CAPZA1 Suppressed the Progression of Esophageal Squamous Cell Carcinoma by Binding to hnRNP K and PTPB1 to Influence Its mRNA Stability
Nan Kang, Yunwei Ou, Shichao Guo, Jie Chen, Dan Li, Qimin Zhan
TL;DR
This study shows that the CAPZA1 gene variant T suppresses esophageal cancer by stabilizing its mRNA through interactions with specific proteins, while the G variant reduces this effect.
Contribution
The study reveals a novel post-transcriptional regulatory mechanism of CAPZA1 in ESCC involving RNA-binding proteins and genotype-specific mRNA stability.
Findings
CAPZA1[T] inhibits ESCC cell migration and invasion by binding to hnRNP K and PTBP1, stabilizing its mRNA.
CAPZA1[G] promotes mRNA decay via UPF1, reducing tumor suppression.
CAPZA1 genotype influences tumor aggressiveness and could serve as a prognostic marker in ESCC.
Abstract
Esophageal squamous cell carcinoma (ESCC) is one of the most aggressive and prevalent cancers in China, a deeper understanding at the molecular level is the cornerstone for advancing precision oncology in ESCC. This study aims to investigate the role of CAPZA1 in ESCC progression. Based on our previous whole genome sequencing (WGS) and whole exome sequencing (WES) data indicating frequent copy number loss of CAPZA1 in ESCC, as well as the presence of a specific single nucleotide polymorphism (SNP, rs373245753 T>G) in its 3′UTR via the dbSNP database (https://www.ncbi.nlm.nih.gov/snp/), we sought to determine the functional and mechanistic impact of CAPZA1 genotypes on ESCC cell behavior. We identified the SNP rs373245753 within the 3′UTR of the CAPZA1 gene via the dbSNP database. To investigate its functional impact, we established stable ESCC cell lines overexpressing either the…
Genes, proteins, chemicals, diseases, species, mutations and cell lines named across the full text — each resolved to its canonical identifier and authoritative record.
Click any figure to enlarge with its caption.
FIGURE 1
FIGURE 2
FIGURE 3
FIGURE 4| Sample | CNV type |
|---|---|
| ESCC‐128T | Loss |
| ESCC‐162T | Gain |
| ESCC‐5B0276T4 | Loss |
| ESCC‐5B0584T1 | Loss |
| ESCC‐EC.BT18 | Loss |
| ESCC‐Z5B0296 | Loss |
| ESCC‐Z5B0306 | Loss |
| ESCC‐Z5C0040 | Loss |
| ESCC‐3N01.VS.3T01 | Loss |
| ESCC‐1N01.VS.1T01 | Loss |
| Number | Protein | NCBI | Mass (kDa) | Functions |
|---|---|---|---|---|
| 1 | Non‐POU domain‐containing octamer‐binding protein isoform 2 | 224028248 | 43.8 | Encoding RNA‐binding proteins playing in transcriptional regulation, RNA splicing |
| 2 |
| 14165466 | 57.2 | Pre‐mRNA processing and other aspects of mRNA metabolism and transport |
| 3 |
| 0.530391071 | 48.5 | Pre‐mRNA processing and other aspects of mRNA metabolism and transport |
| 4 | Pyruvate kinase PKM isoform d | 332164777 | 49.9 | Interaction with thyroid hormones and mediating cellular metabolic effects induced by thyroid hormones |
| 5 | Heterogeneous nuclear ribonucleoprotein R isoform X1 (hnRNP R) | 530360771 | 70.9 | Pre‐mRNA processing and other aspects of mRNA metabolism and transport |
| 6 | Probable ATP‐dependent RNA helicase DDX5 isoform X1 | 530411696 | 69.1 | Unknown |
- —Natural Science Foundation of Beijing Municipality10.13039/501100005089
- —National Natural Science Foundation of China10.13039/501100001809
- —National Key Research and Development Program of China10.13039/501100012166
- —the Research and Development Fund of Peking University People’s Hospital
Peer Reviews
No public reviews on file for this paper yet. If you reviewed it on a platform where reviews are public (OpenReview, ICLR, NeurIPS, ICML), you can paste yours below so the community can read it here.
Videos
No videos yet. Explain this paper in a talk, walkthrough, or lecture? Add one.
Taxonomy
TopicsRNA Research and Splicing · Nuclear Structure and Function · PI3K/AKT/mTOR signaling in cancer
Introduction
1
Esophageal cancer is one of the most common malignancies worldwide and is associated with high morbidity and mortality rates. As one of the most fatal malignancies globally, esophageal cancer has a relatively high incidence in Eastern Asian and Eastern African countries compared to Western countries [1, 2, 3]. Esophageal cancer has two main histological subtypes: esophageal adenocarcinoma (EAC) and esophageal squamous cell carcinoma (ESCC). In China, > 80% of all esophageal cancer cases are ESCC, which is one of the deadliest cancers owing to its highly aggressive nature and poor survival rate [4, 5]. Only 15%–25% of patients survive for 5 years after their diagnosis and are often diagnosed at an advanced stage. The molecular mechanism underlying ESCC development remains largely unknown [6]. Therefore, there is an urgent need to determine the precise molecular mechanisms underlying ESCC pathogenesis.
F‐actin capping protein is a heterodimeric protein consisting of alpha (α) and beta (β) subunits. CAPZA1 (capping actin protein of muscle Z‐line alpha subunit 1) encodes the α subunit of F‐actin capping protein [7, 8]. CAPZA1 regulates the dynamic assembly of actin filaments and cell motility by binding to the barbed ends of actin filaments [7, 8]. CAPZA1 has been reported to have ectopic expression in neuroblastoma, malignant melanoma, and gastric, liver, and breast cancers [9, 10, 11, 12]. Li et al. reported that CAPZA1 deficiency induces F‐actin accumulation, which promotes cell migration and invasion in pancreatic cancer [13]. CAPZA1 regulates EMT by controlling actin cytoskeleton remodeling in hepatocellular carcinoma (HCC). Furthermore, CAPZA1 expression is negatively correlated with the migration and invasion of HCC cells, as well as the biological characteristics of primary HCC and patient prognosis [10, 14]. However, the specific functions of CAPZA1 in ESCC have not been elucidated.
