Krüppel-like factor 10 promotes the progression of breast cancer by activating canonical NF-κB signaling
Xue-Wei Jiang, Jing Liu, Mei-Rong Bao, Xiao-Yan Bai, Ran Tao
TL;DR
This study shows that KLF10 promotes breast cancer by activating the NF-κB signaling pathway, leading to cancer cell growth and spread.
Contribution
The paper reveals a new mechanism where KLF10 activates NF-κB by upregulating RELA and degrading IκBα.
Findings
KLF10 promotes breast cancer proliferation and metastasis.
KLF10 activates NF-κB by increasing RELA expression and degrading IκBα.
NF-κB targets like TNF, VEGFA, and MMP9 are upregulated by KLF10.
Abstract
The elevation of NF-κB activity is frequently found in more malignant cancer types; however, the cause of this activation has still been controversial. Here, we showed that KLF10 promoted breast cancer progression by activating the NF-κB cascade. Mechanistically, KLF10 transcriptionally upregulated RELA mRNA expression. ChIP assay further validated the binding of KLF10 to the RELA promoter. Additionally, by interacting with IκBα and promoting its proteasomal degradation, KLF10 facilitated the release and nuclear translocation of p65, thereby activating the NF-κB signaling. The phosphorylated p65 level was dramatically increased upon KLF10 overexpression. Several targets of NF-κB, including TNF, VEGFA, PLAU, MMP9, ICAM1, CCND1, and MYC, were also upregulated by KLF10. In vivo experiments confirmed that KLF10 promoted breast cancer metastasis, with its expression positively correlated…
Genes, proteins, chemicals, diseases, species, mutations and cell lines named across the full text — each resolved to its canonical identifier and authoritative record.
Click any figure to enlarge with its caption.
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8Peer Reviews
No public reviews on file for this paper yet. If you reviewed it on a platform where reviews are public (OpenReview, ICLR, NeurIPS, ICML), you can paste yours below so the community can read it here.
Videos
No videos yet. Explain this paper in a talk, walkthrough, or lecture? Add one.
Taxonomy
TopicsKruppel-like factors research · Genomics, phytochemicals, and oxidative stress · Mechanisms of cancer metastasis
Introduction
The incidence of breast cancer has been continuously growing in the past few decades worldwide.1^,^2 As a highly heterogeneous cancer type, breast cancer occurs mainly due to the dysregulation of molecular biological processes in mammary cells, caused by the contributions of both genetic and environmental factors.3^,^4 Attention has been focused on the identification of causative signals and the regulatory factors in different subtypes of breast cancer, which may provide clinical benefits to patients in targeted therapy.
NF-κB signaling plays a major role in tumor initiation and development through various hallmarks of cancer, including cell proliferation, survival, apoptosis, transformation, metastasis, angiogenesis, inflammation, and chemoresistance.3^,^5 The NF-κB transcription factor family consists of five subunits, RelA (p65), RelB, c-Rel, NF-κB1 (p105 and p50), and NF-κB2 (p100 and p52), which form homodimers or heterodimers to regulate the downstream gene expression. In the canonical NF-κB pathway, IκB proteins, the NF-κB inhibitors, sequester the p50-p65 complex in the cytoplasm. When triggered by external stimuli, IKK kinase phosphorylates IκBα to promote its ubiquitination and proteasomal degradation, facilitating the release of p50-p65 from IκBα. Subsequently, the phosphorylated p50-p65 then enters to the nucleus and activates gene transcription.6 Aberrantly high activation of NF-κB signaling is frequently found in more aggressive cancers,7 indicating a great contribution of NF-κB in cancer invasiveness. In breast cancer, elevated levels of active NF-κB are detected in various molecular subtypes of breast cancer, predominantly in the HER2-amplified and hormone-negative subclass.8^,^9^,^10 Therefore, efforts should be made to explore the tumorigenesis in NF-κB-activated subtypes of breast cancer by targeting this oncogenic pathway.
Krüppel-like factor 10 (KLF10), also named as TIEG1 (TGF-β inducible immediate-early gene 1, TIEG1), was initially identified by Subramaniam et al. in 1995.11^,^12 It is shown to play roles in tumorigenesis, involving several processes of proliferation, apoptosis, and differentiation.12 As mentioned earlier, KLF10 exerts its tumor-suppressive functions primarily by modulating the TGF-β/SMAD signaling pathway,13^,^14 involving growth inhibition and apoptosis induction.15^,^16^,^17^,^18^,^19 Given the dual role of TGF-β signaling, which is characterized by tumor suppression at the early stages and invasiveness promotion at the late stages, it is reasonable that the effect of KLF10 on cancer development is diverse. Recently, several studies have reported that KLF10 might act as an oncoprotein to promote cancer proliferation and invasion.20^,^21^,^22^,^23^,^24^,^25 In hepatocellular carcinoma, CASC7 increased KLF10 expression to promote cell proliferation, invasion, and migration via miR-30a-5p.22 In breast cancer, KLF10 was shown to be induced by estrogen in ER-positive tumor tissues and cell lines.26 Growing evidence has revealed that high KLF10 is associated with poor prognoses in patients with cancer.27^,^28^,^29 Therefore, the different cell contexts might influence the effect of KLF10 on tumor progression, which needs further investigation.
