FWD | 5′‐GGCCTCAGGTGGATGAAACT‐3′ | 131 | |
| RVS | 5′‐CACGGTGGGCTGGATAAAGT‐3′ | |||
|
| FWD | 5′‐TGAGCAACTATTCCAAACCAGC‐3′ | 74 | |
| RVS | 5′‐GCACGTAGTCTTCGATCACTATC‐3′ | |||
|
| FWD | 5′‐GTTCTCAGCCCAACAATACAAGA‐3′ | 127 | |
| RVS | 5′‐GTGGACGGGTCGATGTCAC‐3′ | |||
|
| FWD | 5′‐CTGCAGCTGGAGAGTGTGGAT‐3′ | 96 | |
| RVS | 5′‐CTCCACTTTGCTCTTGACTTCTATCTT‐3′ | |||
|
| FWD | 5′‐CCCTCACACTCAGATCATCTTCT‐3′ | 61 | |
| RVS | 5′‐GCTACGACGTGGGCTACAG‐3′ | |||
|
| FWD | 5′‐AGTCTTCACTGCCCCTCATC‐3′ | 135 | |
| RVS | 5′‐AACAGCGGTAGTATCAGCCA‐3′ | |||
|
| FWD | 5′‐AACCAGTTGTGTTGTCAGGAC‐3′ | 139 | |
| RVS | 5′‐CCACCATGTTTCTTAGAGTGAGG‐3′ | |||
|
| FWD | 5′‐CCTTTTAAGCAGTATGCAGGCA‐3′ | 120 | |
| RVS | 5′‐CAAGCCAAATGGCCCAAGTT‐3′ | |||
|
| FWD | 5′‐AGCGACCAGATGAAGCAGTG‐3′ | 181 | |
| RVS | 5′‐TCCGCTCTCTGTCAAAGTGTG‐3′ | |||
|
| FWD | 5′‐GGCTGTATTCCCCTCCATCG‐3′ | 154 | |
| RVS | 5′‐CCAGTTGGTAACAATGCCATGT‐3′ | |||
- —Korea Institute of Oriental Medicine10.13039/501100003718
Peer Reviews
No public reviews on file for this paper yet. If you reviewed it on a platform where reviews are public (OpenReview, ICLR, NeurIPS, ICML), you can paste yours below so the community can read it here.
Videos
No videos yet. Explain this paper in a talk, walkthrough, or lecture? Add one.
Taxonomy
TopicsInsect Utilization and Effects · Alcohol Consumption and Health Effects · Invertebrate Immune Response Mechanisms
Introduction
1
Alcohol is consumed as a beverage and food additive all over the world (Guo et al. 2017). In small to moderate volumes, alcohol can help improve cardiovascular function and reduce the risk of dementia (Collins et al. 2009; Hong et al. 2017); however, excessive consumption has negative consequences on physical health and can be fatal (Room et al. 2005). Therefore, alcohol consumption remains a substantial global public health concern. According to a recent report by the World Health Organization, 400 million people, accounting for 7% of the world's population over 15 years old, had alcohol use disorders in 2019 (World Health Organization 2024). Furthermore, 2.6 million deaths were attributable to alcohol consumption worldwide in 2019, corresponding to 4.7% of all deaths in that year (World Health Organization 2024). Moreover, the average annual number of deaths induced by alcohol dependence in the United States increased by 14.2% from 2006–2010 to 2011–2015 (Esser et al. 2020). This statistical evidence highlights the increasing global burden of health issues associated with alcohol consumption.
Abuse of alcohol raises the risk of numerous disorders and pathological conditions affecting the gastrointestinal, cardiovascular, musculoskeletal, and immune systems (Hong et al. 2017; Room et al. 2005). Among these, alcoholic liver disease (ALD) (Collins et al. 2009), which ranges from hepatic steatosis, steatohepatitis, and cirrhosis to hepatocellular carcinoma (Altamirano and Bataller 2011), is one of the most severe outcomes of chronic alcohol consumption and causes significant mortality in individuals with alcohol use disorders (Adachi and Brenner 2006). However, no medicines for the prevention or reversal of its pathogenesis and progression have been widely approved. For individuals with ALD, agents with antioxidant and anti‐inflammatory activities, including N‐acetylcysteine, a precursor of glutathione (Zhou et al. 2003), corticosteroids (Mathurin et al. 2002), colchicine (Kershenobich et al. 1988), pentoxifylline (Akriviadis et al. 2000), and S‐adenosyl methionine (Vendemiale et al. 1989), can be considered as supplementary therapies; however, their application is often limited owing to side effects, including kidney impairment and jaundice (Day 2007; Mathurin and Bataller 2015). Accordingly, natural medicines have gained recognition in the treatment of ALD owing to their unique advantages, including their natural sources, low toxicity, and multitarget properties (Ding et al. 2012; Sun, Wang, et al. 2018).