According to our previous study on WGS and WES in ESCC^2^, we found that CAPZA1 exhibits 5.84% copy number loss and only 0.65% copy number gain in the ESCC sequencing cohort, then we identified a SNP (rs373245753, T>G) in the 3′UTR of the CAPZA1 gene from the single nucleotide polymorphism database (dbSNP) (https://www.ncbi.nlm.nih.gov/snp/). As we all know, SNPs and genetic variants can potentially affect the mRNA expression of target genes by binding to RNA binding proteins (RBPs) [15, 16]. Numerous studies have revealed that SNPs occurring in the 3′UTR are the most common human genetic variations and are significantly associated with the occurrence of various diseases, including ESCC [17, 18]. Researchers have identified that SNPs located in the 3′UTR modulate target mRNA translation, which is associated with tumor susceptibility by affecting the binding of microRNAs (miRNAs) or RBPs [19, 20]. However, the role of CAPZA1 in ESCC, the molecular mechanism of tumor metastasis, and its SNPs in 3′UTRs remain unknown. A comprehensive in vitro and in vivo study demonstrated that the stable overexpression of CAPZA1[T] significantly suppressed the malignancy of ESCC cells, whereas CAPZA1[G] cells attenuated this suppressive ability. Additionally, the knockdown of CAPZA1 promoted the malignancy of ESCC. Further studies revealed that CAPZA1[T] suppresses ESCC cell malignancy by increasing mRNA stability, whereas CAPZA1[G] promotes mRNA decay. Furthermore, biotin‐RNA pulldown assays, mass spectral analysis, and RNA Binding Protein Immunoprecipitation Assay (RIP) assays revealed that CAPZA1[T] was associated with hnRNP K and PTBP1, whereas UPF1 was bound to CAPZA1[G] mRNA to promote mRNA decay. IP assays indicated that PTBP1, hnRNP K, and UPF1 could interact with each other to influence mRNA stability.
The findings uncover a novel molecular mechanism which CAPZA1 acts as a tumor suppressor by binding to hnRNP K and PTPB1 to influence its mRNA stability, offering potential implications for therapeutic targeting. However, it is not known how hnRNP K and PTPB1 influence CAPZA1 mRNA stability in our research and the specific binding motif of hnRNP K and PTPB1 to CAPZA1. Specifically, a limitation of this study is the lack of clinical samples and research on its correlation with prognostic and stages. Thus, subsequent research of our study aims to elucidate the specific mechanism that influences CAPZA1 mRNA stability, and we also aim to expand the clinical cohort and the analysis of clinicopathological correlation.
Materials and Methods
2
Cell Culture and Treatment
2.1
The human ESCC cell lines KYSE2, KYSE30, KYSE70, KYSE140, KYSE180, KYSE410, KYSE450, KYSE510, and COLO680, and the human lung cancer cell line H1299 were cultured in 90% RPMI1640 medium supplemented with 10% fetal bovine serum (FBS) and antibiotics at 37°C and 5% carbon dioxide (CO_2_). KYSE150 was cultured in a 1:1 mixture of Ham's F12 medium and RPMI‐1640 medium supplemented with 2% FBS and antibiotics in a humidified atmosphere with 5% CO_2_ at 37°C. Immortalized human esophageal epithelial cell line NE3 was cultured in a 1:1 mixture of defined keratinocyte serum‐free medium (dKSFM, Gibco, Thermo Fisher Scientific Inc., Waltham, MA, USA) and EpiLife medium (Cascade Biologics Inc., Portland, OR, USA) in 5% CO_2_ at 37°C. When the cells reached 60%–70% confluence, they were transfected with the relevant plasmids using Lipofectamine^2000^ (Invitrogen, 11668027) according to the standard procedure. For siRNA transfection, the cell density was increased to 40%–50%.
RNA Extraction and Quantitative Real‐Time (qRT)‐PCR Analysis
2.2
Total RNA from ESCC cell lines used in this study was extracted using TRIzol reagent. First‐strand cDNA was synthesized using a Superscript II reverse transcriptase kit (Invitrogen, 18064014), according to the manufacturer's instructions. RT‐PCR was used to measure the expression levels of genes of interest in ESCC cell lines. RT‐PCR was performed in triplicate using the SYBR Premix Ex Taq kit (Takara, DRR420A) and a 7300 RT‐PCR system (Life Technologies), according to the manufacturer's instructions. The relative expression levels of CAPZA1, PTBP1, hnRNP K, and UPF1 were normalized to the endogenous expression of GAPDH. Primers were provided by Invitrogen as follows: CAPZA1 forward, 5′‐CGCCTGTGAAGATAGAAGGAT‐3′, reverse, 5′‐AGACTTCAGACCTCCATCTGC‐3′. PTBP1 forward, 5′‐GAGTGATCCACATCCGGAAGC‐3′, reverse, 5′‐CCTCCTC CGTGTTCATCTCGA‐3′, hnRNP K forward, 5′‐CGCCCTGCAGAAGATATGGAA‐3′, reverse, 5′‐TGTCTGGGACTGAAACACTGG‐3′, UPF1 forward, 5′‐TACTCTTCCTAGCCAGACGCA‐3′, reverse, 5′‐TCTTGGCTACACTGTCGTCCA‐3′, GAPDH forward, 5′‐GCTGAGAACGGGAAGCTTGT‐3′, reverse, 5′‐GCCAGGGGTGCTAAGCAGTT‐3′.
Cell Lysis, Western Blotting Analysis and Antibodies
2.3
Cells were homogenized in 1× PBS supplemented with 1% Nonidet P‐40, 0.2% protease inhibitor cocktail (Roche, 4693116001), and 50 mg/mL phenylmethylsulfonyl fluoride (Thermo Fisher Scientific, 36978). Lysates were purified by centrifugation, and supernatants were prepared for western blotting or immunoprecipitation using the antibodies described below. Total protein was separated by sodium dodecyl sulfate‐polyacrylamide gel electrophoresis (SDS‐PAGE) and transferred to a 0.22 μm polyvinylidene difluoride (PVDF) membrane (Merck Millipore, IPVH00010) under constant current. Membranes were incubated with the primary antibody diluted 1:500 overnight at 4°C. Subsequently, the membrane was incubated with a secondary antibody at room temperature for 1 h. Finally, luminescence analysis was performed using a chemiluminescence detection kit (Thermo Fisher Scientific, 34577). The antibodies used were as follows: anti‐CAPZA1 (Abcam, ab32083), anti‐PTBP1 (Abcam, ab5642), anti‐hnRNP K (Abcam, ab39975), anti‐UPF1 (Abcam, ab109363), anti‐β‐actin (Proteintech, 66009‐1‐Ig), and anti‐GAPDH (Cell Signaling Technology, 2118).
Tissue Samples and Immunohistochemical (IHC) Staining
2.4
For IHC staining, the sections were rehydrated and dewaxed. After antigen repair with citrate buffer (pH 6.0), samples were treated with 3% hydrogen peroxide for 15 min to eliminate endogenous peroxidase activity. The CAPZA1 antibody (Abcam, ab234836, dilution 1:100) was incubated overnight at 4°C. After the addition of the secondary antibody, the sections were reacted with 3,3′‐diaminobenzidine for 2 min, rinsed with tap water, and stained with hematoxylin. The sections were then examined under a microscope. The study was approved by the Ethical Review Committee of Peking University People's Hospital (Approval number 2024PHB499‐001), and all the enrolled patients provided informed consent. All tissues were sectioned by paraffin embedding.