In the current study, we identified KLF10 as a novel oncogenic driver that facilitates breast cancer progression through the constitutive activation of the NF-κB signaling. Mechanistically, KLF10 induces tumorigenesis either by activating RELA transcription or by facilitating IκBα degradation to upregulate NF-κB activity, thereby leading to increases in TNF, VEGFA, PLAU, MMP9, ICAM1, CCND1, and MYC. In human breast cancer, KLF10 expression demonstrates a significant positive correlation with the activation status of the NF-κB signaling.
Results
KLF10 promotes breast cancer cell proliferation and metastasis in vitro
To investigate the clinical significance of KLF10, we initially assessed its prognostic value through a comprehensive analysis of a large-scale breast cancer cohort comprising 1,300 clinically annotated tumor samples (https://kmplot.com/analysis/). The survival curve indicated that patients with high KLF10 expression had a significantly shorter overall survival (HR = 1.26, 95% confidence interval, 1.05–1.52, p < 0.05) than those with low KLF10 expression (Figure 1A).Figure 1KLF10 promotes the abilities of proliferation and invasion in breast cancer cells(A) Kaplan-Meier survival analysis of patients with breast cancer stratified by KLF10 expression levels. Data were retrieved from the online website (http://kmplot.com/analysis/). The “Number at risk” is a crucial component of the Kaplan-Meier plot, presented as a table beneath the survival curve. It provides the foundational sample size data for the probability estimates at each corresponding time point on the curve.(B) Endogenous expression of KLF10 in various breast cancer cell lines, including ZR-75-30, T47D, MCF7, and MDA-MB-231. The Western blotting images were cropped, and the original images were supplied in “Data S1.”(C) Western blotting analysis of the overexpression of Flag-KLF10 and GFP-KLF10 fusion proteins in ZR-75-30 cells transfected with Flag-tagged KLF10 or GFP-tagged KLF10 expression construct, as well as the endogenous KLF10 in MDA-MB-231 cells transfected with siKLF10 #1 and siKLF10 #2. The Western blotting images were cropped, and the original images were supplied in “Data S1.”(D) Cell morphology of ZR-75-30 transfected with either GFP-KLF10 expression vector or the corresponding control vector. Scale bars, 50 μm. The MTT assay showing cell growth after Flag-KLF10 overexpression in ZR-75-30 cells (E), and KLF10 knockdown in MDA-MB-231 cells (F).Scratch wound healing assay was performed to investigate the cellular migration resulting from the ectopic expression of GFP-KLF10 in ZR-75-30 cells (G) and from the knockdown of KLF10 using siKLF10 #1 and siKLF10 #2 in MDA-MB-231 cells (H) (left). Quantification of cell migration rate (right). Scale bars,: 50 μm. Transwell invasion assay was used to evaluate invasive ability in ZR-75-30 cells upon ectopic GFP-KLF10 expression (I) and in MDA-MB-231 cells upon KLF10 knockdown with siKLF10 #1 and #2 (J) (left). Quantification of the invasive cells (right). Scale bars, 50 μm. All experiments were performed with three independent biological replicates. The data are expressed as means ± SDs. p < 0.05, significant.
Breast cancer can be classified into three major subtypes based on the expression status of estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor 2 (HER2): hormone receptor-positive/HER2-negative, HER2-positive, and triple-negative.30 Given the prominent activation of the NF-κB pathway in HER2-positive and triple-negative breast cancer,7^,^31 we therefore chose the ZR-75-30 and MDA-MB-231 cell lines for the NF-κB investigation. As shown in Figure 1B, KLF10 expression is markedly lower in ZR-75-30 cells than in MDA-MB-231 cells. Therefore, ZR-75-30 cells were selected for overexpression experiments, while MDA-MB-231 cells were chosen for knockdown studies. Next, we assessed the promotive effect of KLF10 on the abilities of proliferation and metastasis in breast cancer cells. We first used Western blot to validate the overexpression of Flag-KLF10 and GFP-KLF10 proteins, as well as the knockdown efficiency of siKLF10 #1 and siKLF10 #2 (Figure 1C). In the morphological observation, cells transfected with GFP-KLF10 displayed mesenchymal-like morphology, manifesting more extended pseudopodia around cells (Figure 1D). KLF10 overexpression in ZR-75-30 cells enhanced proliferation, while its knockdown in MDA-MB-231 cells suppressed it, as determined by MTT assay (Figures 1E and 1F). Scratch wound healing and Transwell assays showed that KLF10 overexpression in ZR-75-30 cells enhanced cell migration and invasion (Figures 1G and 1I), whereas its knockdown in MDA-MB-231 cells suppressed these processes (Figures 1H and 1J). Overall, these results suggested that KLF10 could promote the progression of breast cancer.