Insects have historically comprised an important aspect of human nutrition in various regions, such as Asia, Latin America, and Africa (Bodenheimer 1951). With the growing emphasis on sustainable food production, edible insects are attracting increasing global attention as alternative sources of nutrition (Poma et al. 2017). Apart from their nutritional value, insects possess therapeutic properties, rendering them promising candidates for medical application (Devi et al. 2023; Siddiqui et al. 2023). The Protaetia brevitarsis larva (PBL), commonly referred to as the white‐spotted flower chafer, is a kind of beetle that belongs to one of the main categories of edible insects (Francis et al. 2019). According to the principles of traditional Korean medicine, PBLs are believed to target the liver meridian, exerting therapeutic effects by promoting blood circulation and removing blood stasis (The Korean Society of Materia Medica 2021). Based on this theory, PBLs have traditionally been employed to treat various diseases in Korea, including hepatic disorders such as hepatitis, liver cirrhosis, and hepatic cancer (Kwon et al. 2023). To date, however, no studies on the effect of PBL per se on ALD have been conducted. Therefore, in the present study, we aimed to investigate whether PBL extract (PBLE) has therapeutic properties against ALD in a chronic‐plus‐single‐binge ethanol feeding mouse model.
Materials and Methods
2
Preparation and Extraction of PBLs
2.1
We purchased dried PBLs from Kwang Myung Dang Co. (Ulsan, Korea), which we macroscopically and genetically confirmed previously (Lee et al. 2021). The verified specimens were submitted to the Korean Herbarium of Standard Herbal Resources at the Korea Institute of Oriental Medicine, Naju, Korea (medicinal ID: 2‐18‐0111). In total, 887 g of dried PBL was pulverized, and the constituents were extracted with 15 L of distilled water at 100°C ± 2°C under reflux for 3 h. The extract was filtered, underwent vacuum evaporation, and was freeze‐dried to obtain the crude extract (243 g, 27.4%; extract ID: 3‐18‐0048). Afterward, it was stored at −20°C.
Ultra‐High‐Performance Liquid Chromatography (UPLC) Analysis
2.2
For UPLC analysis, PBLE was dissolved in distilled water (5 mg/mL) and filtered through a Pall Corporation 0.2 μm membrane (Port Washington, NY, USA). Analytical UPLC was conducted using a Waters Acquity H‐Class Plus System (Milford, MA, USA) equipped with a Waters Acquity UPLC charged surface hybrid C_18_ column (2.1 × 100 mm, 1.7 μm). Gradient elution was performed using a liquid chromatography‐grade mobile phase composed of 0.05% formic acid in distilled water (solvent A) and acetonitrile (solvent B; JT Baker, Phillipsburg, NJ, USA). Furthermore, it was commenced with 2% solvent B from 0 to 3 min and increased linearly to 50% solvent B for 15 min. The injected volume, column temperature, and flow rate were 10 μL, 35°C, and 0.3 mL/min, respectively. Ultraviolet (UV) detection was performed over a wavelength of 200–400 nm, and the chromatogram for the chemical profile was specifically monitored at 254 nm. The analytical procedure for UPLC analysis and compound identification was based on a previously established and validated method (Lee et al. 2021).
Animals
2.3
Pathogen‐free female C57BL/6 mice (7 weeks of age) were obtained from Dooyeol Biotech (Seoul, South Korea). The mice were maintained under a 12:12 h photoperiod at 22°C ± 2°C, with free access to food and water in standard cages. After a one‐week period of quarantine and acclimatization, the mice were utilized for experiments. All procedures were approved by the Institutional Animal Care and Use Committee of the Korea Institute of Oriental Medicine, under approval number 21‐022, dated March 23, 2021. Animal group sizes were consistent with those commonly used in previous studies employing similar models and endpoints (Ki et al. 2010; Yan et al. 2024). All experimental procedures and results adhered to the relevant regulations and ARRIVE guidelines (http://arriveguidelines.org).
Chronic‐Plus‐Single‐Binge Ethanol Feeding Model
2.4
The animals were treated as previously described (Bertola et al. 2013). Briefly, we acclimatized all the mice to a controlled liquid diet (Envigo, Huntingdon, Cambridgeshire, UK) for 5 days with ad libitum access. Subsequently, we divided the mice into four groups comprising six individuals each: control, ethanol, 100 mg/kg PBLE (PBLE100), and 200 mg/kg PBLE (PBLE200). All mice were administered a Lieber–DeCarli ethanol liquid diet comprising 5% (v/v) ethanol for a duration of 10 days, except for the control group. The control group was provided with a Lieber–DeCarli control diet in which ethanol was replaced with isocaloric maltose dextrin. The PBLE100 and PBLE200 groups were administered PBLE orally at doses of 100 and 200 mg/kg/day, respectively, with the Lieber–DeCarli diet. The doses of PBLE (100 and 200 mg/kg) were determined based on our previous pilot study. In that study, 100 mg/kg showed a trend toward hepatoprotection but failed to reach statistical significance (Figure S1). Therefore, 200 mg/kg was included in the present study to more clearly evaluate the therapeutic potential of PBLE. In the vehicle groups, including the control and ethanol groups, saline was administered orally instead of PBLE. We measured body weight every other day and recorded dietary intake daily. The mice in the ethanol, PBLE100, and PBLE200 groups received an ethanol (5 g/kg) binge on day 11, whereas the control mice were administered a binge of isocaloric maltose mixture (containing the same calories as 5 g/kg ethanol) via oral gavage. The mice were euthanised 9 h after the binge by using an alfaxalone and xylazine combination; thereafter, blood serum was collected and dissected liver tissue was weighed. These were stored at −80°C prior to use.
