Proline-Mediated Inhibition of ATPIF1-mTOR Signaling Alleviates Radiation-Induced Macrophage Polarization and Colon Inflammation
Lei Chang, Le Zhou, Shan Jiang, Kai Wei, Jie Li, Junhong Zhao, Kavita Shah, Xinzhou Deng, Renhuang Sun, Xiaoyu Zuo, Zhenzhen Wang, Liting Ding, Zhiguo Luo, Lihua Duan, Yutao Yan
TL;DR
Proline reduces radiation-induced inflammation by inhibiting a key signaling pathway in macrophages.
Contribution
This study identifies proline as a novel inhibitor of radiation-induced M1 macrophage polarization via the ATPIF1-mTOR axis.
Findings
Radiation increases M1 macrophage polarization and pro-inflammatory cytokines.
Proline supplementation reverses radiation-induced mitochondrial dysfunction and inflammation.
The ATPIF1-mTOR axis is central to radiation-induced inflammation and is inhibited by proline.
Abstract
Radiation therapy often triggers inflammatory complications such as radiation colitis, which is driven by persistent M1 macrophage polarization. While metabolic reprogramming is pivotal in macrophage activation, the role of amino acid metabolism—particularly proline—in regulating radiation-induced inflammation remains unexplored. In this study, bone marrow-derived macrophages (BMDMs) and RAW264.7 cells exposed to 4 Gy radiation exhibited robust M1 polarization (increasing from 13.5% in controls to 23.7% in F4/80+CD86+ cells), elevated pro-inflammatory cytokines (TNF-α, IL-1β, IL-6; 3- to 6-fold increase), and mitochondrial dysfunction ( 30% decrease in ATP levels, 60% reduction in oxygen consumption rate [OCR], and 2-fold increase in mitochondrial ROS). Proline supplementation reversed these effects, suppressing M1 polarization by 50%, restoring ATP levels by 1.6-fold, and normalizing…
Genes, proteins, chemicals, diseases, species, mutations and cell lines named across the full text — each resolved to its canonical identifier and authoritative record.
Click any figure to enlarge with its caption.
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5- —Natural Science Foundation of Hubei Province of China
- —National Natural Science Foundation of China
Peer Reviews
No public reviews on file for this paper yet. If you reviewed it on a platform where reviews are public (OpenReview, ICLR, NeurIPS, ICML), you can paste yours below so the community can read it here.
Videos
No videos yet. Explain this paper in a talk, walkthrough, or lecture? Add one.
Taxonomy
TopicsEffects of Radiation Exposure · Cancer, Hypoxia, and Metabolism · Immune cells in cancer
Introduction
Radiation therapy (RT) remains a cornerstone in cancer treatment, yet its off-target effects on healthy tissues—particularly radiation colitis—pose significant clinical challenges [1]. Approximately 50% of patients undergoing abdominal or pelvic RT develop acute gastrointestinal inflammation, characterized by persistent diarrhea, mucosal ulceration, and fibrosis, which severely compromises treatment continuity and quality of life [2–4]. While inflammation is a natural defense mechanism, prolonged activation of immune cells, such as macrophages, underlies the pathogenesis of radiation-induced tissue damage [5]. Macrophages, as key orchestrators of inflammatory responses, exhibit remarkable plasticity, transitioning between pro-inflammatory M1 and anti-inflammatory M2 phenotypes in response to microenvironmental cues [6, 7]. In radiation-exposed tissues, sustained M1 polarization drives chronic inflammation through excessive cytokine release (e.g., TNF-α, IL-6) and reactive oxygen species (ROS) production, exacerbating tissue injury and fibrotic remodeling [8, 9]. Thus, targeting M1 macrophage activation represents a promising strategy to mitigate RT-associated complications.
Emerging evidence underscores metabolic reprogramming as a critical regulator of macrophage polarization. M1 macrophages predominantly rely on glycolysis and exhibit impaired mitochondrial respiration, whereas M2 activation depends on oxidative phosphorylation (OXPHOS) and fatty acid oxidation [10, 11]. Recent studies further implicate amino acid metabolism in shaping macrophage function: glutamine fuels M2 polarization via α-ketoglutarate-dependent epigenetic modifications, while arginine metabolism dictates nitric oxide production in M1 states [12, 13]. However, the role of proline—a non-essential amino acid with unique cyclic structure and multifaceted roles in collagen synthesis, redox balance, and stress adaptation [14–16]—in macrophage biology and radiation-induced inflammation remains unexplored. Intriguingly, proline catabolism generates ATP and modulates mitochondrial function under nutrient stress [17], suggesting its potential to influence immune-metabolic pathways. Notably, radiation exposure alters cellular proline homeostasis [18], raising the possibility that proline supplementation could counteract radiation-induced metabolic dysregulation.
Here, we investigated whether proline modulates macrophage polarization in the context of radiation-induced inflammation. We identified ATP synthase inhibitory factor 1 (ATPIF1)—a mitochondrial protein that preserves ATP during stress by inhibiting F1Fo-ATPase hydrolysis [19], —as a key mediator linking radiation to M1 polarization. Radiation upregulated ATPIF1, impaired OXPHOS, and activated mTOR, a metabolic sensor that promotes glycolysis and M1 polarization. Proline supplementation reversed these effects, restored mitochondrial homeostasis and suppressed inflammatory responses. These findings offer a new approach, suggesting that proline can mitigate radiation-induced inflammation by reversing the M1 polarization of macrophages.