KLF10 activates nuclear factor kappaB signaling and alters p65 and IκBα expressions in breast cancer cells
To investigate the molecular basis of KLF10-driven tumor progression, we performed a comprehensive screening of downstream signaling pathways using luciferase reporter assays. Notably, the NF-κB signaling cascade was prominently activated by KLF10, as evidenced by a significant enhancement in NF-κB-responsive promoter activity (2.6-fold increase, p < 0.01 in HEK 293T cells, Figure 2A; 2.5-fold increase, p < 0.001 in ZR-75-30 cells; Figure 2B). Reverse transcription-PCR and quantitative real-time PCR assays revealed that KLF10 overexpression significantly increased the RELA (encoding p65) mRNA level, but had no effect on the mRNA expressions of NFKB1 (encoding p50) and IKBA (encoding IκBα) in ZR-75-30 cells (Figures 2C and 2D). At the protein level, GFP-KLF10 overexpression in ZR-75-30 cells showed either p65 upregulation or IκBα downregulation, whereas the p50 level was unaffected (Figure 2E). Conversely, KLF10 knockdown in MDA-MB-231 cells mirrored these effects, reducing p65 and elevating IκBα, without impacting p50 (Figure 2F). Taken together, these findings suggested that KLF10 could either increase p65 expression or reduce IκBα protein levels to activate the NF-κB pathway.Figure 2KLF10 activates NF-κB signalingLuciferase reporter gene assays assessing the promoter activities of NF-κB target gene in HEK 293T (A) or ZR-75-30 (B) cells after transfection with different doses of GFP-KLF10. For the luciferase reporter assay, the four experimental groups were administered GFP-KLF10 construct at concentrations of 0, 0.5, 1.5, and 3 μg/mL, respectively.(C) Reverse transcription-PCR analysis of NFKB1, RELA, IKBA, and KLF10 mRNA in ZR-75-30 cells following transfection with either GFP-KLF10 expression vector or the corresponding control vector (left). The DNA gels were cropped, and the original images were supplied in “Data S1.” Quantitative analysis of KLF10, NFKB1, RELA, and IKBA mRNA expression levels normalized to GAPDH as an endogenous control (right).(D) Real-time PCR analysis of KLF10, NFKB1, RELA, and IKBA mRNA levels in ZR-75-30 cells when transfected with either GFP-KLF10 expression vector or the corresponding control vector. Western blotting was performed to analyze the protein levels of endogenous p50, p65, and IκBα following KLF10 overexpression in ZR-75-30 cells (E) or KLF10 knockdown in MDA-MB-231 cells (F). The Western blotting images were cropped, and the original images were supplied in “Data S1.” The data are expressed as means ± SDs. NS, not significant. p < 0.05, statistically significant.
KLF10 increases RELA transcription and p65 expression
To further validate that the KLF10-mediated regulation of p65 occurs at the transcriptional level, we performed reverse transcription-quantitative PCR analysis in ZR-75-30 cells that underwent transfection with different doses of KLF10. As participated, the RELA mRNA exhibited a dose-dependent increase upon transfection with escalating doses of the KLF10 expression construct (Figure 3A). Consequently, Western blot analysis revealed a dose-dependent upregulation of p65 protein level in ZR-75-30 cells (Figure 3B) following transfection with increasing concentrations of GFP-tagged KLF10 expression vector. To validate the binding of KLF10 to the RELA promoter region, a ChIP assay was conducted in HEK 293T cells. As shown in Figure 3C, a DNA band was immunoprecipitated from cells expressing GFP-KLF10 using an anti-GFP antibody, indicating a specific interaction between KLF10 and RELA promoter. These results indicated that KLF10 could markedly upregulate RELA transcription to increase p65 protein expression.Figure 3KLF10 upregulates RELA expression at the transcription level(A) Reverse transcription-PCR analysis of RELA mRNA expression levels in ZR-75-30 cells following transfection with increasing concentrations of GFP-tagged KLF10 expression vector (left). The DNA gels were cropped, and the original images were supplied in “Data S1.” Quantification of the RELA mRNA level normalized to GAPDH (right).(B) Western blotting analysis of endogenous levels of p65 in ZR-75-30 cells following transfection with escalating concentrations of GFP-tagged KLF10 expression construct. The Western blotting images were cropped, and the original images were supplied in “Data S1.”(C) ChIP-PCR analysis of the RELA promoter region was conducted in GFP-KLF10-expressing HEK 293T cells using anti-GFP antibody, with IgG as the negative control. The DNA gels were cropped, and the original images were supplied in “Data S1.” Western blotting analysis of endogenous p65 and phosphorated p65 expressions in MDA-MB-231 cells (D) and ZR-75-30 cells (E) overexpressing GFP-KLF10 treated with phosphatase inhibitor. The Western blotting images were cropped, and the original images were supplied in “Data S1.” The data are expressed as means ± SDs. p < 0.05, statistically significant.
As phosphorylated p65 (p-p65) is tightly associated with NF-κB activity,32 we applied a phosphatase inhibitor to identify the alteration of p-p65 caused by KLF10. Immunoblotting showed that KLF10 overexpression could potently increase p65 and p-p65 protein levels in MDA-MB-231 (Figure 3D) and ZR-75-30 (Figure 3E) cells when phosphatase inhibitor was used. Overall, these data revealed that KLF10 may upregulate p65 and p-p65 levels to promote NF-κB activation.