Liver Index
2.5
The liver index was calculated as the ratio of liver weight to body weight and expressed as a percentage according to the following formula:
Histology
2.6
Liver tissues were preserved in formalin, paraffin‐mounted, and sliced at a 4‐μm thickness for microscopic examination. Hematoxylin and eosin (H&E) visualization followed established techniques.
Measurements of Biochemical Parameters
2.7
Serum concentrations of aspartate aminotransferase (AST), alanine aminotransferase (ALT), and triglycerides (TGs) were measured using a Dri‐Chem NX500 analyzer (Fujifilm, Tokyo, Japan), following the instructions provided by the manufacturer.
RNA Extraction, Complementary DNA (cDNA) Synthesis, and Quantitative Real‐Time Reverse Transcription Polymerase Chain Reaction (qRT‐PCR)
2.8
Total RNA was isolated using the RNeasy Mini Kit (Qiagen, Hilden, Germany). Using DeNovix DS‐11 spectrophotometer (DeNovix Inc., Wilmington, NC, USA), the optical density was measured to analyze RNA concentration. cDNA was synthesized with Superscript IV Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's recommendations. The cDNA was diluted to 8 ng/μL with RNase‐free water and stored at −80°C. qRT‐PCR was performed using the TOPreal qPCR 2× PreMIX (Enzynomics, Daejeon, South Korea) on a CFX96 system (Bio‐Rad Laboratories Inc., Hercules, CA, USA) as instructed by the manufacturer. The employed primer sequences are listed in Table 1. PCR cycling consisted of an initial pre‐incubation, followed by 40 cycles of denaturation and annealing. A melting curve analysis was conducted to verify the specificity of amplification. Amplification profiles and quantification cycle values were generated using the instrument's integrated software. Following normalization to β‐actin, relative transcript abundance was assessed via the 2^−ΔΔCT^ technique (Livak and Schmittgen 2001), with results represented as fold differences relative to the control group.
Western Blot
2.9
Hepatic samples were processed with a nuclear and cytoplasmic protein extraction kit (Novus Biologicals, Centennial, CO, USA) according to the supplier's protocol to obtain both cytosolic and nuclear protein fractions. These fractions were separated on sodium dodecyl sulphate–polyacrylamide gels (Bio‐Rad Laboratories Inc.) and subsequently transferred onto polyvinylidene fluoride membranes (Bio‐Rad Laboratories Inc.). The membranes were blocked for 1 h at room temperature in phosphate‐buffered saline (pH 7.4) containing 1% (v/v) normal goat serum (Vector Laboratories, Burlingame, CA, USA), 0.5% (v/v) bovine serum albumin (Sigma‐Aldrich, St. Louis, MO, USA), and 0.1% (v/v) Tween 20, followed by overnight incubation at 4°C with the primary antibodies including anti‐alcohol dehydrogenase (ADH; 1:1000, #sc‐133207; Santa Cruz Biotechnology, Santa Cruz, CA, USA), anti‐aldehyde dehydrogenase 1/2 (ALDH1/2; 1:1000, #sc‐166362; Santa Cruz Biotechnology), anti‐cytochrome P450 2E1 (CYP2E1; 1:1000, #ab28146; Abcam, Cambridge, MA, USA), anti‐p65 (1:1000, #8242. Cell Signaling Technology, Danvers, MA, USA), anti‐cyclooxygenase‐2 (COX2; 1:1000, #sc‐7951; Santa Cruz Biotechnology), anti‐inducible nitric oxide synthase (iNOS; 1:1000, #13120; Cell Signaling Technology), anti‐interleukin‐1 beta (IL1β; 1:1000, #NB600‐633; Novus Biologicals), anti‐nuclear factor erythroid 2‐related factor 2 (NRF2; 1:1000, #12721; Cell Signaling Technology), anti‐haem oxygenase 1 (HO1; 1:1000, #sc‐136960; Santa Cruz Biotechnology), and anti‐superoxide dismutase 3 (SOD3; 1:1,000, #sc‐271170; Santa Cruz Biotechnology), respectively. We treated the membranes with horseradish peroxidase‐conjugated anti‐rabbit secondary antibody (1:5000, #31460; Thermo Fisher Scientific, Waltham, MA, USA) or anti‐mouse secondary antibody (1:5000, #31181; Thermo Fisher Scientific) for 2 h. The blots were visualized using western blotting luminal reagent (Thermo Fisher Scientific) and detected using a ChemiDoc MP imaging system (Bio‐Rad Laboratories Inc). The membranes were re‐probed with anti‐β‐actin (1:5000, #4967; Cell Signaling Technology) and anti‐histone H3 (1:1000, #sc‐10809; Santa Cruz Biotechnology) for cytosolic and nuclear proteins, respectively.