Materials and Methods
Cell Culture and Radiation Treatment
Bone Marrow-Derived Macrophages (BMDMs): The femurs and tibias of 8-week-old male C57BL/6 mice (Vital River Laboratory, Beijing) were flushed with PBS to isolate bone marrow cells. These cells were cultured in DMEM (GE Healthcare Life Sciences Hyclone Laboratories) supplemented with 10% FBS (A5669801, Gibco), 100 U/mL penicillin-streptomycin (P1400, Solarbio Science & Technology), and 20 ng/mL recombinant murine M-CSF (PeproTech, 315-02) for 7 days at 37 °C in an atmosphere of 5% CO₂. The media was partially replaced (50%) on day 3. Purity (> 97% F4/80⁺) was confirmed by flow cytometry (BD FACS Calibur) using APC-anti-F4/80 (Clone BM8, BD, 566787).
RAW264.7 Macrophages: The murine macrophage cell line was maintained in DMEM supplemented with 10% FBS and antibiotics.
Radiation Protocol: The cells were irradiated with 4 Gy of X-rays using an X-RAY irradiator (RAD SOURCE RS 2000 X, USA).
Proline (200 nM, Absin, abs47000156) was immediately added post-irradiation.
Macrophage Polarization and Functional Assays
Cells were harvested 24 h subsequent to irradiation and subjected to flow cytometry and mRNA detection. Cells were collected 48 h following irradiation for Western blot (WB) detection. The culture supernatant was collected for ELISA.
Flow Cytometry: Cells (1 × 10⁶/mL) were blocked with anti-CD16/32 (BioLegend, 101302), then stained with APC-anti-F4/80 and PE-anti-CD86 (Clone GL-1, BD Pharmingen, 553692) for M1 quantification, or PE-anti-CD206 (Clone C068C2, BioLegend, 141706) for M2 analysis. Data were acquired on a BD FACS Calibur and analyzed using FlowJo v10.8.
Real-time RT-PCR: Total RNA was extracted using the FastPure Cell/Tissue Total RNA Isolation Kit (RC112-01, Vazyme). The RNA was then converted to cDNA with the High-Capacity cDNA Reverse Transcription Kit (Life Technologies). The cDNA synthesis was performed using the SuperScript II Reverse Transcriptase Kit (Invitrogen). TaqMan primers for Park7, ATPIF1, Sp1, Lyst, Tlr4, Fnip1, Kat6a, and Naa10 were sourced from Applied Biosystems. Amplification was conducted with an initial 10-minute step at 95 °C, followed by 40 cycles consisting of 15 s at 95 °C and 1 min at 60 °C. Relative gene expression levels were determined using the 2^(-ΔΔCt) method. The primer sequences and ATPIF1 ShRNA sequence are provided in Tables 1 and 2.
Table 1PCR primer sequenceNo.GenePrimer sequence1Park7F: CAAGGAGCAGGAGAGCAGGAAGR: AACCTACTTCGTGAGCCAACAGAG2Naa10F: CTTTCCACCCGCTTCCCTCTGR: CCTTTGTTCTCCGCTTTGTTCTCC3Kat6aF: GAAGAGGAGGAGGAGGAGGAGTCR: GGTGTAGAGGTATCTGGCTCAAGTG4SP1F: ACCCACAAGCCCAGACAATCACR: TGGAGGAGAGTTGAGCAGCATTC5Atpif1F: GGACTCGTCGGATAGCATGGATACR: CCTCTTCAGCCTTTTCTCGTTTTCC6Fnip1F: GGAAGACTGGACAGAAGAGGATGAGR: AAGTTGGCAATGTTGGGCTGAAC7LystF: AGTACAGCCAACAGAGAACACAGGR: GATAACTTCTTCACCGCAGCAACC8Tlr4F: CGCTCTGGCATCATCTTCATTGTCR: CCTCCCATTCCAGGTAGGTGTTTC9β-ActinF: CCTCACTGTCCACCTTCCR: GGGTGTAAAACGCAGCTC
Table 2ATPIF1 ShRNA sequenceNo.GeneTargetSeq1Atpf1CGTCTGCAGAAGCAAATTGAA2Atpf1TACTTCCGAGAGAAGACTAAA3Atpf1CTCGTCGGATAGCATGGATACNCNCCCTAAGGTTAAGTCGCCCTCG
Western Blotting: Proteins were extracted using RIPA buffer (Absin, abs9161) and separated on 10% SDS-PAGE gels. They were then transferred to PVDF membranes (Millipore) and probed with the following primary antibodies: anti-iNOS (1:1000, CST, 13120 S), anti-ATPIF1 (1:1000, A24640, ABclonal), anti-mTOR (1:1000, 2983, CST), anti-p-mTOR (Ser2448, 1:1000, 5536, CST), and β-tubulin (1:5000, A12289, ABclonal). HRP-conjugated secondary antibodies (Absin, abs20040) were used for detection with chemiluminescence (Bio-Rad, USA).
Cytokine Profiling: TNF-α, IL-1β, and IL-6 levels in the supernatants were quantified using a Cytometric Bead Array (BD Biosciences, catalog numbers 558309, 560232, 558301), adhering to the manufacturer’s protocol.
Cell Proliferation Assay and Lactate Measurements: The proliferation of RAW264.7 cells was assessed using a Cell Counting Kit-8 (CCK-8, Dojindo Laboratories, Japan), following the manufacturer’s guidelines. Intracellular lactate concentrations were determined using a Lactate Production Assay (abs580160; Absin), in accordance with the provided instructions.
Endocytosis assay: BMDMs at a concentration of 1 × 10^^6^ cells/ml were exposed to FITC-dextran (HY-128868, MCE) at a concentration of 1 mg/ml and incubated for 3 h at 37 °C under normal conditions. Subsequently, the cells were harvested and analyzed using a FACS Calibur to measure fluorescence. The mean fluorescence intensity (MFI) of cells incubated with FITC-dextran at 0 °C served to establish the baseline fluorescence as the background signal.
