Renoprotective effect of dulaglutide in L-NAME-induced hypertensive nephropathy in rats: insight into the roles of PPAR-gamma and VEGF

TL;DR

Dulaglutide helps protect rat kidneys from hypertension damage by reducing inflammation and improving blood vessel health.

Contribution

This study shows dulaglutide's reno-protective effects in hypertensive nephropathy via upregulation of VEGF and PPARγ.

Findings

Dulaglutide reduces renal fibrosis and improves glomerular and vascular structure in hypertensive rats.

The drug increases anti-inflammatory IL-10 and PPARγ while decreasing pro-inflammatory TNF-α.

Dulaglutide elevates eNOS and VEGF expression, promoting vascular endothelium health.

Abstract

Hypertensive nephropathy (HTNeph), primarily triggered by vascular endothelial dysfunction, is the second most common cause of end-stage renal disease. This study investigates the ameliorative effect of dulaglutide, a glucagon-like peptide-1 receptor agonist, on HTNeph via its impact on renal vascular endothelial growth factor (VEGF) and peroxisome proliferator-activated receptors-gamma (PPARγ). The effect of dulaglutide (0.2 mg/kg/day, s.c.) for six weeks on L-NAME-induced hypertension (50 mg/kg/day, i.p.) was investigated in rats. Renal function biomarkers, serum IL-10 and TNF-α, tissue redox balance, histopathological and immunohistochemical changes, and PPARγ gene expression were assessed. Coadministration of dulaglutide with L-NAME could recover renal glomerular and vascular histological structure, reduce collagen deposition, increase the anti-inflammatory IL-10 and the reno-protective PPARγ level, elevate the immunohistochemical expression of the renal tubular eNOS and VEGF, and substantially reduce TNF-α activity in hypertensive rats. Our research linked dulaglutide’s anti-inflammatory, antifibrotic, antioxidant, and vascular endothelium-promoting qualities to its capacity to upregulate VEGF and PPARγ, which confer its reno-protective effects. Thus, dulaglutide is presented as a potential candidate to shield patients from HTNeph.

Dulaglutide ameliorates hypertensive nephropathy in rats via preserving renal function’s biomarkers, restoring tissue redox balance, increasing the anti-inflammatory marker IL-10 and decreasing the inflammatory marker TNF-α, elevating the renoprotective PPARγ gene expression, amending renal vasculopathy and glomerular injury, decreasing fibrosis, and increasing the immunohistochemical expression of eNOS and VEGF

Dulaglutide ameliorates hypertensive nephropathy in rats via preserving renal function’s biomarkers, restoring tissue redox balance, increasing the anti-inflammatory marker IL-10 and decreasing the inflammatory marker TNF-α, elevating the renoprotective PPARγ gene expression, amending renal vasculopathy and glomerular injury, decreasing fibrosis, and increasing the immunohistochemical expression of eNOS and VEGF

Dulaglutide ameliorates hypertensive nephropathy in rats via preserving renal function’s biomarkers, restoring tissue redox balance, increasing the anti-inflammatory marker IL-10 and decreasing the inflammatory marker TNF-α, elevating the renoprotective PPARγ gene expression, amending renal vasculopathy and glomerular injury, decreasing fibrosis, and increasing the immunohistochemical expression of eNOS and VEGF.

Figures

The study design and the timeline of administered drugs

SBP measurements on Day 0, Day 7, and Day 47 in all experimental groups. Data are mean ± SD (*n* = 6). Two-way repeated measures ANOVA and post-hoc Tukey test. *, #, and @ are significant variances vs. control, DLG, and HTN groups respectively, *p* < 0.05Table 1Effect of DLG on SBP, body weight, and renal function biomarkers in L-NAME-induced HTNephParameterControlDLGHTNHTN + DLGSBP (mmHg)108.02 ± 5.5110.6 ± 9.92159.52 ± 10.5^*#^137.35 ± 12.34^*#@^Body weight (g)279 ± 25285.83 ± 24197.83 ± 14^*#^242.17 ± 8^*#@^Urine volume (mL/24 h)16.83 ± 2.614.67 ± 2.347.17 ± 1.47^*#^11 ± 1.55^*#@^Urine albu

Effect of DLG on renal tissue oxidative enzymes (MDA and GSH), serum inflammatory markers (IL-10 and TNF-α), and renal tissue PPARγ expression in L-NAME-induced HTNeph. Data are mean ± SD (*n* = 6). One-way ANOVA and post-hoc Tukey test. *, #, and @ are significant variances vs. control, DLG, and HTN groups respectively, *p* < 0.05