Statistical Analysis
2.10
Data are presented as means ± standard deviation (SD). One‐way analysis of variance (ANOVA) was used to conduct the statistical analyses. Specifically, to evaluate the therapeutic effects of PBLE, Dunnett's test was performed as a pre‐planned comparison to compare all treatment groups against the disease control group. Body weight and daily food intake were analyzed using two‐way ANOVA followed by Tukey's test for post hoc multiple comparisons. Comparative analytical graphs were constructed using GraphPad Prism (ver. 10.5.0; San Diego, CA, USA). Statistical significance was set at p < 0.05.
Results
3
Chemical Profile of PBLE
3.1
The extract and a mixture of standard compounds were analyzed simultaneously by using an analytical method at 254 nm to characterize the chemical profile (Figure 1A). Six major compounds—adenine (1), hypoxanthine (2), uridine (3), adenosine (4), inosine (5), and benzoic acid (6)—were isolated from PBLE (Figure 1B), as previously described (Lee et al. 2021). Compounds 1–6 were identified in PBLE at 0.807, 1.682, 2.440, 4.086, 5.100, and 11.024 min, respectively, using a comparison of the retention times and UV absorbance patterns.
Ultra‐performance liquid chromatography chemical profile of PBLE at UV 254 nm (A) and chemical structures of compounds 1–6 (B). PBLE, water extract of Protaetia brevitarsis larvae.
Changes in Body Weight and Food Intake
3.2
The experimental groups and schedule are presented in Figure 2A,B. Food intake and body weight were monitored daily and on alternate days, respectively. The initial body weights were similar between all pairs of groups (Figure 2C). The body weight of the control group showed an increasing trend, whereas that of the other ethanol‐fed groups remained stagnant. Nevertheless, no substantial difference was noted between the groups, except between the control and PBLE100 groups on Day 4 after ethanol feeding. All groups exhibited similar daily volumes as regards the food intake throughout the experimental periods, with the exception of Days 1, 2, 3, and 6 after ethanol feeding (Figure 2D, left). The control group ate significantly more than the other groups on days 1 and 3. The dietary intake of the control group was significantly greater than that of the PBLE200 group on Days 2 and 6 after ethanol feeding. However, no significant differences were detected in the daily average food consumption between the groups (Figure 2D, right).
*Schematic experimental timeline and changes in the mouse body weight and food intake. Experimental groups (A) and schedule (B) are described. Body weight (C) and food intake (D) were measured every other day and daily, respectively. Data are reported as the mean ± SD (n = 6 per group). p < 0.05, control vs. EtOH group; †p < 0.05 and ††p < 0.01, control vs. PBLE100 group; #p < 0.05 and ##p < 0.01, control vs. PBLE200 group. EtOH, ethanol; PBLE, water extract of Protaetia brevitarsis larvae; PBLE100, mice co‐treated with ethanol and PBLE 100 mg/kg; PBLE200, mice co‐treated with ethanol and PBLE 200 mg/kg.
Amelioration of Ethanol‐Induced Hepatic Injury by PBLE Treatment
3.3
In H&E analysis, the control group exhibited normal cellular architecture with distinct hepatic cells and no histological abnormalities (Figure 3A). However, massive fat deposition and hepatocytic ballooning were observed following ethanol feeding. These pathological alterations were alleviated by PBLE treatment in a dose‐dependent manner.
*PBLE administration attenuated ethanol‐induced hepatic injury and morphological liver alterations. (A) H&E‐stained liver tissue sections. (B) Liver index defined as the ratio of liver to body weight. (C) Serum AST, ALT, and TG levels. Scale bars = 50 μm. Data are reported as the means ± SD (n = 6 per group). *p < 0.05, **p < 0.01, and **p < 0.001 vs. EtOH group. ALT, alanine aminotransferase; AST, aspartate aminotransferase; EtOH, ethanol; PBLE, water extract of Protaetia brevitarsis larvae; PBLE100, mice co‐treated with ethanol and PBLE 100 mg/kg; PBLE200, mice co‐treated with ethanol and PBLE 200 mg/kg; PV, portal vein; TG, triglyceride.
The liver index in the ethanol group was considerably higher than that in the control group (Figure 3B). Nevertheless, the ethanol‐induced liver index increase was significantly improved by co‐treatment with high‐dose PBLE.