Metabolic and Mitochondrial Assessments
Cells were harvested 24 h after irradiation, and the intracellular adenosine triphosphate (ATP) levels, reactive oxygen species (ROS) levels, mitochondrial ROS levels, and oxidative phosphorylation were measured.
ATP Quantification: Intracellular ATP was measured using an ATP Assay Kit (Absin, abs580117) with a microplate reader (Varioskan LUX, Thermo) at a wavelength of 570 nm.
Oxidative Phosphorylation: The cell mitochondrial stress was measured using the Seahorse XF cell mito stress test kit (103015, Seahorse Bioscience, Agilent). Cells were plated at a density of 2 × 10⁵ per well in a 24-well XF cell culture microplate and incubated for 24 h with culture media before the assay. The oxygen consumption rate (OCR) was assessed in XF base medium (pH 7.4) supplemented with 10 mM glucose, 1 mM sodium pyruvate, and 2 mM glutamine. Measurements were taken after sequentially adding oligomycin (0.1 mM), FCCP (0.1 mM), and a combination of Rotenone and Antimycin A (0.05 mM). The data were processed using the Seahorse XF Cell Mito Stress Test Report Generator, and results were normalized based on cell counts obtained from the Countstar Bio Tech Automated Cell Counter.
ROS Detection: Total ROS was measured with DCFH-DA (Beyotime, S0033S), and mitochondrial ROS with MitoSOX Red (HY-D1055, 1:1000, MCE), using flow cytometry (FL1/FL2 channels).
RNA Sequencing and Metabolomics
Cells were harvested 24 h post - irradiation for RNA - seq. Additionally, cells were collected 48 h after irradiation for liquid chromatography-mass spectrometry (LC-MS) metabolomics analysis.
RNA-seq: Total RNA from RAW264.7 cells (n = 3/group) was extracted using the miRNeasy Mini Kit (Qiagen, 217004). RNA integrity was assessed with the RNA Nano 6000 Assay Kit on the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). The samples were subsequently clustered and sequenced on an Illumina platform by Metware Biotechnology Co., Ltd. (Wuhan, China), generating 150 bp paired-end reads. Additionally, differential expression analysis was conducted to identify genes that were differentially expressed under various conditions.
LC-MS Metabolomics: Untargeted metabolite profiling was conducted using LC/MS-MS. The clean data was obtained through the molecular feature extraction (MFE) tool in the Agilent MassHunter Qualitative Analysis B.04.00 software (Agilent Technologies, USA), and then analyzed using PCA (Principal Component Analysis), PLS-DA (Partial Least Squares Discriminant Analysis), and OPLS-DA (Orthogonal Partial Least Squares Discriminant Analysis) methods. Differences between the experimental groups were assessed using an unpaired t-test (with either equal or unequal variance), with a VIP (Variable Importance in the Projection) score greater than 1 in the PLS-DA model. A VIP score greater than 1 indicates that the variable is considered important in the PLS-DA model and significantly contributes to the separation and discrimination between the experimental groups. This helps in identifying key metabolites that may be responsible for the observed biological differences. Statistical significance was determined at the 95% confidence level (P < 0.05). Enrichment analysis was performed using the hypergeometric test. For KEGG (Kyoto Encyclopedia of Genes and Genomes), the test was conducted at the pathway level, and for GO (Gene Ontology), it was performed based on GO terms.
ATPIF1 Knockdown
Cells entered the logarithmic growth phase for transfection and were irradiated 24 h post - transfection.
The lentiviral shRNA targeting mouse ATPIF1 was cloned into the pCLenti-U6-shRNA (Atpif1)-CMV-Puro-WPRE vector (provided by OBiO Technology, Shanghai). RAW264.7 cells were transduced at an MOI of 10 and subsequently selected using puromycin at a concentration of 10 µg/mL (Sigma). The knockdown efficiency was validated through quantitative PCR (qPCR) and Western blot analysis.
Radiation Colitis Model
Male Sprague-Dawley (SD) rats, (aged 7–8 weeks and weighing between 200 and 220 g from Beijing Laboratory Animal, were randomly assigned to four groups (n = 3/group): control, proline-only (administered 0.01 g/kg/day via oral gavage), radiation-only (exposed to 8 Gy/day over three days in the abdominal field), and radiation plus proline. Clear timepoints and experimental schematic are shown in Tables 3 and 4. The radiation was administered using an Elekta Infinity™ Linear Accelerator (Elekta AB, Sweden), delivering 6 MeV X-rays at a dose rate of 300 cGy/min, with an irradiation field area of 4.0 × 4.0 cm, a source skin distance of 100 cm, and targeting 2 cm below the xiphoid process to the pubic symphysis. Six days following the final irradiation, colons were excised for hematoxylin and eosin (H&E) staining and immunofluorescence analysis (using anti-F4/80 [Abcam, ab300421] and anti-CD86 [Santa Cruz, sc28347] antibodies). Secondary antibodies conjugated with DyLight 488 or PE-Cy7, diluted 1:2000, were then applied. Nuclei were stained with DAPI, and images were captured using an Olympus FV3000RS fluorescence microscope. Colon shortening was assessed as an indicator of inflammation.
Table 3. In vivo experimental DesignGroup n RadiationProlineAdministration ScheduleControl3NonePBS vehicle (oral gavage)9 DaysProline-only3None0.01 g/kg/day (oral gavage)9 DaysRadiation-only38 Gy/day(1–3 days)PBS vehicle (oral gavage)9 DaysRadiation + Proline38 Gy/day(1–3 days)0.01 g/kg/day (oral gavage)9 Days
Table 4. Experimental schematic timelineDay 1Day 2Day 3Day 4–8Day 9IR8 Gy8 Gy8 GyNoneSacrifice & AnalysisProline●●●●● Proline feed via oral gavage.