Plasmid Construction
2.5
The full‐length CAPZA1 rs373245753 [T] sequence was amplified by polymerase chain reaction (PCR) on the complementary DNA (cDNA) of ESCC cells and cloned into the BamHI/XhoI sites of the mammalian expression vector pcDNA3.1(+) (Invitrogen) to generate the pcDNA3.1(+) CAPZA1 vector. pcDNA3.1‐antisense‐CAPZA1 was constructed by subcloning antisense gadd7 into the XhoI/BamHI sites of the pcDNA3.1(−) vector (Invitrogen). The CAPZA1 rs373245753 [G] version of the cDNA with HindIII/XbaI sites was chemically synthesized by Invitrogen and inserted into pcDNA3.1(+) to create pcDNA3.1‐CAPZA1 [G].
RNA Interference
2.6
In total, 40%–50% confluent ESCC cells were transfected with 50 nM of siRNA using Lipofectamine^2000^ (Invitrogen, 11668027) following the manufacturer's instructions. All siRNAs (25‐mer duplex stealth siRNAs for CAPZA1 [Coding sequence] CDS, PTBP1, and hnRNP K) were obtained from Invitrogen. The target sequences were as follows:siRNAsSerial number CAPZA1‐stealth1HSS101357 CAPZA1‐stealth2HSS101358 CAPZA1‐stealth3HSS188720 HnRNP K‐stealth1HSS179311 HnRNP K‐stealth2HSS179312 HnRNP K‐stealth3HSS179313 PTBP1‐stealth1HSS143518 PTBP1‐stealth3HSS143520 PTBP1‐stealth3HSS183787
25‐mer siRNAs for UPF1, IGF2BP3, 3′UTR, and the target sequences are the following:siRNAsTarget sequencessiUPF1‐1CCCUGAUAAUUAUGGCGAUTTAUCGCCAUAAUUAUCAGGGTTsiUPF1‐2CCUUCCCAUCCAACAUCUUTTAAGAUGUUGGAUGGGAAGGTTsiUPF1‐3CCGAUAAACCGAUGUUCUUTTAAGAACAUCGGUUUAUCGGTT
Negative control (siNC): A scrambled, non‐targeting siRNA sequence.
Gene‐specific siRNAs: Two independent siRNAs (designated si1 and si2) were designed to target different regions of the mRNA.
Proliferation Assay
2.7
The assay was performed as previously described [2]. Briefly, cell proliferation ability was detected using the xCELLigence Real‐Time Cell Analyzer (RTCA)‐MP system (Acea Biosciences/Roche Applied Science). This platform can monitor cellular proliferation status in real time. The culture medium (50 mL) was added to each well of an E‐Plate 96 (Roche Applied Science) to obtain equilibrium. Transfected cells were incubated in 6‐well culture plates for 24 h, and 2000 cells in 100 mL of the culture medium were seeded in E‐Plate 96. The E‐Plate 96 was locked in the RTCA‐MP device at 37°C with 5% CO_2_. The measured changes in electrical impedance were presented as a cell index that directly reflects the cellular growth status on biocompatible microelectrode‐coated surfaces. The cell index was read automatically every 15 min, and the recorded growth curve was presented as the cell index SEM.
Colony Formation Assay
2.8
Transfected cells were seeded at a density of 500–1000 cells per well in 6‐well culture plates and incubated at 37°C with 5% CO_2_ for 10 days. All culture plates were performed in triplicate, and the number of colonies containing > 50 cells was counted microscopically. On day 10, the cells were washed with pre‐cooled phosphate‐buffered saline (PBS), fixed with pre‐cooled methanol for 15 min, and stained with 1% crystal violet for 20 min. The number of colonies was examined and automatically quantified using G:box (Syngene).
Transwell Migration/Invasion Assays
2.9
Migration and invasion assays were performed as previously described [2]. Cell migration and invasion were evaluated in Transwell cell culture chambers equipped with 6.5‐mm‐diameter polycarbonate membrane filters containing 8‐μm pore size. Briefly, for the migration assay, 3 × 10^4^ cells in 100 mL of serum‐free medium were seeded in the upper compartment of the chamber, and the bottom chamber was filled with 600 mL of culture medium containing 20% FBS. For the invasion assay, the upper chamber of the device was pre‐coated with 50 mL of a 2.5 mg/mL solution of Matrigel (Falcon BD, 356234). The non‐migration/invasion cells were removed by wiping the upper surface of the membrane with a cotton swab after the appropriate incubation time at 37°C with 5% CO_2_. The filters were fixed in methanol for 15 min and stained with a 1% crystal violet solution for 20 min. Five random microscopic fields per filter were counted. All experiments were performed in triplicates. For each independent experiment, three replicates were performed per group.
Animal Experiments
2.10
Twelve male BALB/c nude mice (4 weeks old, weighing 18–20 g) were fed a pathogen‐free (SPF) diet. To produce tumors in nude mice, KYSE510 cells (1 × 10^6^) transfected with CAPZA1[T] or CAPZA1[G] plasmids were injected into the axillae of the forelimbs of nude mice. Tumors were measured with a vernier caliper every 4 days after injection, and tumor volume was calculated using the following formula: length × (width)^2^/2. After 24 days, the mice were sacrificed, and the tumors were removed for examination and recording. Finally, tumor tissues were fixed with 4% paraformaldehyde for further analysis. All animal experiments were approved by the National Cancer Center/Cancer Hospital, Chinese Academy of Medical Sciences Ethics Committee for Laboratory Animals and Welfare (approval number SYXK(京)2014‐0003).
In Vitro Transcription, RNA Pulldown Assay and Mass Spectrometry Analysis
2.11
The plasmids, pcDNA3.1‐CAPZA1[T], pcDNA3.1‐CAPZA1[G], and pcDNA3.1‐antisense‐CAPZA1[T]/[G] were linearized with the corresponding restriction enzymes to prepare the template DNAs for in vitro transcription of CAPZA1[T], CAPZA1[G], or antisense. In vitro transcription of the 3′UTR and antisense 3′UTR was performed using primers containing the T7 promoter sequence as follows: 3′UTR upstream: 5′‐GATCACTAATACGACTCACTATAGGGAGAAGGCTGAATGTAGGATTCTTCA‐3′, downstream: 5′‐CAATTTTAGAACAAAACA GGTATAT‐3′, 3′UTR antisense upstream: 5′‐GATCACTAATACGACTCACTATAG GGAGACCTGATACAGAAGATAGTGTGG‐3′, and downstream: 5′‐AGGCTGAATGTAGGATTCTTC‐3′. All biotin‐labeled RNA transcripts were produced in vitro using the MEGAscript T7 kit (Ambion, AM1333) with biotin‐16‐UTP (Ambion, AM8452) and purified using the MEGAclear kit (Ambion, AM1908), according to the manufacturer's protocol. Five micromoles of biotinylated RNAs were heated to 95°C for 2 min, quickly cooled to 4°C, and then maintained at room temperature for 30 min. RNAs were mixed with 500 mg of precleared ESCC cell extracts in binding buffer (0.5% Triton X‐100), 10 mM HEPES pH 7.0, 1 mM DTT, 50 mM KCl, 1 mM EDTA, and 10% glycerol, supplemented with tRNA (0.1 mg/mL), and heparin (0.5 mg/mL). The cells were lysed using IP lysis buffer (cat. no. 87787; Thermo Fisher Scientific Inc.) and centrifuged at 12,000 × g for 10 min at 4°C. The 100‐μL lysates were subsequently added to the biotinylated probe and co‐incubated at room temperature for at least 30 min. The complexes were isolated using prepared strepavidin‐coupled Dynabeads according to the manufacturer's instructions (Thermo Fisher Scientific Inc. 11205D). Finally, the proteins were detected by Western blotting. The bands specific to CAPZA1 3′UTR were excised, and proteomic screening was performed by mass spectrometry analysis on a MALDI–TOF instrument.