KLF10 interacts with IκBα and facilitates its protein degradation
Since KLF10 could downregulate IκBα protein level (Figures 2E and 2F), but had no effect on IKBA mRNA level (Figures 2C and 2D), we speculated that KLF10 might promote IκBα protein degradation at the posttranslational level. Exogenous protein expression analysis by Western blotting demonstrated that ZR-75-30 cells transfected with GFP-tagged KLF10 showed a significant downregulation of Myc-tagged IκBα protein (Figure 4A). Moreover, GFP-KLF10 could be detected in the Myc-IκBα immunoprecipitates, indicating a protein interaction between exogenous KLF10 and IκBα (Figure 4B). To determine whether the KLF10-mediated downregulation of IκBα involves proteasomal degradation pathways, we treated cells with MG132, a specific proteasome inhibitor, to assess the potential contribution of the ubiquitin-proteasome system to IκBα protein regulation. The KLF10-induced downregulation of endogenous IκBα was effectively reversed upon MG132 treatment (Figure 4C), demonstrating that KLF10 reduces IκBα protein levels through a proteasome-dependent degradation. Taken together, the above data suggested that KLF10 activated NF-κB signaling by either upregulating RELA transcription or by promoting IκBα degradation.Figure 4KLF10 interacts with IκBα and promotes IκBα protein degradation(A) Western blotting analysis of Myc-IκBα after GFP-KLF10 overexpression in ZR-75-30 cells (left). The Western blotting images were cropped, and the original images were supplied in “Data S1.” Quantitative analysis of Myc-IκBα protein levels normalized to β-actin as the control (right).(B) CoIP assay was performed in HEK 293T cells following transfection with either GFP-tagged KLF10 alone or in combination with Myc-tagged IκBα. Immunoprecipitated Myc-IκBα complexes were subsequently analyzed by immunoblotting using anti-GFP and anti-Myc antibodies. ∗, non-specific bands. The Western blotting images were cropped, and the original images were supplied in “Data S1.”(C) Western blotting analysis of endogenous IκBα protein expression in ZR-75-30 cells expressing GFP-tagged KLF10, treated with or without 10 μM MG132 for 8 h (left). Quantitative analysis of IκBα protein levels normalized to β-actin as an endogenous control (right). The Western blotting images were cropped, and the original images were supplied in “Data S1.” The data are expressed as means ± SDs. p < 0.05, statistically significant.
KLF10 upregulates nuclear factor kappaB target genes and is positively associated with its target gene expression
We applied a quantitative real-time PCR assay to check the mRNA levels of NF-κB target genes upon KLF10 overexpression. As shown in Figures 5A–5H, when transfected KLF10 into ZR-75-30 cells (Figure 5A), the target genes of NF-κB signaling were upregulated, including TNF (Figure 5B), VEGFA (Figure 5C), PLAU (Figure 5D), MMP9 (Figure 5E), ICAM1 (Figure 5F), CCND1 (Figure 5G), and MYC (Figure 5H). To validate the clinical relevance of our findings in breast cancer, we performed correlation analysis using large-scale genomic datasets obtained from the cBioPortal database. In a TCGA dataset of “Breast Invasive Carcinoma” involving 816 subjects, KLF10 mRNA level was positively associated with PLAU (Figure 5I), ICAM1 (Figure 5J), CCND1 (Figure 5K), and MYC (Figure 5L) mRNA levels according to the Spearman’s and Pearson’s correlation analyses. Overall, KLF10 could upregulate NF-κB targets and was positively correlated with the NF-κB pathway in breast cancer tissues.Figure 5KLF10 upregulates the target genes of NF-κB signaling in breast cancerReal-time PCR of TNF (B), VEGFA (C), PLAU (D), MMP9 (E), ICAM1 (F), CCND1 (G), and MYC (H) in KLF10-transfected ZR-75-30 cells. The data are expressed as means ± SDs (n = 3). Correlation analysis between the mRNA levels of KLF10 and NF-κB downstream targets (PLAU, ICAM1, CCND1, MYC; I-L) in breast cancer cohorts from the TCGA dataset (Dataset: “Breast Invasive Carcinoma,” 816 samples, TCGA, Cell 2015) in the cBioPortal website (https://www.cbioportal.org/). p < 0.05, significant.
KLF10 promotes breast cancer cell metastasis, and its expression shows a positive correlation with p65 and a negative correlation with IκBα in vivo
To observe the promotive effect of KLF10 on cancer progression in vivo, the 4T1 cell line, which is a triple-negative murine breast cancer cell line, and BALB/c mice were used for in vivo investigation. Compared with the control (4T1-Ctrl: mice injected with 4T1 cells harboring control vector), mice intravenously injected with cells stably expressing GFP-KLF10 (4T1-KLF10) exhibited obvious weight loss (Figure 6A). Additionally, both lung tumor size and weight were significantly increased in the 4T1-KLF10 group compared to the 4T1-Ctrl group (Figure 6B). HE staining confirmed that lungs in the 4T1-KLF10 group showed the greatest metastatic nodules among the three groups (Figure 6C), suggesting that KLF10 may promote breast cancer lung metastasis. Furthermore, immunohistochemical analysis of lung tissue sections revealed significantly elevated KLF10 expression levels in the 4T1-KLF10 group compared to the 4T1-Ctrl group (Figures 7A and 7B). Additionally, p65 expression was markedly increased in the 4T1-KLF10 group relative to controls (Figures 7A and 7C). IκBα expression was markedly decreased in the 4T1-KLF10 group compared to the control group (Figures 7A and 7D). Quantitative analysis revealed a robust positive correlation between KLF10 and p65 protein levels (R^2^ = 0.8276, p < 0.001; Figure 7E), and a strong inverse correlation between KLF10 and IκBα (R^2^ = 0.6622, p < 0.01; Figure 7F) in breast cancer metastatic lesions, as determined by Pearson’s correlation test. Collectively, KLF10 upregulated p65 protein and downregulated IκBα expression in breast tumors, and promoted breast cancer cell metastasis in vivo.Figure 6KLF10 promotes the lung metastasis of 4T1 cells in BALB/c mice(A) The line graph illustrates the body weights of BALB/c mice following the intravenous administration of either normal saline or 4T1 cells transfected with GFP-KLF10 versus a control vector.(B) Lung tumor imaging data (left) and corresponding quantitative tumor weight measurements (right) are presented.(C) HE staining of lung tissues in three groups (NS: injection of normal saline; 4T1-Ctrl: injection of 4T1 cells transfected with a control vector; 4T1-KLF10: injection of 4T1 cells transfected with GFP-KLF10) (left). Scale bars, 50 μm. Quantification of the metastatic area of lungs in different mouse groups (right). The data are expressed as means ± SDs (n = 3). p < 0.05, significant.Figure 7KLF10 expression shows a positive correlation with p65 and a negative correlation with IκBα in metastatic breast tumors in vivo(A) IHC analysis reveals distinct expression patterns of KLF10, p65, and IκBα subunits in pulmonary metastatic tumors from BALB/c mice inoculated with GFP-KLF10-transfected 4T1 cells, compared to vector-transfected controls. Scale bars, 50 μm. KLF10 (B), p65 (C), and IκBα (D) protein levels in the three groups (NS: injection of normal saline; 4T1-Ctrl: injection of 4T1 cells transfected with a control vector; 4T1-KLF10: injection of 4T1 cells transfected with GFP-KLF10). The correlations between KLF10 and p65 expression levels (E), as well as between KLF10 and IκBα (F), were determined using Pearson’s correlation analysis. The data are expressed as means ± SDs (n = 5). p < 0.05, significant.