Microscopic sections showing renal arteries of all experimental groups. Control and DLG groups showing normal renal arteries, thin intima, endothelium with flat to ovoid nuclei, and tunica media formed of a few layers of spindle myocytes with cigar-shaped nuclei (H&E), thin, mildly folded BM (PAS), thin, mildly folded IEL and delicate EEL (aldehyde fuchsin). HTN group showing marked perivascular edema, thickened arterial wall with narrow lumen, proliferated endothelial cells, wrinkled thickened intima encroaching on the arterial lumen, media showing circular myocytes’ hyperplasia with cytoplas

Microscopic examination of renal tissue sections from all experimental groups. Control and DLG groups showing normal glomeruli (G) surrounded by regular Bowman’s space (B), renal tubules (T) lined with cuboidal epithelium with eosinophilic cytoplasm, and vesicular rounded nuclei (N) (H&E), thin Bowman’s capsule (BC) and salient apical brush border (BB) in renal tubules (PAS), minimal periglomerular and interstitial collagen fibers (arrows) (Picrosirius red), and intense cytoplasmic glomerular and tubular reaction against eNOS and VEGF. HTN group showing collapsed glomeruli (G), irregular widen

Full text

Introduction

Hypertensive nephropathy (HTNeph) is the second cause of end-stage renal disease, following diabetic nephropathy [1]. Glucagon-like peptide-1 receptor agonists (GLP-1 RAs) have been studied in hypertension models, including salt-sensitive, renin-dependent, and obesity-dependent models [2]. Nearly all studies in mice are consistent with blood pressure (BP)-lowering via direct and indirect mechanisms [3]. In animal models of diabetes and renal ischemia/reperfusion, previous studies have demonstrated that GLP-1 RAs can lessen renal damage [4].

Endothelial dysfunction (ED), which is a major contributor to HTNeph by either reducing the capacity of endothelial cells to produce nitric oxide (NO) or increasing the production of superoxide, which inactivates NO, is indicated by oxidative stress (OS), leukocyte adhesion, and inflammatory response [5, 6]. Vascular endothelial growth factor (VEGF) is a trophic factor for vascular endothelium, which encourages normal endothelial NO release while inhibiting the macrophage infiltration, endothelial overgrowth, and smooth muscle proliferation [7]. By promoting endothelial cell angiogenesis and raising VEGF expression through the CNPY2-PERK pathway, GLP-1 RAs may have a reno-protective impact [8].

The nuclear hormone receptor superfamily’s peroxisome proliferator-activated receptors (PPARs) with their three subtypes: PPARα, PPAR β/δ, and PPARγ, are ligand-activated transcription factors [9]. The nephroprotective benefits of PPARγ activation are mediated via inhibiting mesangial cell proliferation, reducing proteinuria [10], alleviating inflammation [11], restraining endothelial cell apoptosis [12], and repressing TGF-β pathways, which play a crucial role in kidney fibrosis [13]. GLP-1 RAs can increase PPARγ expression and activity in renal tissues by many interconnected pathways, such as direct transcriptional augmentation through the cAMP–PKA pathway [14], mitochondrial integrity enhancement via boosting Sirt1, p-AMPK, and PGC-1α [15] and mediation of anti‑inflammatory and antifibrotic gene programs [16].

This work aimed to investigate the possible protective effect of dulaglutide (DLG), a GLP-1 RA, against renal injury induced by HTN via modulating renal VEGF and PPARγ biomarkers.

Materials and methods

Drugs

L-NG-Nitroarginine methyl ester (L-NAME) powder (Sigma Aldrich Co., MO, USA) dissolved in normal saline 0.9% and DLG (1.5 mg in 0.5 mL solution) as Trulicity pre-filled injection pen (Eli Lilly and Company Pharmaceuticals, IN, USA).

Animals and ethical statement

This protocol was directed in a unit with the Institutional Animal Care and Use Committee of Cairo University, Egypt (CU-IACUC, code: CU-III-F-14-23). Wistar male rats (200–240 g, 8:10 weeks) were obtained from the National Research Center, Giza, Egypt. Per the ARRIVE guidelines and the European Union directive 2010/63/EU for animal experiments and in line with NIH standards for the Care and Use of Laboratory Animals, this experiment was conducted at the Animal House of the Faculty of Medicine, Cairo University, Giza, Egypt. Rats were allowed to acclimate for 2 weeks before conducting the study in stainless steel cages (six rats/cage). The environment was pathogen-free, naturally ventilated, with regular dark/light cycles. Rat chow and tap water were available ad libitum.