To evaluate the health status of the rat, four objective criteria were established: activity (active = 1, stationary = 0), posture (normal = 1, hunched = 0), pelage (well-groomed, smooth, and healthy-looking fur = 1; poorly groomed and rough fur = 0), and dehydration (absent = 1, present = 0). Dehydration was assessed by gently pinching a small fold of dorsal skin; a rat was considered dehydrated if the skin remained tented or retracted slowly to its original position. The consistency and objectivity of the health scoring system were validated by three independent observers who were blinded to the treatments [20].
Colon mucosa injury was assessed macroscopically using the Colonic Mucosal Damage Index (CMDI) scoring criteria, as follows: 0, normal appearance; 1, focal hyperemia without ulcers; 2, ulceration without hyperemia or bowel wall thickening; 3, ulceration with inflammation at one site; 4, two or more sites of ulceration and inflammation; 5, major damage extending more than 1 cm along the colon; and 6–10, damage extending more than 2 cm along the colon, with an additional point given for each additional 1 cm of involvement [21].
Statistical Analysis
Data are presented as the mean ± standard error of the mean (SEM). Comparisons between two groups were analyzed using the unpaired Student’s t-test, while multiple groups were compared by one-way analysis of variance (ANOVA) followed by Tukey’s post hoc test (GraphPad Prism, version 8.0; GraphPad Software, San Diego, CA, USA). For high-throughput datasets, RNA-seq and metabolomics data were adjusted for multiple comparisons using the Benjamini-Hochberg false discovery rate (FDR) method. A P-value < 0.05 was defined as statistically significant.
Results
Radiation Induces Macrophage M1 Polarization and Enhances Pro-Inflammatory Cytokine Secretion
To examine the impact of radiation on M1 polarization of macrophages, we exposed BMDMs and RAW264.7 cells to a 4 Gy radiation dose. BMDMs were isolated from the femurs and tibias of C57BL/6 mice, achieving a purity of over 97% (Fig. S1A). Following radiation treatment, we assessed the proportion of M1 macrophages using flow cytometry with F4-80^+^/CD86^+^ labeling. The results indicated that radiation increased the proportion of the M1 phenotype (Fig. 1A). A similar effect was observed in RAW264.7 cells (Fig. 1B). Otherwise, radiation did not affect macrophage M2 polarization, as indicated by CD206^+^ labeling (Figure S1B, C). To further investigate the impact of radiation on macrophage differentiation, we analyzed iNOS expression using Western blotting. The results showed that radiation increased iNOS expression in both BMDMs and RAW264.7 cells, indicating that radiation enhances the proportion of the M1 phenotype (Fig. 1C, D).
Reactive oxygen species (ROS) acts as a critical mediator of macrophage functional dynamics, and is the initial driving signal for the activation of M1 polarization of macrophages [22]. Thus, we assessed the levels of intracellular total ROS using DCF-HDA and mitochondrial ROS using MitoSOX Red in BMDMs and RAW264.7 cells. As expected, the results demonstrated that radiation elevated both total ROS and mitochondrial ROS levels (Fig. 1E-H).
As tumor cells are known to generate lactate to fuel metabolism after radiation, we evaluated the proliferation and lactate levels in RAW264.7 cells following radiation. We observed a decrease in cell number over the subsequent 3 days after radiation (Figure S1D), and the levels of lactate increased inversely (Fig. S1E), indicating that these cells are indeed combating oxidative stress that occurs after radiation. Phagocytosis is a crucial function of macrophages, so we assessed the pinocytic activity of BMDMs and RAW264.7 cells after radiation using dextran uptake. The results demonstrated that radiation enhances macrophage phagocytosis in both cell types, indicating that both BMDMs and RAW264.7 after radiation are active (Fig. 1I, J).
Fig. 1. Radiation Induces Macrophage M1 Polarization and Enhances Pro-Inflammatory Cytokine Secretion. (A) BMDMs were extracted from the femurs and tibias of C57BL/6 mice and subjected to a 4 Gy dose of X-ray radiation. The percentage of F4/80+/CD86 + macrophages was assessed using FACS analysis. The graph on the right illustrates the representative data showing the proportion of the M1 phenotype. (B) RAW264.7 cells were exposed to a 4 Gy dose of X-ray radiation. The percentage of CD86 + cells was determined using FACS analysis. This figure represents one of three independent experiments. (C) Western blot analysis showing iNOS protein expression in BMDMs following radiation treatment. β-tubulin was used as a loading control. (D) Western blot analysis showing iNOS protein expression in RAW264.7 cells after radiation treatment, with β-tubulin serving as the loading control. (E) BMDMs were exposed to a 4 Gy dose of X-ray radiation. The levels of ROS are displayed. (F) RAW264.7 were exposed to a 4 Gy dose of X-ray radiation. The levels of ROS are displayed. (G) BMDMs were exposed to a 4 Gy dose of X-ray radiation. The levels of mitochondrial ROS are shown. (H) RAW264.7 were exposed to a 4 Gy dose of X-ray radiation. The levels of mitochondrial ROS are shown. (I) BMDMs were exposed to a 4 Gy dose of X-ray radiation. Shown is the count of Dextran. (J) RAW264.7 were exposed to a 4 Gy dose of X-ray radiation. Shown is the count of Dextran. (K) BMDMs were exposed to a 4 Gy dose of X-ray radiation. The supernatants from the cell cultures were analyzed for cytokine levels, including TNF-α, IL-1β, and IL-6, using a Cytometric Beads Array. (L) RAW264.7 were exposed to a 4 Gy dose of X-ray radiation. Cytokine levels, including TNF-α, IL-1β, and IL-6, were measured in the supernatants from the cell cultures using a Cytometric Beads Array. Error bars are SEM of biological replicates and ^^p < 0.01; ^*^p < 0.001
M1 macrophages, characterized by their pro-inflammatory phenotype, can secrete pro-inflammatory cytokines to aid in the removal of antigens and dead cells. Therefore, we measured the levels of pro-inflammatory cytokines, including TNF-α, IL-1β, and IL-6, secreted by BMDMs and RAW264.7 cells after radiation. The results revealed a significant increase in all three cytokines in both cell types, indicating a pronounced pro-inflammatory effect of radiation (Fig. 1K, L).