RNA Binding Protein Immunoprecipitation Assay (RIP)
2.12
The RIP assay was performed using the Magna RIP RNA‐Binding Protein Immunoprecipitation Kit (Millipore, 17‐700‐12T) according to the manufacturer's instructions. Anti‐PTBP1 (Abcam, ab5642), hnRNP K (Abcam, ab39975), and anti‐UPF1 (Abcam, ab109363) were diluted (1:50). The total RNA (input control) and precipitation with isotype control (IgG) for each antibody were assessed simultaneously. Co‐precipitated RNAs were detected using qRT‐PCR.
Cycloheximide (CHX) Protein Stability Assay
2.13
To investigate the impact of CAPZA1[T] on the protein stability of ESCC, cells were inoculated in 100 mm dishes. Total protein was extracted after treating the cells for CHX (Sigma‐Aldrich, C7698) for the indicated time points (0, 4, 8, and 12 h) to inhibit protein synthesis, and the protein expression was monitored by western blotting.
RNA Stability Assay
2.14
To investigate the impact of CAPZA1[T] on the mRNA stability of ESCC, cells were inoculated in 60 mm dishes. RAN was extracted after treating the cells for Actinomycin D (Thermo Fisher Scientific, 11‐805‐017) for the indicated time‐points (0, 1, 2, 3, 4 and 5 h) to inhibit mRNA synthesis, and the mRNA abundance was monitored by qRT‐PCR.
Co‐Immunoprecipitation (Co‐IP) Assay
2.15
Briefly, total proteins were extracted from the ESCC cell lines using IP lysis buffer. Then, the lysates were incubated with the indicated primary antibodies (anti‐hnRNP K/PTBP1/UPF1 antibodies) and protein A/G sepharose beads (Santa Cruz Biotechnology, sc—2003) on a rotator (100 rpm) at 4°C overnight. The following day, the samples were washed and incubated with secondary antibodies. Then the bound proteins were collected by centrifugation, diluted, and boiled in SDS–PAGE solution. Upon the removal of beads, these samples were subjected to Western blot analysis.
Statistics in the Experiments
2.16
All experiments were performed in triplicate. All statistical analyses were performed using GraphPad Prism software (version 9.0). The data are presented as line charts or bar charts. Student's t‐test was used to compare the differences between the two groups:
One‐way ANOVA was used to compare the differences with one variable among multiple groups. The decay of mRNA over time was modeled as a first‐order exponential decay process and the “One phase decay” nonlinear regression analysis module in GraphPad Prism was used to obtain the mRNA half‐lives (t½). p < 0.05 was considered statistically significant, and statistical significance was defined as *p < 0.05, **p < 0.01, ***p < 0.001 and ****p < 0.0001.
Results
3
Characterization of
CAPZA1 in ESCC
3.1
CAPZA1 is located on chromosome 1 in human and has a length of 51,785 nt and the SNP (rs373245753, T>G) locates in the 3′UTR of the CAPZA1 gene (Figure 1A). CAPZA1 exhibits 5.84% copy number loss and only 0.65% copy number gain in our previous study on WGS and WES of ESCC^2^ (Table 1). To select appropriate cell lines for subsequent functional studies, we assessed the mRNA expression levels of CAPZA1 in ten ESCC cell lines (YSE2, KYSE30, KYSE70, KYSE140, KYSE150, KYSE180, KYSE410, KYSE450, KYSE510, and COLO680) and an immortalized human esophageal epithelial cell line by qRT‐PCR (Figure 1B). As anticipated, CAPZA1 expression was significantly lower in ESCC cell lines than that in normal cell line. Then, cell lines with intrinsically low endogenous CAPZA1 expression (KYSE180 and KYSE510) were selected for subsequent overexpression studies to investigate the biological effects resulting from its elevated expression. Conversely, cell lines with high endogenous CAPZA1 levels (YSE2 and KYSE30) were employed for knockdown studies to characterize the phenotypic changes induced by the suppression of its activity. Furthermore, IHC assays were employed to validate the CAPZA1 expression in 68 ESCC and adjacent normal epithelial tissues; the findings indicated that CAPZA1 expression in the nucleus was significantly lower in cancer tissues than in normal tissues (Figure 1C). According to The Cancer Genome Atlas (TCGA) PanCancer Atlas Studies, we observed that the CAPZA1 gene altered in 1.65% of 182 patients, which exhibits 0.55% somatic variation, 0.55% amplification, and 0.55% deep deletion in EAC (Figure 1D), but its function in ESCC still remains unexplored. Overall, CAPZA1 tends to exhibit more frequent deletion than amplification across PanCancer Atals(Figure 1D) (https://www.cbioportal.org/), which is consistent to our previous study on WGS and WES of ESCC^2^. Previous studies have demonstrated that CAPZA1 regulates EMT by controlling actin cytoskeleton remodeling in HCC [21]. Subsequently, we examined the key molecules of the EMT pathway in ESCC cells and observed that CAPZA1 promoted the expression of E‐cadherin and decreased the expression of Vimentin and Twist, suggesting that, at least in part, CAPZA1 regulates the EMT pathway in ESCC (Figure 1E).
Characterization of CAPZA1 in ESCC. (A) Location of CAPZA1 in the genome and the location of SNP (rs373245753, T>G) in the 3′UTR of the CAPZA1 gene. (B) mRNA expression levels of CAPZA1 in ESCC cell lines and the immortalized normal esophageal cell line (NE3) were measured using RT‐PCR. (C) Representative IHC images of CAPZA1 expression in ESCC tissue (top), quantitative analysis indicated that CAPZA1 expression levels were significantly high in adjacent normal epithelial tissues relative to the matched ESCC tissues in the nucleus (bottom). (D) The frequency and oncoprint of CAPZA1 somatic alterations, amplification and deep deletion in PanCancer Atals. (E) Western blotting assays were used to validate the key molecules of EMT pathways after knockdown and overexpression of CAPZA1 in KYSE30 and KYSE510 cells. All experiments were performed in triplicate (n = 3).