Next, we examined the impact of ethanol feeding and PBLE administration on serum liver enzyme (e.g., AST and ALT) and TG levels (Figure 3C). Ethanol feeding markedly upregulated AST, ALT, and TG levels in serum compared with those of the control mice. However, high‐dose PBLE alleviated the ethanol‐induced increase in AST levels. Both doses significantly mitigated the elevated TG levels. The increased ALT levels in the ethanol group decreased minimally with PBLE co‐administration; however, the difference was not significant.
Effects of Ethanol Feeding and PBLE Administration on Alcohol Metabolism‐Related Enzymes
3.4
We investigated the effects of ethanol feeding and PBLE treatment on the alcohol metabolism‐related hepatic enzymes ADH, ALDH1/2, and CYP2E1 (Figure 4). Figure 4A shows representative images of Western blot analysis. Ethanol feeding significantly suppressed the protein levels of ADH and ALDH1/2 in comparison with those of the control group (Figure 4B). However, co‐treatment with high‐dose PBLE mitigated the reduced ADH and ALDH1/2 expression. The protein level of CYP2E1 was markedly elevated in the ethanol‐fed group, whereas high‐dose PBLE significantly attenuated this elevation. Similarly, ethanol feeding substantially reduced the mRNA expression of Adh1 and Aldh2; however, these reductions were ameliorated by high‐ and low‐dose PBLE treatments, respectively (Figure 4C).
*Effects of PBLE treatment on alcohol metabolism‐related enzymes. (A) Representative photos of Western blotting. (B) Bar graphs representing the expression levels of proteins ADH, ALDH1/2, and CYP2E1. (C) Quantitative plots of mRNA levels of Adh1 and Aldh2 genes. Data are reported as mean ± SD (n = 6 per group). *p < 0.05, **p < 0.01, and **p < 0.001 vs. EtOH group. ADH, alcohol dehydrogenase; ALDH, aldehyde dehydrogenase; CYP2E1, cytochrome P450 2E1; EtOH, ethanol; PBLE, water extract of Protaetia brevitarsis larvae; PBLE100, mice co‐treated with ethanol and PBLE 100 mg/kg; PBLE200, mice co‐treated with ethanol and PBLE 200 mg/kg.
Anti‐Inflammatory Effects of PBLE Administration in the Liver of Chronic‐Plus‐Single‐Binge Ethanol‐Fed Mice
3.5
We investigated whether PBLE co‐treatment with ethanol alleviated ethanol‐induced hepatic inflammation (Figure 5). Figure 5A shows representative photos of Western blot analysis of inflammatory factors, including p65, COX2, iNOS, and IL1β. The levels of all these proteins were increased considerably in the liver tissue of the ethanol‐fed mice (Figure 5B). However, PBLE treatment significantly downregulated these proteins.
*PBLE treatment alleviated hepatic inflammation in ethanol‐fed mice. (A) Representative images of Western blot analysis. (B) Bar graphs showing the protein levels of p65, COX2, iNOS, and IL1β. (C) Quantitative graphs of mRNA expression of Cox2, iNos, Il1β, and Tnfα. Data are reported as the means ± SD (n = 6 per group). *p < 0.05, **p < 0.01, and **p < 0.001 vs. EtOH group. EtOH, ethanol; PBLE, water extract of Protaetia brevitarsis larvae; COX2, cyclooxygenase‐2; IL1β, interleukin 1 beta; iNOS, inducible nitric oxide synthase; PBLE100, mice co‐treated with ethanol and PBLE 100 mg/kg; PBLE200, mice co‐treated with ethanol and PBLE 200 mg/kg; TNFα, tumor necrosis factor alpha.
In addition, mRNA expression levels of inflammatory factors, including Cox2, iNos, Il1β, and tumor necrosis factor alpha (Tnfα), were elevated in the liver of the ethanol group (Figure 5C). The elevated mRNA expression of Cox2, iNos, and Il1β in the ethanol‐fed mice was mitigated by high‐dose PBLE co‐treatment, and that of Tnfα was significantly reduced by both doses of PBLE administration.
Antioxidant Effect of PBLE Treatment in the Liver of Ethanol‐Fed Mice
3.6
Figure 6 shows the expression levels of proteins and genes related to antioxidant responses to ethanol‐induced oxidative stress (Figure 6). Figure 6A shows Western blot images for NRF2, HO1, and SOD3. Their protein levels were markedly reduced in the livers of ethanol‐fed mice relative to those in the control group (Figure 6B). The protein levels of NRF2 dose‐dependently recovered following PBLE administration; whereas the difference did not reach statistical significance. The protein expression of HO1 and SOD3 was significantly upregulated after high‐dose treatment with PBLE relative to those in the ethanol group.
*PBLE exerted antioxidant activity in ethanol‐induced hepatic damage. (A) Representative Western blot images. (B) Quantitative plots of protein levels of NRF2, HO1, and SOD3. (C) Bar graphs representing mRNA levels of Nrf2, Sod1, Gpx3, and catalase. Data are reported as the mean ± SD (n = 6 per group). *p < 0.05, **p < 0.01, and **p < 0.001 vs. EtOH group. EtOH, Ethanol; Gpx3, glutathione peroxidase 3; HO1, heme oxygenase 1; NRF2, nuclear factor erythroid 2‐related factor 2; PBLE, water extract of Protaetia brevitarsis larvae; PBLE100, mice co‐treated with ethanol and PBLE 100 mg/kg; PBLE200, mice co‐treated with ethanol and PBLE 200 mg/kg; SOD, superoxide dismutase.