Proline Supplementation Attenuates Radiation-Induced M1 Polarization and Inflammatory Responses
Next, we added 200 nM proline solution to the media after radiation to determine whether proline could counteract the effects of radiation therapy. The addition of exogenous proline solution alone (without radiation) had no impact on the proportion of the M1 phenotype. However, when proline was added after radiation, it prevented radiation-induced M1 polarization, which could be observed in both BMDMs and RAW264.7 (Fig. 2A, B). Similarly, proline addition alone did not affect iNOS expression, but when added after radiation, it suppressed the radiation-induced increase in iNOS expression (Fig. 2C, D). Then, we also measured the levels of both total intracellular ROS and mitochondrial ROS in BMDMs and RAW264.7 cells. Proline by itself did not affect either total intracellular ROS or mitochondrial ROS levels. We observed that proline reduced the radiation-induced increase in mitochondrial ROS levels (Fig. 2E, F), while it had no impact on total ROS (Fig. S2A). Interestingly, proline did not influence macrophage phagocytosis, regardless of radiation exposure (Fig. S2B). Likewise, proline stimulated cell proliferation that was suppressed by radiation and lowered the elevated lactate levels caused by radiation (Fig. S2C, D). Following that, we measured the levels of three pro-inflammatory cytokines released by BMDMs and RAW264.7 cells after radiation, both with and without proline. The results demonstrated that proline reduced the secretion of three pro-inflammatory cytokines that were elevated by radiation (Fig. 2G, H). All the data collectively suggest that proline mitigates the M1 macrophage polarization caused by radiation.
Fig. 2. Proline Supplementation Attenuates Radiation-Induced M1 Polarization and Inflammatory Responses. (A) BMDM cells were exposed to a 4 Gy dose of X-ray radiation, either with or without proline treatment. The percentage of F4/80+/CD86 + macrophages was measured using FACS analysis. The graph on the right displays representative data illustrating the proportion of the M1 phenotype. (B) RAW264.7 were exposed to a 4 Gy dose of X-ray radiation, either with or without proline treatment. The percentage of CD86 + cells was determined using FACS analysis. This figure represents one of three independent experiments. (C) Western blot analysis showing iNOS protein expression in BMDMs following radiation treatment, with or without proline treatment. β-tubulin was used as a loading control. (D) Western blot analysis showing iNOS protein expression in RAW264.7 cells following radiation treatment, with or without proline treatment. β-tubulin was used as a loading control. (E) BMDMs were exposed to a 4 Gy dose of X-ray radiation, with or without proline treatment. The levels of mitochondrial ROS are presented. (F) RAW264.7 were exposed to a 4 Gy dose of X-ray radiation, with or without proline treatment. The levels of mitochondrial ROS are presented. (G) BMDMs were exposed to a 4 Gy dose of X-ray radiation, with or without proline treatment. The supernatants from the cell cultures were analyzed for cytokine levels, including TNF-α, IL-1β, and IL-6, using a Cytometric Beads Array. (H) RAW264.7 cells received a 4 Gy dose of X-ray radiation, with or without proline treatment. Cytokine levels, including TNF-α, IL-1β, and IL-6, were measured in the cell culture supernatants using a Cytometric Beads Array. Error bars are SEM of biological replicates and ^^p < 0.05; ^**^p < 0.001
Proline Restores Mitochondrial Bioenergetics Via Oxidative Phosphorylation Regulation
To uncover the molecular mechanism by which proline inhibits the effects of radiation therapy, we analyzed gene expression differences between radiation therapy alone and radiation therapy combined with proline using RNA sequencing. By comparison, it was found that after irradiation, macrophages treated with proline showed changes in the expression of 673 genes, where 460 genes were upregulated and 213 were downregulated (Fig. S3B). In the GO term analysis, we discovered that differential genes were associated with various intracellular biological processes. However, the ATP metabolic process emerged as the most prominent pathway regulated by radiation (Fig. 3A). This finding indicated that proline can alter the ATP metabolic process in macrophages. KEGG pathway analysis further revealed multiple differential genes involved in the oxidative phosphorylation process (Fig. 3B). Additionally, we examined the metabolic pathways related to the differential genes and found that the ATP metabolic process was also notably significant (Fig. 3D).
Together, these data uncovered that proline was involved in the mitochondrial metabolic process in macrophages following radiation exposure. We then conducted an enrichment analysis of the cellular pathways associated with the differential genes and identified the involvement of TOR, MAPK, and NF-kB pathways (Fig. 3C).
We next compared all the metabolites between radiation therapy alone and radiation therapy combined with proline using LC/MS-MS. A volcano plot illustrates the number of different metabolites in macrophages, out of which 57 metabolites increased and 117 metabolites decreased (Fig. S3D). Notably, we found that these distinct metabolites participated in several metabolic pathways, including the metabolism of various amino acids (Fig. 3E). As amino acid metabolism occurs in mitochondria, it indicated that proline was likely involved in mitochondrial metabolic processes in macrophages following radiation exposure, which was also consistent with our data showing involvement of genes related to oxidative phosphorylation.