Discussion
In this study, we first report that KLF10 activates NF-κB signaling to promote breast cancer progression. First, KLF10 was found to promote breast cancer cell proliferation and metastasis. Second, KLF10 could increase NF-κB activity either by upregulating RELA transcription or by promoting IκBα degradation. Third, KLF10 significantly upregulated NF-κB target genes and showed a strong positive association with NF-κB signaling pathway activity in the TCGA database. Finally, in vivo data also confirmed the effect of KLF10 on breast oncogenesis. Hyperactivation of NF-κB signaling is related to the progression of various human cancers, including breast cancer.33 Since the continuous activation of NF-κB signaling was seen mostly in hormone-negative cancers,34 and was found in 86% of HER2-positive cancers,31^,^35 we therefore chose the HER2-positive breast cancer cell line ZR-75-30 and the triple-negative breast cancer cell line MDA-MB-231 to explore the NF-κB axis. This work emphasizes that KLF10 acts as an oncoprotein to activate NF-κB signaling, revealing a novel therapeutic target against the KLF10/NF-κB cascade in breast cancer.
KLF10, belonging to the Krüppel-like transcription factor family, may recognize the GC-rich or GT-box elements to regulate gene transcription.12 Previously, KLF10 could behave as a tumor suppressor to play an important role in inhibiting cell proliferation and inducing apoptosis, probably through the facilitation of the TGF-β/Smad pathway.36 Recently, emerging evidence suggests that KLF10 may act as an oncoprotein to promote the proliferation and metastasis of several cancers, including osteosarcoma,20 hepatocellular carcinoma,22 hepatectomized mouse model,24 and head and neck squamous cell carcinoma.28 Hence, besides the TGF-β/Smad signaling, it is necessary to explore the other pathways related to the effects of KLF10 on carcinogenesis. Therefore, the functions and the underlying mechanisms of KLF10 in tumors, characterized by specific gene expression profiles and cellular microenvironment, should be better understood. Our study depicts a novel mechanism of KLF10 in cancer promotion, highlighting the participation of NF-κB signaling in this process.
The NF-κB signaling plays a critical role in tumorigenesis, and the extent of its activation is closely associated with the malignancy of cancer,3^,^37 including breast cancer.38 Therefore, the identification of the cause of aberrantly activated-NF-κB is essential for targeted therapy in cancer treatment. Concerning the association of the KLF family members with the NF-κB pathway, KLF5 has been reported to promote the tumorigenesis of thyroid cancer via the NF-κB signaling.39 KLF6 could inhibit cancer metastasis by reducing NF-κB activity in glioblastoma.40 Moreover, KLF8 has been shown to act as a cancer promoter by activating NF-κB in breast cancer.41 Our previous study indicated that KLF9 may suppress breast cancer metastasis by inhibiting the NF-κB pathway, especially emphasizing the MMP9 function in this process.3^,^42 As mentioned above, we concluded that KLF members could either inhibit or enhance NF-κB activity to play roles in cancer progression, depending on the cell type, cellular context, and the functional domain of the KLF protein. Based on our findings, KLF10 was identified to activate NF-κB signaling through a dual mechanism involving both the induction of RELA expression and the promotion of IκBα degradation, by which KLF10 functioned as a tumor activator in human breast cancer.
In this study, we found KLF10 as a cause of NF-κB activation in breast cancer. The underlying mechanism involves the KLF10-mediated regulation of two critical components of the NF-κB signaling pathway: RELA (p65) and its inhibitory partner IκBα. The oncogenic role of KLF10 observed in breast cancer may represent a conserved mechanism that extends to other malignancies characterized by constitutive NF-κB pathway activation. Targeting KLF10 to inactive NF-κB may provide a therapeutic strategy in the treatment of these tumors.
Limitations of the study
Efforts are still needed to deeply study the mechanism described in our study. One is that the putative binding elements in the RELA promoter should be identified by the luciferase reporter assay after constructing site-mutant reporters. In addition, the fact that KLF10 interacted with IκBα to facilitate IκBα proteasomal degradation (Figure 4) should be confirmed by the detection of ubiquitin-IκBα level upon KLF10 overexpression. Furthermore, to precisely map the interaction domains between KLF10 and IκBα, a series of truncation mutants should be generated and subsequently analyzed through CoIP assays.