CAPZA1
Expression Was Negatively Correlated With the Malignant Phenotype of ESCC Cell Lines
3.2
To determine the functions of CAPZA1[T] and CAPZA1[G] in ESCC, we stably overexpressed CAPZA1[T] and CAPZA1[G] in KYSE180 and KYSE510 cells by lentiviral infection and assessed the effects of CAPZA1 on cell phenotypes. First, we evaluated the efficiency of lentiviral plasmid overexpression in the ESCC cell lines (Figure 2A). Transwell assays indicated that ESCC cell migration and invasion were reduced by CAPZA1[T] overexpression, whereas the CAPZA1[G] genotypes weakened the effects (Figure 2B). Subsequently, we administered in the subcutaneous tissue of the lower limb and observed that the growth rate of xenograft ESCC cells overexpressing CAPZA1[T] was significantly lower than that of the control, whereas CAPZA1[G] increased this ability (Figure 2C). These findings demonstrate that CAPZA1[G] is indispensable for ESCC malignancy. Furthermore, siRNAs were used to efficiently reduce mRNA expression (Figure S1A) and protein levels (Figure S1B) of CAPZA1. Our findings indicated that CAPZA1 knockdown increased cell proliferation (Figure S2A,B), migration, and invasion of the ESCC cell lines (Figure S2C), implying that CAPZA1 expression is negatively correlated with ESCC cell malignancy. These results provide insights into the central role of CAPZA1 in suppressing ESCC aggressiveness both in vivo and in vitro.
*CAPZA1[T] inhibits the migration and invasion of ESCC cells, whereas CAPZA1[G] attenuates these inhibitory effects. (A) Stably ectopic expression of wild type and mutant CAPZA1 in ESCC cell lines (KYSE180 and KYSE510) was measured using RT‐PCR, which indicated significantly higher levels of CAPZA1 mRNA. (B) Transwell assays were performed to evaluate the effect of CAPZA1[T] and CAPZA1[G] on KYSE180 and KYSE510 cell migration and invasion. The stably ectopic expression of CAPZA1[T] inhibited the migration and invasion of ESCC cells, whereas CAPZA1[G] weakened these effects. Representative images (top) and quantitative data (bottom) of cell migration and invasion. (C) Stable overexpression of CAPZA1[T] inhibited xenograft tumor formation in BALB/c nude mice, whereas CAPZA1[G] attenuated the ability of KYSE510 stable cells, as presented in the representative images (top). Quantitative analysis of the volume and weight of xenograft tumors in BALB/c nude mice. All experiments were performed in triplicate (n = 3), and the data were statistically analyzed using a two‐tailed t‐test. *p < 0.05, **p < 0.01, ***p < 0.001 and ***p < 0.0001 versus CAPZA1[T]. Error bars indicate SEM.
CAPZA1
[T] Promoted mRNA Stability of CAPZA1 by Binding to hnRNP K and PTBP1, Whereas CAPZA1 [G] Abolished This Ability
3.3
3′UTR regulates mRNA stability, subcellular location, translation efficiency, and translation rate by interacting with miRNAs or RBPs [22]. Genetic variants that modify the binding sites of RBPs in the 3′UTR can influence mRNA stability by affecting the RNA‐binding domain and sequence [23]. Therefore, we assumed that the functions of CAPZA1[T] and CAPZA1[G] in mRNA and protein stability might be influenced by this mechanism. CHX, a protein synthesis inhibitor, were treated the cells for the indicated time‐points (0, 4, 8, and 12 h) to inhibit protein synthesis, and the protein expression was monitored by western blotting(Figure 3A). Furthermore, we monitored the stability of CAPZA1 mRNA at predetermined time points after actinomycin D treatment. mRNA decay curves following actinomycin D treatment. The “One phase decay” nonlinear regression analysis module in GraphPad Prism was used to obtain the mRNA half‐lives (t½). We observed that the half‐life of CAPZA1[T] mRNA was significantly longer than that of CAPZA1[G] mRNA (Figure 3B). To clarify the mechanism of CAPZA1[T] and CAPZA1[G] mRNA stability, we performed RNA pulldown assay to identify proteins associated with CAPZA1. The biotinylated CAPZA1[T], CAPZA1[G], and the two negative control transcripts, biotinylated antisense‐CAPZA1[T] and biotinylated antisense‐CAPZA1[G], were transcribed in vitro and incubated with whole KYSE30 cell lysates. Biotin‐labeled transcripts and their associated cellular proteins were extracted using streptavidin beads and subjected to SDS‐PAGE analysis. The protein bands specific to CAPZA1[T] were extracted, digested with trypsin, and analyzed by mass spectrometry (Figure S3A and Table 2). Interestingly, the results revealed that most of the proteins bound to the CAPZA1[T] transcript were hnRNPs. To focus on the role of CAPZA1[T] in the regulation of mRNA stability, hnRNP K and PTBP1 were selected for further studies because of their functions in regulating mRNA stability. Furthermore, the association of CAPZA1[T] with hnRNP K and PTBP1 was validated using RNA pulldown assays. The results revealed that hnRNP K and PTBP1 were detected in CAPZA1[T] pulldown protein complexes but not in those associated with CAPZA1[G] or the antisense. The decay of mRNA has the opposite effect on its stability, both of which play dispensable roles in affecting mRNA abundance. Superfamily I RNA helicase (UPF1) is a key molecule involved in mRNA decay [24]. Therefore, we hypothesized that CAPZA1[G] binds UPF1 to promote mRNA decay. As expected, UPF1 specifically interacted with CAPZA1[G] in the RNA pulldown assay (Figure 3C). RIP assays were performed to confirm the endogenous association between CAPZA1[T] and hnRNP K and PTBP1 in vivo. Antibodies against hnRNP K and PTBP1 were incubated with KYSE30 cell lysates, and the co‐precipitated RNAs were analyzed by Western blotting and qRT‐PCR. We observed enrichment of CAPZA1[T], but not CAPZA1[G], with hnRNP K and PTBP1 immunoprecipitation (IP) when compared to non‐specific IgG IP. Meanwhile, UPF1 specifically interacted with CAPZA1[G] in the RIP assays (Figure 3D, Figure S3C). To further confirm the specificity of this interaction, a competition RNA pulldown assay was performed by adding different amounts of non‐biotinylated CAPZA1[T]. The interaction between CAPZA1[T], hnRNP K, and PTBP1 competed with non‐biotinylated CAPZA1[T] in a dose‐dependent manner (Figure 3E). In addition, we predicted the binding sites for hnRNP K and PTBP1 on CAPZA1[T] by RBPmap database, which was shown in the Tables S1 and S2. These results demonstrate that hnRNP K and PTBP1 specifically interact with CAPZA1[T]. Further studies will be conducted to investigate the function and mechanism of these binding motifs.