Thus, initially we investigated ATP levels in these cells by treating them with proline alone, which did not affect ATP levels. However, when added post-radiation, it counteracted the radiation-induced reduction in ATP levels (Fig. 3F), suggesting that proline supplementation rescues the decrease in ATP levels in macrophages after radiation exposure.
Subsequently, the oxygen consumption rate (OCR) was measured to evaluate mitochondrial function, particularly oxidative phosphorylation. Interestingly, while radiation caused a significant reduction in OCR in macrophages, treatment with proline successfully restored the OCR levels that had decreased due to radiation (Fig. 3G). This finding suggests that proline maintains ATP levels by influencing oxidative phosphorylation, thereby playing a protective role in preserving cellular respiration and energy production processes.
To dissect the molecular mechanism that leads to increased ATP levels, we then chose eight markedly different genes for PCR analysis (Fig. 3H). ATP synthase inhibitory factor 1 (ATPIF1) is a mitochondrial protein that functions by inhibiting F_1_F_o_-ATP synthase under stressful conditions, thereby preventing ATP hydrolysis [23]. By inhibiting F1Fo-ATP synthase, ATPIF1 ensures that ATP is conserved during cellular stress, which is particularly important after radiation exposure. This preservation of ATP is vital for maintaining energy balance and supporting the cell’s recovery and survival mechanisms. Therefore, we hypothesized that ATPIF1 could be the target gene through which proline counteracts the M1 polarization of macrophages induced by radiation.
Fig. 3. Proline Restores Mitochondrial Bioenergetics via Oxidative Phosphorylation Regulation. (A) The differences in gene expression between radiation therapy alone and radiation therapy combined with proline were analyzed using RNA sequencing. The displayed results represent the GO term analysis. (B) The displayed results represent the KEGG pathway analysis. (C) The displayed results represent the enrichment analysis of the cellular pathways associated with the differentially expressed genes. (D) The displayed results represent the enrichment analysis of the metabolic pathways related to the differential genes. (E) All metabolites between radiation therapy alone and radiation therapy combined with proline were compared using LC/MS-MS. The multiple metabolic pathways involving the different metabolites are displayed. (F) RAW264.7 were exposed to a 4 Gy dose of X-ray radiation, with or without proline treatment. The levels of ATP are presented. (G) RAW264.7 cells were exposed to a 4 Gy dose of X-ray radiation, with or without proline treatment, and OCR assays were conducted using the Seahorse XF24 analyzer. (H) The expression of eight markedly different genes was measured by PCR analysis. Error bars are SEM of biological replicates and ^^p < 0.05; ^^p < 0.01; ^^p < 0.001.
Proline Inhibits the Radiation-Activated ATPIF1-mTOR Axis To Attenuate M1 Polarization
We then analyzed ATPIF1 expression and discovered that radiation indeed upregulated its protein levels. While proline alone had no effect on ATPIF1 levels, however, when administered after radiation, it almost fully suppressed the radiation-induced upregulation of ATPIF1 (Fig. 4A). To determine whether ATPIF1 plays a critical role in the process by which proline counteracts the M1 polarization of macrophages induced by radiation, we knocked down ATPIF1 expression in RAW264.7 cells. Initially, we designed three shRNAs and confirmed that shRNA-3 was the most effective at knocking down ATPIF1 (Fig. S4B). After ATP1F1 knockdown, we assessed iNOS expression to ascertain the switch to M1 phenotype and found that ATPIF1 knockdown alone did not affect iNOS expression. However, when measured following radiation, it suppressed the radiation-induced upregulation of iNOS, indicating that M1 phenotype switch upon radiation is primarily mediated by ATP1F1 (Fig. 4B). To further validate these findings, we also evaluated the proportion of M1 macrophages using flow cytometry with F4-80+/CD86 + labeling, and the results were consistent with the iNOS expression findings (Fig. 4C). These findings suggest that radiation promotes M1 polarization of macrophages by upregulating ATPIF1 expression.
Radiation activates mTOR pathway by increasing p-mTOR levels. Since we knew that the TOR pathway was involved in proline’s ability to counteract M1 polarization of macrophages induced by radiation, we investigated the levels of mTOR and phosphorylated mTOR (p-mTOR). While neither radiation nor proline affected the levels of mTOR (Fig. 4D, Fig. S4C), radiation increased p-mTOR levels as expected. Importantly, proline supplementation inhibited this radiation-induced upregulation of p-mTOR (Fig. 4D).
To examine whether ATP1F1 was involved in mTOR activation, we also examined mTOR and p-mTOR levels following ATP1F1 knockdown. As expected, radiation did not alter mTOR levels (Fig. 4E, Fig. S4D). Similarly, ATPIF1 knockdown by itself did not alter p-mTOR expression. However, when combined with radiation, it inhibited the radiation-induced increase in p-mTOR levels (Fig. 4E). To explore the potential function of p-mTOR in macrophage polarization, we used a p-mTOR agonist (MHY1485) (10 nM). Through a dose-dependent study, we first identified the optimal concentration that does not impact macrophage proliferation (Fig. S4E). Under treatment with a p-mTOR agonist, we evaluated iNOS expression and observed that while the p-mTOR agonist appeared to slightly increase iNOS expression, the change was not statistically significant (Fig. 4F). Similarly, after ATPIF1 knockdown, p-mTOR agonist appeared to slightly increase iNOS expression, but the change also was not statistically significant (Fig. 4G). All the data suggest that ATPIF1, rather than mTOR, should be the target for inducing M1 polarization through radiation. However, ATPIF1 may influence p-mTOR expression following radiation. Subsequently, we assessed the oxygen consumption rate (OCR) and mitochondrial ROS levels following ATPIF1 knockdown and radiation. As anticipated, radiation caused a significant reduction in OCR in macrophages, and ATPIF1 knockdown further mitigated this decrease in OCR (Fig. 4H). We also observed that ATPIF1 knockdown diminished the increase in mitochondrial ROS levels caused by radiation (Fig. S4F). Together, these findings indicate that ATP1F1 is a critical player in inducing M1 polarization in macrophages following radiation.