Resource availability
Lead contact
Further data of this study, the related reagents, and technical protocols should be contacted to the lead contact, Xiao-Yan Bai ([email protected]).
Materials availability
This study did not generate new unique reagents.
Data and code availability
- •Data reported in this article will be shared by the lead contact upon request.
- •This article does not report original code.
- •Any additional information required to reanalyze the data reported in this article is available from the lead contact upon request.
Acknowledgments
This research was supported by grants (81802758 to X.-Y.B.) from the 10.13039/501100001809National Natural Science Foundation of China, the Basic Research Project from the Educational Committee of Liaoning Province (JYTMS20230382 to X.-Y.B.), and the Liaoning Provincial Science and Technology Plan Joint Program-General Project (2025-MSLH-015 to X.-Y.B.).
Author contributions
X-Y. B. designed and guided the research; X-Y. B. and R. T. were responsible for funds acquisition; X-W. J., J. L., and M-R. B. performed the experiments; X-Y. B. and R. T. analyzed the data; X-Y. B. wrote the article. All authors reviewed the article.
Declaration of interests
The authors declare no competing interests.
STAR★Methods
Key resources table
REAGENT or RESOURCESOURCEIDENTIFIERAntibodiesanti-FlagSigma-AldrichCat# F1804; RRID: AB_262044anti-MycSigma-AldrichCat# PLA0001; RRID: AB_3697471anti-β-actinSigma-AldrichCat# A5441; RRID: AB_476744anti-GFPSangon BiotechCat# D110008; RRID: AB_3697475anti-KLF10Sangon BiotechCat# D221327; RRID: AB_3697474anti-p50AbcamCat# ab313430; RRID: AB_3697472anti-p65BiossCat# bsm-33117M; RRID: AB_3697473anti-phosphorylated p65AbcamCat# ab76302; RRID: AB_1524028anti-IκBαAbcamCat# ab32518; RRID: AB_733068HRP-conjugated goat anti-mouse IgGZSGB-BIOCat# ZB-5305; RRID: AB_2923203HRP-conjugated goat anti-rabbit IgGZSGB-BIOCat# ZB-5301; RRID: AB_2923202Chemicals, peptides, and recombinant proteinsLipofectamine 3000InvitrogenCat# L3000015HindIIITakaraCat# 1060SXbaITakaraCat# 1093SXhoITakaraCat# 1094SBamHITakaraCat# 1010SEcoRITakaraCat# 1040STRIzol ReagentInvitrogenCat# 15596026CNprotein A-Sepharose beadsCytivaCat# 17078001MG132MacklinCat# M832899MTTSolarbioCat# M8180Crystal VioletSolarbioCat# G1063Critical commercial assaysD-LuciferinSigma-AldrichCat# L9504PrimeScript II 1st Strand cDNA Synthesis KitTakaraCat# 6210ATB Green Premix Ex Taq IITakaraCat# RR820AExperimental models: Cell linesHEK 293TProf. Huijian WuDalian University of TechnologyZR-75-30Prof. Huijian WuDalian University of TechnologyMDA-MB-231Prof. Huijian WuDalian University of Technologymurine breast cancer cell line 4T1Prof. Huijian WuDalian University of TechnologyExperimental models: Organisms/strainsBALB/c miceN/AN/AOligonucleotidesKLF10 Forward (5′ to 3′): aaagttcccatctgaaggcccaThis paperN/AKLF10 Reverse (5′ to 3′): ggttggaggtagagcaatgtcaThis paperN/ANFKB1 Forward (5′ to 3′): aacagcagatggcccataccThis paperN/ANFKB1 Reverse (5′ to 3′): aacctttgctggtcccacatThis paperN/ARELA Forward (5′ to 3′): gaatggctcgtctgtagtgThis paperN/ARELA Reverse (5′ to 3′): tggtatctgtgctcctctcThis paperN/AIKBA Forward (5′ to 3′): aggaaatacccccctacaccThis paperN/AIKBA Reverse (5′ to 3′): atcagcacccaaggacaccaThis paperN/AGAPDH Forward (5′ to 3′): tgaaggtcggagtcaacggThis paperN/AGAPDH Reverse (5′ to 3′): cctggaagatggtgatgggThis paperN/ATNF Forward (5′ to 3′): cccaggcagtcagatcatcttcThis paperN/ATNF Reverse (5′ to 3′): agctgcccctcagcttgaThis paperN/AVEGFA Forward (5′ to 3′): agggcagaatcatcacgaagtThis paperN/AVEGFA Reverse (5′ to 3′): agggtctcgattggatggcaThis paperN/APLAU Forward (5′ to 3′): agcagagacactaacgacttcThis paperN/APLAU Reverse (5′ to 3′): ttagacttaacaatcagacaccagThis paperN/AMMP9 Forward (5′ to 3′): tactgtgcctttgagtccgThis paperN/AMMP9 Reverse (5′ to 3′): ttgtcggcgataaggaagThis paperN/AICAM1 Forward (5′ to 3′): caccctagagccaaggtgacThis paperN/AICAM1 Reverse (5′ to 3′): gggccatacaggacacgaagThis paperN/ACCND1 Forward (5′ to 3′): gctgcgaagtggaaaccatcThis paperN/ACCND1 Reverse (5′ to 3′): cctccttctgcacacatttgaaThis paperN/AMYC Forward (5′ to 3′): cccttgccgcatccacgThis paperN/AMYC Reverse (5′ to 3′): cgaggtcatagttcctgttggtgThis paperN/AGAPDH Forward (5′ to 3′): aggtcggagtcaacggattt (for real-time PCR)This paperN/AGAPDH Reverse (5′ to 3′): tagttgaggtcaatgaaggg (for real-time PCR)This paperN/ARELA promoter sense (5′ to 3′): ACAAAGTGAGTAATCGGCGGACCThis paperN/ARELA promoter antisense (5′ to 3′): AGAGGCGGAAATGCGCCGCGThis paperN/AsiRNA KLF10 #1 sense: GGCAGAUGUUGAUGAGAAATTThis paperN/AsiRNA KLF10 #1 antisense: UUUCUCAUCAACAUCUGCCTTThis paperN/AsiRNA KLF10 #2 sense: CAACAAGUGUGAUUCGUCATTThis paperN/AsiRNA KLF10 #2 antisense: UGACGAAUCACACUUGUUGTTThis paperN/AsiRNA control sense: UUCUCCGAACGUGUCACGUTTThis paperN/AsiRNA control antisense: ACGUGACACGUUCGGAGAATTThis paperN/ASoftware and algorithmsGraphPad Prism 7GraphPadN/APhotoshop CS6AdobeN/AImageJNIHN/A