Moreover, the mRNA levels of Nrf2, superoxide dismutase 1 (Sod1), catalase, and glutathione peroxidase 3 (Gpx3) were considerably lower in the ethanol group than those in the control group. However, the suppressed expression of these proteins was significantly ameliorated by high‐dose PBLE administration (Figure 6C).
Discussion
4
In the present study, we evaluated the hepatoprotective potential of PBLE in a mouse model with ALD by using a chronic‐plus‐single‐binge ethanol feeding method, thereby identifying a new treatment strategy for ALD. This mouse model has been optimized to have similarities to ALD in humans (Bertola et al. 2013). It resembles the initial phases of ALD in humans, such as steatosis and steatohepatitis, and has been widely used to investigate the molecular impacts of alcohol on the liver as well as to evaluate potential new therapy strategies, although it is limited in inducing advanced pathological features such as extensive fibrosis or cirrhosis (Bertola et al. 2013; Landmann et al. 2014). In this study, mice were fed a diet containing ethanol for 10 days. On the 11th day, the mice received a single gavage dose of ethanol, which produced a greater elevation in blood ethanol levels than either acute or chronic ethanol feeding. This combination provoked inflammation, hepatic steatosis, and liver damage in a synergistic manner (Bertola et al. 2013).
Alcohol consumption impairs lipolysis, leading to hepatic lipid accumulation and elevated plasma TG levels, which are closely linked to liver steatosis, an early hallmark of ALD (Jeon and Carr 2020; Yuan et al. 2007). Liver steatosis was once considered a benign and non‐progressive condition; however, recent studies have suggested that it is critical in both ALD onset and progression (Harrison and Diehl 2002; Landmann et al. 2014). Mice treated with ethanol in this study exhibited lipid droplet accumulation and hepatocyte ballooning in the liver tissue. Their liver weight was significantly increased by ethanol feeding, which might have resulted from fat accumulation or oedema in the liver. In contrast, PBLE administration significantly alleviated the histological changes and increased liver weight. Furthermore, the increased TG, AST, and ALT levels in the serum after ethanol administration were improved by PBLE administration. Collectively, these findings indicate that PBLE protects against alcohol‐induced histopathological changes, liver damage, and lipid metabolic disturbance.
Alcohol metabolism relies on two major enzymes, ADH and ALDH. ADH plays a predominant role during the initial phase of ethanol metabolism as it oxidizes ethanol to acetaldehyde in hepatocytes (Kimura et al. 2015; Sasaki‐Tanaka et al. 2022; Tan et al. 2020). The second step involves ALDH, which converts a toxic byproduct, acetaldehyde, into acetic acid (Yan et al. 2023). Normally, ADH accounts for approximately 75%–80% of ethanol metabolism (Kimura et al. 2015; Sasaki‐Tanaka et al. 2022; Tan et al. 2020). In contrast, CYP2E1 has relatively low catalytic efficiency for ethanol and contributes to 10% of its metabolism (Quertemont 2004). Nevertheless, when blood alcohol levels are high, CYP2E1 becomes more relevant (Jiang et al. 2020) because the low Km of ADH leads to saturation under conditions of excessive alcohol consumption (Jones 2019). CYP2E1 facilitates ethanol metabolism when ADH is saturated; it also serves as a major contributor to oxidative stress in hepatocytes (Lieber 2004; Lu and Cederbaum 2008). It facilitates the efficient reduction of dioxygen and other chemicals, even without a binding substrate, as its haem iron is in a constitutively high‐spin state (Harjumäki et al. 2021). Consequently, CYP2E1 enhances the generation of reactive oxygen species, including hydrogen peroxide and superoxide, causing hepatotoxicity mediated by oxidative stress and lipid peroxidation (Ekström and Ingelman‐Sundberg 1989; Harjumäki et al. 2021; Ingelman‐Sundberg et al. 1993). Previously, Brandon‐Warner et al. showed that the expression and activity of CYP2E1 and levels of malondialdehyde (a marker of lipid peroxidation) were increased and the glutathione level was decreased in the liver tissue of mice administered alternating 10%/20% (v/v) ethanol for 8 weeks; however, the hepatic expression of ADH and ALDH did not significantly differ (Brandon‐Warner et al. 2012). Furthermore, Liu et al. reported that ADH and ALDH activities, their mRNA levels, and the protein expression of SOD2 were down‐regulated, whereas the protein level of CYP2E1 was upregulated, in mice fed the Lieber–DeCarli diet containing gradually increasing ethanol (1.8%–5.0%) over 10 days (Liu et al. 2012). Similarly, in this study, ethanol administration decreased the protein and gene expression of ADH and ALDH and markedly increased the protein expression of CYP2E1. The high blood alcohol concentration induced by ethanol feeding might have led to the downregulation of ADH and ALDH and upregulation of CYP2E1. However, PBLE administration significantly ameliorated these ethanol‐induced alterations, indicating its modulatory effect on ethanol metabolism impaired by chronic ethanol intake.