*Molecular mechanism of CAPZA1[T] suppressive function in ESCC. (A) Transient overexpression of CAPZA1[T] and CAPZA1[G] in ESCC cells was used to validate protein translation efficiency by adding 50 ng/mL cycloheximide (CHX). Total proteins were extracted at 0, 4, 8, and 12 h to analyze the protein levels of CAPZA1 using Western blotting. Protein levels remained unaffected. (B) Ectopic expressions of CAPZA1[T] and CAPZA1[G] in KYSE510 cells were used to validate the mRNA degradation ratio. The cells were treated continuously with these reagents at various times in the presence of 2 μg/mL actinomycin D. Total RNA was extracted at 0, 1, 2, 3, 4, and 5 h to analyze the expression of CAPZA1 using RT‐PCR, which was normalized to vector controls and GADPH. mRNA decay curves followed actinomycin D treatment. mRNA half‐lives (t½) were calculated directly using the “One phase decay” analysis. (C) Western blotting assays were used to validate the results of RNA pulldown and mass spectrometry analyses. hnRNP K and PTBP1 bind to CAPZA1[T], whereas UPF1 binds to CAPZA1[G], the input (left), and beads (right) as illustrated above. (D) RT‐PCR assays demonstrated that CAPZA1[T] RNA is significantly more enriched in the compounds precipitated by hnRNP K and PTBP1 proteins than CAPZA1[G] and negative controls, whereas UPF1 specifically binds to CAPZA1[G]. (E) Western blotting assays were selected to validate the findings of RNA pulldown competition assays. Various amounts of unlabeled RNA were added to compete with biotin‐labeled CAPZA1[T] and CAPZA1[G] for interaction with PTBP1, hnRNP K, and UPF1. Cell lysates (50 μg) were used as input. (F) Transient knockdown of hnRNP K in CAPZA1[T] KYSE510 cells was selected to validate mRNA degradation ratio by adding to 2 μg/mL actinomycin D. Total RNA was extracted at 0, 0.5, 1, 2, 3, 4, 5, and 6 h to analyze the expression of CAPZA1 using RT‐PCR, which were normalized to GADPH. mRNA decay curves followed actinomycin D treatment. The “One phase decay” nonlinear regression analysis module in GraphPad Prism was used to obtain the mRNA half‐lives (t½). (G) Transient knockdown of PTBP1 in CAPZA1[T] KYSE510 cells was selected to validate mRNA degradation ratio by adding to 2 μg/mL actinomycin D. Total RNA was extracted at 0, 0.5, 1, 2, 3, 4, 5, and 6 h to analyze the expression of CAPZA1 using RT‐PCR, which were normalized to GADPH. mRNA decay curves following actinomycin D treatment. mRNA half‐lives (t½) were calculated directly using the “One phase decay” analysis. (H) Total RNA of knockdown of UPF1 by siRNAs in KYSE510 cells was extracted at 0, 0.5, 1, 2, 3, 4, 5, 6, and 7 h. RT‐PCR analysis of CAPZA1 mRNA degradation ratio by adding 2 μg/mL actinomycin D in CAPZA1[G] cells and the UPF1 knockdown group, which were normalized to GADPH. mRNA decay curves following actinomycin D treatment. mRNA half‐lives (t½) were derived directly using the “One phase decay” analysis. All experiments were performed in triplicate (n = 3), and the data were statistically analyzed using a two‐tailed t‐test. (bottom) **p < 0.01 and **p < 0.001 versus CAPZA1[T]. Error bars indicate SEM.
To validate the essential role of hnRNP K and PTBP1 in maintaining the mRNA stability of CAPZA1, we overexpressed the 3′UTR [T] of CAPZA1 and knocked down hnRNP K and PTBP1, respectively, using siRNAs. The efficiency of hnRNP K and PTBP1 knockdown was demonstrated by Western blotting and qRT‐PCR (Figure S4A,B). As expected, si‐hnRNP K (Figure 3F) and si‐PTBP1 (Figure 3G) significantly reduced the mRNA stability. Conversely, its expression was significantly reduced by si‐UPF1 (Figure S4C), and mRNA stability was also increased in the overexpressed 3′UTR [G] transcript and knockdown si‐UPF1 constructs (Figure 3H), the “One phase decay” nonlinear regression analysis module in GraphPad Prism was used to obtain the mRNA half‐lives (t½). Besides, to validate the role of hnRNP K and PTBP1 in maintaining the mRNA stability of ESCC cells, we knocked down hnRNP K and PTBP1 and assessed cell malignancy using colony formation, cell growth curves, and transwell assays in CAPZA1 ESCC cells. hnRNP K and PTBP1 knockdown enhanced the malignancy of wild type CAPZA1 ESCC cells (Figure S5A), whereas elimination of UPF1 attenuated the ability of CAPZA1[T] to enhance cell malignancy (Figure S5B).
Furthermore, we assessed the existence of a tight connection between hnRNP K and PTBP1 with UPF1 to affect CAPZA1 mRNA stability using IP assays (Figure 4A). Together, this result highlights that CAPZA1[T] exerts a suppressive function in ESCC by binding to PTBP1 and hnRNP K to maintain mRNA stability, while CAPZA1[G] abolishes this ability by binding to UPF1 to reduce mRNA stability (Figure 4B).
The model of CAPZA1[T] and CAPZA1[G] function in ESCC. (A) Immunoprecipitation assays were used to evaluate the relationship between UPF1, hnRNP K, and PTBP1. (B) The model of CAPZA1[T] and CAPZA1[G] functions in ESCC. All experiments were performed in triplicate (n = 3).
Discussion
4
ESCC is the most common subtype of esophageal cancer in China, and its 5‐year mortality rate is as high as 70% [4, 5]. The lack of better therapeutic methods leads to the high occurrence and poor survival of ESCC, which remains a public health concern [25]. The long‐term outcomes of this cancer are still dismal, and studies at the molecular level have become a research hotspot.
The capping protein consists of α and β subunits and CAPZA1 encodes the α1 subunit of CAPZ. CAPZA1 expression is associated with dynamic assembly of actin filaments and cell motility [7, 8]. Except for its role in regulating actin dynamics, other physiological functions of CAPZA1 have not been elucidated, especially in tumors [7, 8]. Previous studies have indicated that CAPZA1 overexpression may be a prognostic marker in gastric cancer [26]. Moreover, polymorphisms in the CAPZA1 gene, particularly the C/C or C/T genotype at rs1800137 and the T/A or A/A genotype at rs58618380, are significantly associated with an increased risk of gastric mucosal atrophy [27]. CAPZA1 acts as an oncogenic factor and inhibits the proliferation, invasion, and migration of gastric cancer cells (both in vivo and in vitro) [28]. Huang et al. reported that hypoxia‐mediated low expression of CAPZA1 drives EMT by regulating actin cytoskeletal remodeling, thereby promoting invasion and migration of HCC cells in vitro and in vivo [14]. Li et al. reported that CAPZA1 deficiency induces F‐actin accumulation, which promotes cell migration and invasion in pancreatic cancer [13]. Differential expression of CAPZA1 has been reported to be associated with non‐small cell lung cancer [29]. Previous studies have not documented the CAPZA1 function in ESCC, nor have they examined 3′UTR variation in ESCC. The 3′UTRs of human mRNAs contain many cis‐elements that bind to trans factors and are important for developing various diseases, including cancer [30]. 3′UTRs are known to regulate mRNA stability, subcellular localization, translation efficiency, and protein–protein interactions [31, 32, 33]. Therefore, mutations, variations, and defects in these regions can significantly impact gene expression and the associated cellular viability, growth, and development.