Experimental model and study participants details
Cell culture and transfection
Human HEK 293T cell line, human breast cancer cell lines (ZR-75-30 and MDA-MB-231), and murine breast cancer cell line 4T1 used in the present study were gifts from Dalian University of Technology. HEK 293T and MDA-MB-231 cells were maintained in DMEM medium (Gibco, Thermo Fisher Scientific, Waltham, MA, USA). ZR-75-30 and 4T1 cells were cultured in RPMI-1640 medium (Gibco, Thermo Fisher Scientific, Waltham, MA, USA). All culture media were supplemented with 10% fetal bovine serum (Biological Industries, BI) and 1% penicillin/streptomycin at 37°C in a 5% CO_2_ humidified atmosphere. Upon reaching 70–80% confluence, the cells were transfected with the plasmids using Lipofectamine 3000 (Invitrogen) in accordance with the manufacturer’s protocol.
Mouse model of metastasis
BALB/c mice (Female, 6–8 weeks old) were purchased from the Animal Laboratory Center of Dalian Medical University (Dalian, China) and housed under specific pathogen-free (SPF) conditions. All animal experiments were consistent with the guidelines of Ethics Committee, and approved by the Institutional Animal Care and Use Committee (IACUC) (IACUC permit number: DW2018-026) of the Medical College of Dalian University. Following randomization into experimental groups, mice received a tail vein injection of 4T1 cells (5×10^6^ cells in 100 μL normal saline) that had been transfected with either the pEGFP-N3-KLF10 construct (encoding human KLF10) or a control vector. After 10 days of feeding, the mice were euthanized, followed by immediate surgical dissection of lungs. The harvested lung tissues were weighed and processed for histopathological examination using hematoxylin and eosin (HE) staining and IHC analysis.
Method details
Plasmids
The coding sequence (CDS) of human KLF10 was directionally cloned into the pCMV10.0-Flag vector using HindIII and XbaI restriction sites, and into the pEGFP-N3 vector using XhoI and BamHI sites. The human IκBα CDS was PCR-amplified and subsequently subcloned into the pcDNA3.1-Myc construct through EcoRI and XhoI restriction sites. The pNF-κB-luciferase reporter plasmid was commercially obtained from Promega (Madison, WI, USA). The proteasome inhibitor MG132 (catalog number: M832899) was acquired from Macklin Biochemical Co., Ltd (Shanghai, China).
Small interfering RNA (siRNA) and transfection
Two independent siRNA sequences against the endogenous KLF10 transcript were commercially synthesized by Sangon Biotech (Shanghai, China) to knock down its expression. The corresponding sequences and control siRNA were listed in the “key resources table”. Upon reaching 70–80% confluence, the cells were transfected with 50 nM siRNA using Lipofectamine 3000 (Invitrogen). Following an incubation period of 24–48 h, the cells were collected and prepared for analysis by western blot and various functional assays.
Luciferase reporter assay
Promoter activity was measured through the luciferase reporter system. In brief, cells were planted in a 24-well plate and cultured for 24 h. The firefly luciferase reporter and β-galactosidase reporter constructs were cotransfected into cells. The luciferase activity, quantified as bioluminescence intensity in the cell lysates, was quantified using a Centro LB 960 microplate luminometer (Berthold Technologies, Bad Wildbad, Germany), which should be normalized to the β-galactosidase activity.
RNA extraction and reverse transcription-PCR
Total RNA was isolated and subsequently subjected to reverse transcription to generate complementary DNA (cDNA) following established protocols.42^,^43 The forward and reverse primers utilized for quantitative mRNA level analysis were shown in the “key resources table”. All PCR products were analyzed by electrophoresis on a 1% agarose gel.
Real-time PCR assay
The cDNA was synthesized through reverse transcription of total RNA isolated from breast cancer cells, following previously established protocols.42^,^43 The mRNA levels of target genes, which were normalized against GAPDH, were measured by using the CFX Connect Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA) in conjunction with TB Green Premix Ex Taq II (Takara). The forward and reverse primers employed for quantitative mRNA analysis were shown in the “key resources table”.