Alcohol consumption leads to hepatic oxidative stress and lipid deposition, contributing to inflammation and progression of ALD (Cao et al. 2015; Zhong et al. 2012). Therefore, regulation of oxidative stress and inflammation is crucial for the therapeutic management of ALD. Previous studies have reported that hepatic oxidative stress and inflammation caused by chronic Lieber–DeCarli ethanol feeding are attenuated by several substances, including hydrogen‐rich water (Lin et al. 2017), astaxanthin (Han et al. 2018), Lactobacillus spp. (Hsieh et al. 2021), and Xie Zhuo Tiao Zhi decoction (Chang et al. 2024). In this study, NRF2, a key transcription factor controlling the intracellular adaptive antioxidant defense during oxidative stress (Sun, Fu, et al. 2018), and its downstream targets HO1, SOD3, Sod1, Gpx3, and catalase were suppressed in the livers of ethanol‐fed mice. Furthermore, ethanol administration upregulated the hepatic expression of p65, a major subunit of nuclear factor kappa B, which mediates inflammatory signaling, and related inflammatory factors, including COX2, iNOS, IL1β, and Tnfα. However, PBLE administration alleviated these ethanol‐induced changes by enhancing antioxidant defenses and suppressing inflammatory responses. Consequently, we suggest that PBLE ameliorates ALD through its antioxidant and anti‐inflammatory effects by modulating the NRF2 and p65 signaling pathways.
We revealed that PBLE contains benzoic acid, a pyrimidine derivative (uridine), and purine derivatives (i.e., adenosine, adenine, hypoxanthine, and inosine). Some of these isolated compounds, such as benzoic acid, uridine, adenine, adenosine, and inosine, have been reported to exhibit antioxidant activity by modulating several molecular pathways, including apoptosis (mammalian sterile 20‐like kinase 1), ferroptosis (Nrf2), lipid metabolism (acyl‐CoA synthetase long‐chain family member 4), and endoplasmic reticulum stress (activating transcription factor 4 and glucose‐regulated protein 78) (Gholinejad et al. 2018; Gudkov et al. 2006; Lai et al. 2023; Leu et al. 2021; Velika and Kron 2012). Benzoic acid, uridine, adenosine, and inosine have also been shown to exert anti‐inflammatory effects by suppressing pro‐inflammatory mediators, including IL‐1β, IL‐6, nitric oxide, TNF‐α, macrophage inflammatory protein‐2 (Chen et al. 2020; Cicko et al. 2015; Kohno et al. 2015; Liaudet et al. 2002; Mehler and Gerhards 1987). Notably, inosine administration exerted protective effects in a mouse model of ALD by alleviating serum ALT and AST levels, inflammatory mediators, and hepatic steatosis (Wei et al. 2024). Based on these reports, we hypothesize that PBLE compounds may exert protective effects against ALD induced by chronic‐plus‐single‐binge ethanol feeding.
Although the present study provides experimental evidence for the protective effects of PBLE against alcohol‐induced liver injury, several limitations need to be acknowledged. First, the absence of a positive control group limits the comparative evaluation of PBLE's efficacy relative to established therapeutic agents. Future studies incorporating standard hepatoprotective drugs could more clearly define the therapeutic capacity of PBLE, offering informative comparisons to existing therapies and strengthening the clinical relevance of the findings. Second, while PBLE demonstrated anti‐inflammatory and antioxidant effects, the study did not investigate interactions between specific bioactive compounds and their molecular targets. Examining these interactions would be necessary to better elucidate the molecular mechanisms underlying the hepatoprotective effects of PBLE. Despite these limitations, the present study has several strengths. This study focuses on an edible insect‐derived material, a research area that remains relatively underexplored, and provides experimental evidence supporting the traditional use of Protaetia brevitarsis for liver‐related conditions within a modern experimental framework. Furthermore, by integrating histological, biochemical, and physiological assessments, this work offers a systematic evaluation of the hepatoprotective effects of PBLE and contributes to expanding the scientific basis for edible insect‐derived functional materials.
P. brevitarsis is a highly promising medicinal resource with proven industrial scalability. Since its official registration as an edible food ingredient in the Korean Food Standards Codex by the Ministry of Food and Drug Safety in 2018, it has become the most widely utilized edible insect in Korea. Supported by extensive research into mass‐production technologies, P. brevitarsis accounted for approximately 58.4% of the total sales within the Korean edible insect market as of 2024, representing the largest market share (Ministry of Agriculture 2025). Based on this robust industrial foundation, generating further evidence to support its potential clinical use will be of great significance. Given the physiological and anatomical differences between humans and rodents, further investigations including toxicity and safety evaluations at specific doses, pharmacokinetic studies, and clinical trials to verify efficacy will be essential to establish the translational applicability of PBLE in humans.