In this study, we observed that overexpression of CAPZA1[T] decreased ESCC cell migration and invasion, which also suppressed the growth rate of xenograft ESCC in KYSE510 cells, whereas overexpression of CAPZA1[G] attenuated these effects. Furthermore, knockdown of CAPZA1 increased the proliferation, migration, and invasion of ESCC cell lines. In this report, we examined the mechanism by which CAPZA1 regulates mRNA stability. It has been demonstrated that CAPZA1 binds to and modulates the functions of proteins. RNA pulldown assays and mass spectrometry analysis revealed that PTBP1 and hnRNP K proteins are associated with CAPZA1[T]. Intriguingly, we observed that the CAPZA1 variant that emerged from a T>G transition at rs373245753 cannot be targeted by the RNA‐binding proteins hnRNP K and PTBP1, but it can bind to UPF1. PTBP1 belongs to the hnRNP family and is a multifunctional RNA/DNA‐binding protein involved in transcription, splicing, mRNA transport, and stability [34, 35, 36]. Whether PTBP1, hnRNP K, or UPF1 are necessary for CAPZA1 mRNA stability is unclear. Further rescue analysis revealed that si‐PTBP1 and si‐hnRNP K significantly reduced CAPZA1 mRNA stability and cell phenotype, whereas si‐UPF1 significantly increased CAPZA1 mRNA stability and malignancy. These results indicate that PTBP1 and hnRNP K are key molecules in maintaining CAPZA1 mRNA stability and that UPF1 plays a pivotal role in attenuating CAPZA1 mRNA stability, thereby contributing to CAPZA1's role in ESCC progression.
The most probable explanations for 3′UTR variation are the loss of regulatory sequences, such as miRNA/RBP‐binding sites, or the loss of potential secondary structures that affect the rate of translation or mRNA stability. RNA degradation plays a central role in the monitoring of RNA for aberrant mRNAs and posttranscriptional regulation of gene expression in normal mRNAs [37]. Recent studies have revealed that UPF1 is also involved in normal mRNA decay. For instance, UPF1 regulates mRNA stability by sensing poorly translated coding sequences [38]. UPF1 preferentially associates with the 3′UTR with length to promote mRNA decay [39, 40]. It has been reported that the RNA‐binding protein PTBP1 promotes the ATPase‐dependent dissociation of the RNA deconjugating enzyme UPF1, thereby protecting transcripts from nonsense‐mediated mRNA decay [41]. The present study revealed that UPF1 exhibited a conserved interaction with CAPZA1 [G] and promoted CAPZA1 mRNA decay, whereas CAPZA1[T] bound to hnRNP K and PTBP1, potentially promoting mRNA stability and leading to a suppressive function. RIP competition and IP experiments further support these interactions. Understanding the complex relationship between these three proteins and CAPZA1 may play an important role in the tumorigenesis of ESCC. However, it may also function through recruitment of other factors. Understanding these regulatory mechanisms and their impact on 3′UTR‐directed posttranscriptional gene regulation may uncover promising new targets for therapeutic intervention and ESCC diagnosis. Nevertheless, our research has not determined how hnRNP K and PTBP1 influence CAPZA1 mRNA stability, nor their specific binding sites on the transcript. Moreover, the absence of clinical data limits our understanding of the pathological and prognostic significance of these interactions. Hence, our future objectives are twofold: to decipher the specific stability‐regulating mechanism and to extend the analysis to larger clinical cohorts for comprehensive clinicopathological evaluation.
In conclusion, this study discloses a novel molecular mechanism which CAPZA1 acts as a tumor suppressor by binding to hnRNP K and PTBP1 to influence its mRNA stability, offering potential implications for therapeutic targeting. It also demonstrates that the stable overexpression of CAPZA1[T] significantly suppressed the migration and invasion abilities of ESCC cells, as well as the growth rate of xenograft ESCC cells, whereas CAPZA1[G] genotypes weakened these effects. Our findings indicated that CAPZA1[T] was associated with hnRNP K and PTBP1, promoting mRNA stability and leading to a suppressive function. Conversely, UPF1 binds to the CAPZA1[G] mRNA to promote mRNA decay. These results provide insights into the central role of CAPZA1 in suppressing ESCC aggressiveness by binding to RBPs, which may provide a basis for guiding therapeutic decision‐making and designing future clinical trials on precision therapy for ESCC.
Author Contributions
Nan Kang: data curation (lead), project administration (lead), writing – original draft (lead). Yunwei Ou: conceptualization (equal), resources (equal). Shichao Guo: methodology (equal). Jie Chen: software (equal). Dan Li: project administration (equal), supervision (equal), writing – review and editing (equal). Qimin Zhan: conceptualization (equal), funding acquisition (equal), project administration (equal), supervision (equal).
Funding
This work was supported by the National Natural Science Foundation of China (NO. 81490753), National Key R&D Program of China (2023YFC3503200, 2023YFC3503205), Beijing Natural Science Foundation, China (Grant No. 7254440), the Research and Development Fund of Peking University People's Hospital (RDY2018‐08 and RDX2024‐05).
Ethics Statement
Sample collection from patients was conducted following their provision of written informed consent. All procedures adhered to pertinent guidelines and regulations. The study was approved by the Ethical Review Committee of Peking University People's Hospital (Approval number 2024PHB499‐001), and all the enrolled patients provided informed consent. The animal experimental protocols received approval from the Ethics Committee of National Cancer Center/Cancer Hospital, Chinese Academy of Medical Sciences (approval number SYXK(京)2014‐0003).
Consent
The authors have nothing to report.
Conflicts of Interest
The authors declare no conflicts of interest.