Western blot, coimmunoprecipitation, and chromatin immunoprecipitation assays
Western blot, coimmunoprecipitation (CoIP), and chromatin immunoprecipitation (ChIP) assays were performed according to previously established protocols.3^,^44 For the CoIP assay, cell lysates were prepared and subsequently incubated with target-specific antibodies followed by protein A-Sepharose beads (ab193256, Abcam, Cambridge, MA, USA) at 4°C overnight to allow for immune complex formation. The immunoprecipitated complexes were analyzed by western blotting. For the ChIP assay, the primer sequences designed for targeting the RELA promoter region were shown in the “key resources table”. This amplified product, which spans 270 base pairs (bp), encompassed the core regulatory elements of the p65 promoter region.45^,^46
Cell proliferation assay
Cell proliferation was measured by using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) for cell viability. Cells were cultured in 96-well plates and then transfected with plasmids for about 24 h. Then, 10 μL MTT (5 mg/mL) reagent was added to each plate and incubated for 4 h. The insoluble formazan product was dissolved by adding 100 μL DMSO.47 Finally, the concentration of formazan in samples was quantified by absorbance measurement at 490 nm using a microplate reader (model 680, Bio-Rad, Hercules, CA, USA).
Scratch wound healing and Transwell invasion assays
Scratch wound healing assay was performed to determine the cell migration ability. Briefly, cells in each dish were scratched vertically by pipette, and cultured for 36 h. Then, the scratches of cells were photographed, and the horizontal distance was measured to calculate the migration rate during a 36-h period. For the Transwell invasion assay, cells were implanted in a chamber with a Matrigel-coated membrane (BD, Bioscience). After being cultured for 24 h, cells passed through the membrane were stained and counted.
Immunohistochemistry
The KLF10, p65 and IκBα protein expressions in lung tissues were detected by immunohistochemistry (IHC) assay. In immunohistochemical analysis, brown staining indicated positive protein expression, whereas blue staining represented the absence or negative expression of the target protein. The quantification of positively stained proteins was assessed as described previously.42^,^44
Microarray dataset analysis
The correlation analysis of protein co-expression patterns was performed using clinical transcriptomics data obtained from the cBioPortal for Cancer Genomics (http://www.cbioportal.org/), which integrates multi-omics datasets from The Cancer Genome Atlas (TCGA) program. The mRNA expression data were detected by the Illumina HiSeq RNA Sequencing version 2 (RNA-Seq by Expectation Maximization, RSEM) platform.
Quantification and statistical analysis
The data are presented as means ± SDs from at least three independent experiments. An unpaired t test was used when two independent groups were compared. One-way analysis of variance was applied when there were comparisons among three or more groups. The degree of correlation between the two factors was analyzed by linear regression method. Statistical significance was determined using a two-tailed statistical test, with p-values <0.05 considered statistically significant.
The reference list from the paper itself. Each links out to its DOI / PubMed record.
- 1Bray F.Laversanne M.Sung H.Ferlay J.Siegel R.L.Soerjomataram I.Jemal A.Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries CA Cancer J. Clin.74202422926310.3322/caac.2183438572751 · doi ↗ · pubmed ↗
- 2Lan T.Lu Y.He J.Zhan C.Wang X.Shao X.Hu Z.Global, reginal, national burden and risk factors in female breast cancer from 1990 to 2021 i Science 27202411104510.1016/j.isci.2024.111045 PMC 1149172339435147 · doi ↗ · pubmed ↗
- 3Bai X.Y.Li S.Wang M.Li X.Yang Y.Xu Z.Li B.Li Y.Xia K.Chen H.Wu H.Kruppel-like factor 9 down-regulates matrix metalloproteinase 9 transcription and suppresses human breast cancer invasion Cancer Lett.412201822423510.1016/j.canlet.2017.10.02729107105 · doi ↗ · pubmed ↗
- 4Ortiz M.M.O.Andrechek E.R.Molecular Characterization and Landscape of Breast cancer Models from a multi-omics Perspective J. Mammary Gland Biol. Neoplasia 2820231210.1007/s 10911-023-09540-237269418 PMC 10239388 · doi ↗ · pubmed ↗
- 5Dardis G.J.Wang J.Simon J.M.Wang G.G.Baldwin A.S.An EZH 2-NF-kappa B regulatory axis drives expression of pro-oncogenic gene signatures in triple negative breast canceri Science 26202310711510.1016/j.isci.2023.107115 PMC 1031984537416481 · doi ↗ · pubmed ↗
- 6Pavitra E.Kancharla J.Gupta V.K.Prasad K.Sung J.Y.Kim J.Tej M.B.Choi R.Lee J.H.Han Y.K.The role of NF-kappa B in breast cancer initiation, growth, metastasis, and resistance to chemotherapy Biomed. Pharmacother.163202311482210.1016/j.biopha.2023.11482237146418 · doi ↗ · pubmed ↗
- 7Piao H.L.Yuan Y.Wang M.Sun Y.Liang H.Ma L.alpha-catenin acts as a tumour suppressor in E-cadherin-negative basal-like breast cancer by inhibiting NF-kappa B signalling Nat. Cell Biol.16201424525410.1038/ncb 290924509793 PMC 3943677 · doi ↗ · pubmed ↗
- 8Merkhofer E.C.Cogswell P.Baldwin A.S.Her 2 activates NF-kappa B and induces invasion through the canonical pathway involving IK Kalpha Oncogene 2920101238124810.1038/onc.2009.41019946332 PMC 2829103 · doi ↗ · pubmed ↗