Conclusion
5
In summary, PBLE administration in this mouse model effectively modulated ethanol‐induced liver damage through the regulation of CYP2E1, ADH, ALDH, NRF2, and p65 expression, resulting in amelioration in alcohol metabolism, oxidative stress, and inflammation. Therefore, we suggest that PBLE has therapeutic potential in the prevention or treatment of alcohol‐induced hepatic damage. Further, these findings indicate the potential of the edible beetle PBLs as a functional food ingredient with hepatoprotective properties, thereby adding value to insect‐based foods and feeds. By linking traditional ethnopharmacological knowledge with modern biomedical evidence, our study contributes to enhancing the perceived health benefits of edible insects, which is a key factor in improving consumer acceptance, expanding markets, and promoting sustainable utilization of insect resources.
Author Contributions
S.L.: conceptualization, investigation, formal analysis, writing – original draft, writing – review and editing; Y.H.S.: investigation, formal analysis, writing – original draft; Y.S.S.: investigation; H.H.N.: investigation; J.L.: investigation; J.S.K.: methodology, writing – review and editing, supervision; J.H.L.: conceptualization, investigation, formal analysis, writing – original draft, writing – review and editing. All authors have read and approved the final manuscript.
Funding
This work was supported by grants from the Korea Institute of Oriental Medicine (grant numbers KSN2013320 and KSN2512030).
Ethics Statement
This study does not involve any human or animal testing. All procedures were approved by the Institutional Animal Care and Use Committee of the Korea Institute of Oriental Medicine, under approval number 21–022, dated March 23, 2021. All experimental procedures and results adhered to the relevant regulations and ARRIVE guidelines (http://arriveguidelines.org).
Conflicts of Interest
The authors declare no conflicts of interest.
Supporting information
Figure S1: In a preliminary study, administration of PBLE at 100 mg/kg tended to mitigate ethanol‐induced hepatic damage.
The reference list from the paper itself. Each links out to its DOI / PubMed record.
- 1Adachi, M. , and D. A. Brenner . 2006. “Clinical Syndromes of Alcoholic Liver Disease.” Digestive Diseases 23, no. 3–4: 255–263.10.1159/00009017316508290 · doi ↗ · pubmed ↗
- 2Akriviadis, E. , R. Botla , W. Briggs , S. Han , T. Reynolds , and O. Shakil . 2000. “Pentoxifylline Improves Short‐Term Survival in Severe Acute Alcoholic Hepatitis: A Double‐Blind, Placebo‐Controlled Trial.” Gastroenterology 119, no. 6: 1637–1648.11113085 10.1053/gast.2000.20189 · doi ↗ · pubmed ↗
- 3Altamirano, J. , and R. Bataller . 2011. “Alcoholic Liver Disease: Pathogenesis and New Targets for Therapy.” Nature Reviews. Gastroenterology & Hepatology 8, no. 9: 491–501. 10.1038/nrgastro.2011.134.21826088 · doi ↗ · pubmed ↗
- 4Bertola, A. , S. Mathews , S. H. Ki , H. Wang , and B. Gao . 2013. “Mouse Model of Chronic and Binge Ethanol Feeding (The NIAAA Model).” Nature Protocols 8, no. 3: 627–637.23449255 10.1038/nprot.2013.032PMC 3788579 · doi ↗ · pubmed ↗
- 5Bodenheimer, F. S. 1951. “Insects as Human Food.” In Insects as Human Food: A Chapter of the Ecology of Man, 7–38. Springer.
- 6Brandon‐Warner, E. , T. L. Walling , L. W. Schrum , and I. H. Mc Killop . 2012. “Chronic Ethanol Feeding Accelerates Hepatocellular Carcinoma Progression in a Sex‐Dependent Manner in a Mouse Model of Hepatocarcinogenesis.” Alcoholism, Clinical and Experimental Research 36, no. 4: 641–653. 10.1111/j.1530-0277.2011.01660.x.22017344 PMC 3288433 · doi ↗ · pubmed ↗
- 7Cao, Y.‐W. , Y. Jiang , D.‐Y. Zhang , et al. 2015. “Protective Effects of Penthorum chinense Pursh Against Chronic Ethanol‐Induced Liver Injury in Mice.” Journal of Ethnopharmacology 161: 92–98.25510733 10.1016/j.jep.2014.12.013 · doi ↗ · pubmed ↗
- 8Chang, K. , R. Guo , W. Hu , et al. 2024. “Xie Zhuo Tiao Zhi Formula Ameliorates Chronic Alcohol‐Induced Liver Injury in Mice.” Frontiers in Pharmacology 15: 1363131. 10.3389/fphar.2024.1363131.38681193 PMC 11045942 · doi ↗ · pubmed ↗