Fig. 4. Proline Inhibits the Radiation-Activated ATPIF1-mTOR Axis to Attenuate M1 Polarization (A) Western blot analysis showing ATPIF1 protein expression in RAW264.7 cells following radiation treatment, with or without proline treatment. β-tubulin was used as a loading control. (B) After ATPIF1 knockdown, western blot analysis showing iNOS protein expression in RAW264.7 cells following radiation treatment, with or without proline treatment. β-tubulin was used as a loading control. (C) After ATPIF1 knockdown, RAW264.7 were exposed to a 4 Gy dose of X-ray radiation, either with or without proline treatment. The percentage of CD86 + cells was determined using FACS analysis. This figure represents one of three independent experiments. (D) Western blot analysis showing mTOR and p-mTOR protein expression in RAW264.7 cells following radiation treatment, with or without proline treatment. β-tubulin was used as a loading control. (E) After ATPIF1 knockdown, western blot analysis showing mTOR and p-mTOR protein expression in RAW264.7 cells following radiation treatment, with or without proline treatment. β-tubulin was used as a loading control. (F) Western blot analysis showing iNOS protein expression in RAW264.7 cells following radiation, proline and p-mTOR agonist treatment. β-tubulin was used as a loading control. (G) Western blot analysis showing iNOS protein expression in RAW264.7 cells following radiation, ATPIF1 knockdown and p-mTOR agonist treatment. β-tubulin was used as a loading control. (H) RAW264.7 cells were exposed to a 4 Gy dose of X-ray radiation, with or without ATPIF1 knockdown, and OCR assays were conducted using the Seahorse XF24 analyzer. Error bars are SEM of biological replicates and ^^p < 0.05; ^^p < 0.01; ^^p < 0.001.
Proline Mitigates Radiation Colitis by Suppressing M1 Macrophage infiltration in Vivo
In a rat model of radiation colitis (8 Gy × 3 days), daily proline administration (0.01 g/kg) attenuated clinical and pathological manifestations. Radiation-exposed rats exhibited severe systemic toxicity, including reduced activity, weight loss, bloody stool, and lethargy, whereas proline-treated rats showed marked recovery in activity and stool consistency by day 5 (Fig. 5A).
Proline alleviates radiation-induced colonic damage. Gross examination revealed significant colon shortening, luminal narrowing, and ulceration in irradiated rats, alongside histopathological hallmarks such as epithelial necrosis, crypt distortion, glandular atrophy, and inflammatory cell infiltration. Proline treatment preserved colon length, reduced mucosal sloughing, and minimized submucosal inflammation (Fig. 5B, C).
Proline suppresses M1 macrophage polarization in inflamed tissue. Immunofluorescence staining (F4/80^+^/CD86^+^) demonstrated sparse M1 macrophages in control and proline-only groups. Radiation triggered robust M1 macrophage infiltration in colonic tissues, which was significantly attenuated by proline (Fig. 5D, Fig. S5). These findings confirm that proline ameliorates radiation colitis by curbing M1 macrophage-driven inflammation.
Fig. 5. Proline Mitigates Radiation Colitis by Suppressing M1 Macrophage Infiltration In Vivo (A) The table presents the general signs observed in rats along with their corresponding scores. (B) The picture displays the colons after harvesting, while the table provides their appearance along with the corresponding scores. (C) The pictures show the H&E staining of the colons. (D) IF showing the infiltration of M1 phenotype macrophages. DAPI was used for marking nuclear. The red light marked F4/80 and green light marked CD86.
Discussion
Radiation-induced inflammation, particularly in the gastrointestinal tract, remains a major barrier to the efficacy and tolerability of radiotherapy [24]. In this study, we uncovered a previously unrecognized role for the non-essential amino acid proline as a metabolic regulator that counteracts radiation-driven M1 macrophage polarization and colon inflammation through the ATPIF1-mTOR axis. Our findings not only advanced the understanding of immune-metabolic crosstalk in radiation injury but also proposed a readily translatable strategy to mitigate radiotherapy complications.
Macrophage polarization is increasingly recognized as a metabolic process, with M1 activation favoring glycolysis and disrupted mitochondrial respiration [25]. Here, we demonstrated that radiation exacerbates this metabolic imbalance by depleting ATP levels (30% decrease) and impairing oxidative phosphorylation (OCR 60% decrease), creating a pro-inflammatory milieu conducive to M1 polarization. Proline supplementation reversed these effects, restored ATP synthesis (1.6-fold increase) and mitochondrial function (OCR 60% increase), likely by bypassing radiation-induced electron transport chain defects. This aligns with studies showed proline catabolism supports ATP production under stress via mitochondrial PRODH activity [26], though our work is the first to link this pathway to macrophage immunometabolism. Importantly, proline’s effects were specific to mitochondrial ROS and ATPIF1-mTOR signaling, with no impact on total ROS or phagocytosis, underscoring its precision in metabolic reprogramming.