Supporting information
Figure S1: CAPZA1 Knockdown effects were analyzed using RT‐PCR in ESCC cell lines. (A) Knockdown of CAPZA1 by siRNAs in ESCC cell lines (KYSE30 and KYSE150) was measured using RT‐PCR, which demonstrated a significant reduction in CAPZA1 mRNA levels in siRNA groups. (B) Western blotting analysis of the knockdown efficiency of CAPZA1 protein levels and CAPZA1 protein levels were significantly decreased by siRNAs, which were analyzed by Western blotting assays. All experiments were performed at least three times, and the data were statistically analyzed using a two‐tailed t‐test. *p < 0.05, ***p < 0.001 versus siCtrl. Error bars indicate SEM. Figure S2: CAPZA1 knockdown promotes malignancy in ESCC cells. (A) Knockdown of CAPZA1 significantly increased the proliferation of KYSE30 and KYSE150 cells, as indicated by growth curves. (B) Colony formation assays revealed that knockdown of CAPZA1 significantly enhanced cell growth in KYSE30 and KYSE150 cell lines. Representative images (top) and quantitative histograms (bottom) of the colony formation ability. (C) Transwell assays demonstrated that knockdown of CAPZA1 significantly increased cell migration and invasion of KYSE30 and KYSE150 cells. Representative images (top) and quantitative data (bottom) from the Transwell assay. All experiments were performed in triplicate, and the data were statistically analyzed using a two‐tailed t‐test. Figure S3: Identification of proteins specifically binding to wild type CAPZA1. (A) RNA pulldown and mass spectrometry analyses were performed to identify the specific *CAPZA1(T)‐*binding proteins. Silver‐staining assays revealed differential proteins; some protein bands appeared only in CAPZA1(T) (lane 2), compared with CAPZA1(G) (lane 3) and negative controls no RNA (lane 1), antisense‐CAPZA1(T) (lane 4), and antisense‐CAPZA1(G) (lane 5). (B) Western blotting analysis of hnRNP K, PTBP1, and UPF1 proteins bound to the beads. Anti‐hnRNP K, anti‐PTBP1, and anti‐UPF1 bound to beads efficiently and equivalently. (C) PCR validation of CAPZA1 RNA precipitated by PTBP1 protein, which is particularly high in the CAPZA1(T) 3′UTR. Figure S4: RT‐PCR and Western blotting analysis of hnRNP K, PTBP1, and UPF1 knockdown efficiency. (A) Knockdown of hnRNP K and PTBP1 by siRNAs in the KYSE510 cell line was measured using RT‐PCR. The results indicated that hnRNP K and PTBP1 mRNA levels were significantly reduced in the siRNA groups. (B) Western blotting analysis of the knockdown efficiency of hnRNP K and PTBP1 protein levels revealed that hnRNP K and PTBP1 protein levels were significantly decreased by siRNAs. (C) Knockdown of UPF1 by siRNAs in the KYSE510 cells was measured by RT‐PCR and western blotting, and UPF1 mRNA and protein levels were significantly reduced in siRNA groups. All experiments were performed in triplicate, and the data were statistically analyzed using a two‐tailed t‐test. *p < 0.05, ****p < 0.0001 versus siCtrl. Error bars indicate SEM. Figure S5: Knockdown of hnRNP K and PTBP1 enhances the malignancy of wild type CAPZA1 ESCC cells. (A) Colony formation assays demonstrated that the knockdown of hnRNP K and PTBP1 significantly enhanced cell growth in CAPZA1(T) cells, whereas the knockdown of UPF1 significantly weakened cell proliferation in KYSE510 cell line over‐expressing CAPZA1(G). Representative images (top) and quantitative histograms (bottom) of colony formation ability. All experiments were performed in triplicate, and the data were statistically analyzed using a two‐tailed t‐test. *p < 0.05, **p < 0.01, ****p < 0.0001. Error bars indicate SEM. (B) The growth curves indicated that the knockdown of hnRNP K and PTBP1 significantly increased cell proliferation in over‐expressed CAPZA1(T) cells. Elimination of UPF1 significantly reduced cell growth in the CAPZA1(G) cell line. (C) Transwell assays demonstrated that knockdown of hnRNP K and PTBP1 significantly increased cell migration and invasion of KYSE510 cells. KYSE510 cells overexpressing CAPZA1(T) after knockdown of UPF1 indicated that elimination of UPF1 attenuated the ability of CAPZA1 (T) to enhance cell migration and invasion. Representative images (top) and quantitative data (bottom) of the transwell assays. All experiments were performed in triplicate, and the data were statistically analyzed using a two‐tailed t‐test. **p < 0.01, ***p < 0.001 and ****p < 0.0001. Error bars indicate SEM.
Table S1: RBPmap analysis predicted binding motifs/sites for hnRNP K within the CAPZA1 (T) mRNA. Table S2: RBPmap analysis predicted binding motifs/sites for PTBP1 within the CAPZA1 (T) mRNA.
The reference list from the paper itself. Each links out to its DOI / PubMed record.
- 1H. Zhu , X. Ma , T. Ye , et al., “Esophageal Cancer in China: Practice and Research in the New Era,” International Journal of Cancer 152 (2023): 1741–1751.36151861 10.1002/ijc.34301 · doi ↗ · pubmed ↗
- 2Y. Song , L. Li , Y. Ou , et al., “Identification of Genomic Alterations in Oesophageal Squamous Cell Cancer,” Nature 509 (2014): 91–95.24670651 10.1038/nature 13176 · doi ↗ · pubmed ↗
- 3J. K. Waters and S. I. Reznik , “Update on Management of Squamous Cell Esophageal Cancer,” Current Oncology Reports 24 (2022): 375–385.35142974 10.1007/s 11912-021-01153-4 · doi ↗ · pubmed ↗
- 4N. Zhang , J. Shi , X. Shi , W. Chen , and J. Liu , “Mutational Characterization and Potential Prognostic Biomarkers of Chinese Patients With Esophageal Squamous Cell Carcinoma,” Onco Targets and Therapy 13 (2020): 12797–12809.33363385 10.2147/OTT.S 275688 PMC 7751839 · doi ↗ · pubmed ↗
- 5S. He , C. Xia , H. Li , et al., “Cancer Profiles in China and Comparisons With the USA: A Comprehensive Analysis in the Incidence, Mortality, Survival, Staging, and Attribution to Risk Factors,” Science China. Life Sciences 67 (2024): 122–131.37755589 10.1007/s 11427-023-2423-1 · doi ↗ · pubmed ↗
- 6A. P. Thrift , “Global Burden and Epidemiology of Barrett Oesophagus and Oesophageal Cancer,” Nature Reviews. Gastroenterology & Hepatology 18 (2021): 432–443.33603224 10.1038/s 41575-021-00419-3 · doi ↗ · pubmed ↗
- 7Y. Lu , D. Huang , B. Wang , et al., “FAM 21C Promotes Hepatocellular Carcinoma Invasion and Metastasis by Driving Actin Cytoskeleton Remodeling via Inhibiting Capping Ability of CAPZA 1,” Frontiers in Oncology 11 (2021): 809195.35096613 10.3389/fonc.2021.809195 PMC 8793146 · doi ↗ · pubmed ↗
- 8D. Wang , Z. Ye , W. Wei , et al., “Capping Protein Regulates Endosomal Trafficking by Controlling F‐Actin Density Around Endocytic Vesicles and Recruiting RAB 5 Effectors,” e Life 10 (2021): e 65910.34796874 10.7554/e Life.65910 PMC 8654373 · doi ↗ · pubmed ↗