A key mechanistic insight of this study is the identification of ATPIF1 as a critical mediator of radiation-induced M1 polarization. ATPIF1, which inhibits ATP hydrolysis during mitochondrial stress [27], was upregulated 1.8-fold post-radiation. This upregulation likely exacerbates energy crisis by limiting ATP synthase reversibility, forcing macrophages to rely on glycolysis—a hallmark of M1 states. Concurrently, radiation activated mTOR, a known driver of glycolysis and inflammatory cytokine production [28]. Proline’s ability to suppress both ATPIF1 (30% decrease) and p-mTOR (30% decrease) suggests a dual mechanism: (1) restoring ATP synthase activity to replenish ATP pools, and (2) dampening mTOR-driven glycolytic flux. The dependency of these effects on ATPIF1 was conclusively shown by shRNA experiments, where ATPIF1 knockdown abolished radiation’s pro-inflammatory effects and rendered proline ineffective. This positions ATPIF1 as a gatekeeper of macrophage metabolic flexibility under radiation stress.
Our in vivo data validated the therapeutic potential of proline in a clinically relevant model of radiation colitis. Proline administration reduced M1 macrophage infiltration and attenuated colon shortening, a hallmark of colon inflammation. These effects correlated with decreased TNF-α and IL-6 levels, mirroring our in vitro findings. Notably, the proline dose used is physiologically achievable and far below reported toxic thresholds [29], supporting its safety as an adjuvant to radiotherapy. While current management of radiation colitis focuses on symptom relief (e.g., anti-diarrheals, steroids) [30], our work provided a proactive strategy targeting the root cause—dysregulated macrophage metabolism.
Unanswered Questions and Future Directions
Several questions warrant further investigation. First, how does proline downregulate ATPIF1? While our RNA-seq data suggest transcriptional regulation (e.g., reduced ATPIF1 mRNA), proline may orchestrate ATPIF1 suppression through multiple interconnected pathways: (1) Transcriptional control: Proline-derived metabolites (e.g., P5C, glutamate) could modulate transcription factors like Sp1, PPARγ, or HIF-1α, which bind the ATPIF1 promoter; (2) Post-transcriptional regulation: Proline availability influences miRNA networks (e.g., miR-27b, miR-34a) that target ATPIF1 mRNA stability; (3) mTOR-mediated feedback: Restored ATP levels via proline may suppress mTORC1-driven ATPIF1 transcription, as mTOR promotes ATPIF1 expression during energy stress; (4) Epigenetic modulation: Proline catabolism generates α-KG, a cofactor for TET/JMJD histone demethylases that could remodel chromatin at the ATPIF1 locus. Second, does proline synergize with other metabolic modulators (e.g., metformin) to enhance radioprotection? Third, while our rat model recapitulates acute radiation colitis, chronic fibrosis—a major long-term complication—remains to be studied. Finally, clinical trials are needed to confirm proline’s efficacy in humans, particularly in cohorts receiving abdominal/pelvic radiotherapy.
Limitations and Translational Considerations
It is important to acknowledge that this study relies exclusively on murine models (BMDMs, RAW264.7 cells, and SD rats). While these systems provide valuable mechanistic insights, they may not fully recapitulate human pathophysiology. Proline metabolism and macrophage polarization pathways exhibit interspecies differences; for instance, human macrophages may display distinct metabolic dependencies or inflammatory thresholds under radiation stress. Additionally, the ATPIF1-mTOR axis, though evolutionarily conserved, could have context-specific regulatory nuances in human cells. Future studies validating these findings in primary human macrophages and clinical samples are essential to bridge this translational gap.
Conclusions
This study demonstrated that proline mitigates radiation-induced mitochondrial dysfunction and macrophage hyperactivation through the ATPIF1-mTOR axis. By bridging amino acid metabolism to inflammatory signaling, our work opened new avenues for targeting immunometabolism in radiation oncology.
Supplementary Information
Below is the link to the electronic supplementary material.
Supplementary Material 1 (ZIP 70.1 MB)
Supplementary Material 2 (DOC 1.73 MB)
The reference list from the paper itself. Each links out to its DOI / PubMed record.
- 1Sutthiwanjampa, C., S. H. Kang, M. K. Kim, J. Hwa Choi, H. K. Kim, S. H. Woo, T. H. Bae, W. J. Kim, S. H. Kang, and H. Park. 2025. Tumor necrosis factor-alpha-treated human adipose-derived stem cells enhance inherent radiation tolerance and alleviate in vivo radiation-induced capsular contracture. Journal of Advanced Research 72:433–449. 10.1016/j.jare.2024.07.01110.1016/j.jare.2024.07.011PMC 1214760339019109 · doi ↗ · pubmed ↗
- 2Zhou, B., A. Caudal, X. Tang, J. D. Chavez, T. S. Mc Millen, A. Keller, O. Villet, M. Zhao, Y. Liu, J. Ritterhoff, et al. 2022. Upregulation of mitochondrial AT Pase inhibitory factor 1 (ATPIF 1) mediates increased glycolysis in mouse hearts. Journal of Clinical Investigation 132(10):e 155333. 10.1172/JCI 15533310.1172/JCI 155333 PMC 910635235575090 · doi ↗ · pubmed ↗
- 3Pallag, G., S. Nazarian, D. Ravasz, D. Bui, T. Komlodi, C. Doerrier, E. Gnaiger, T. N. Seyfried, and C. Chinopoulos. 2022. Proline oxidation supports mitochondrial ATP production when complex I is inhibited. International Journal of Molecular Sciences 23(9):5111. 10.3390/ijms 2309511110.3390/ijms 23095111 PMC 910606435563503 · doi ↗ · pubmed ↗