Induction of hypertension

The model rats received L-NAME (50 mg/kg/day,i.p.) [17] for seven weeks. HTN was confirmed after the first week by systolic BP (SBP) above 140 mmHg [18]. Then, we performed a scheduled measure of SBP as described later.

Experimental design

Twenty-four rats were randomly assigned to four groups (n = 6): control group: received daily sterile normal saline 0.9%, s.c. for seven weeks in parallel to the treatment dose; DLG group: rats received daily sterile normal saline 0.9%, s.c. for one week, then DLG (0.2 mg/kg/day,s.c.) for a further 6 weeks [19]; HTN group: HTN was experimentally induced as previously mentioned; HTN+DLG group: received L-NAME and DLG at the formerly assigned duration and doses 1 h apart. The study design and the timeline of administered drugs are illustrated in Fig. 1.Fig. 1. The study design and the timeline of administered drugs

SBP measurements

SBP was measured using the non-invasive tail-cuff method (model ML 125 NIBP, ADInstruments Pty. Ltd, Sydney, Australia) [20] at three key intervals: at the beginning of the experiment (to ensure no significant differences among the normotensive rats), after 1 week of L-NAME treatment to confirm the occurrence of HTN, and 2 days before the sacrifice. To minimize potential stress during the measurement, rats underwent a 3-day pre-training period, and all measurements were conducted in a quiet room with dim lighting by a single operator. SBP (cuff deflation pressure) was defined as the point at which the cuff pressure corresponds to restoring the first caudal artery pulse. An average of at least three measurements was recorded for each occasion.

Urine collection

After the last drug doses, rats were individually housed in metabolic cages and deprived of food; however, water was available ad libitum for 24 h [21, 22]. Ice gel bags were wrapped around the collecting tubes to minimize the effects of evaporation. The urinary albumin creatinine ratio (UACR) was calculated using the formula [23]:

\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${{\rm{UACR}}}={{\rm{urinary}}}\; {{\rm{albumin}}}\; {{\rm{mg}}}/{{\rm{dL}}}\,{{{\div}}}\,{{\rm{urinary}}}\; {{\rm{creatinine}}}\,({{\rm{g}}}/{{\rm{dL}}})$$\end{document}

Anesthesia, body weight assessment, and sample collection

After urine collection, rats were anesthetized with 5% isoflurane [24]. Body weights were recorded using a digital scale, then blood samples were collected from the tail vein in plain collection tubes, centrifuged at 3000 rpm at 4 °C for 5 min to obtain sera, and stored at –20 °C. Then, the kidneys from each rat were excised through a midline abdominal incision, washed with chilled phosphate buffer saline (PBS), pH = 7.4, and blotted-dry. Part of the left kidney was kept at –80 °C for RNA extraction; the other part was homogenized with 10% ice-cold PBS, centrifuged for 10 min at 3000 rpm and 4 °C, separated, and stored at –80 °C for biochemical analysis. The right kidney was cut lengthwise and sent for histopathology.

Kidney function markers

Serum creatinine, urea, urinary creatinine, and albumin levels were assessed by commercially available kits (CR 12 51, UR 21 10, and AB 10 10, respectively, Bio-diagnostics Co., Giza, Egypt) and following the manufacturer’s guidelines.

Oxidative stress markers

Malondialdehyde (MDA) and glutathione (GSH) were measured spectrophotometrically in the collected supernatant of the tissue homogenate, using available commercial kits (MD 25 2, GR 25 11, respectively, Bio-diagnostics Co., Giza, Egypt) and following the manufacturer’s instructions [25, 26].

Renal inflammatory mediators

Commercial ELISA kits for rat interleukin (IL-10) and Tumor necrosis factor-alpha (TNF-α) (E-EL-R0016 and E-EL-R0019, Elabscience, USA) were utilized according to the manufacturer’s instructions [27, 28].

Renal gene expression of PPARγ

Snap-frozen renal tissues were utilized to isolate total mRNA using RNeasy mini kit (74 104, QIAGEN Co., Germany), following the manufacturer’s instructions. The concentration and purity of the obtained RNA were investigated by Nanodrop 2000 UV–Vis spectrophotometer (Thermo Fisher Scientific Inc., TX, US). The mRNA was then reverse-transcripted by QuantiTect Rev. Transcription Kit (205311, QIAGEN Co., Germany). Specific primers for PPARγ (Accession No.: NM_013124.3) were designed as follows: [(Forward: 5′CGTGGCCGCAGATTTGAA3′) and (Reverse: 5′CTTCCATTACGGAGAGATCCAC3′)]. A real-time PCR step was performed using the QuantiTect SYBR green PCR kit (QIAGEN, Germany) using Rotor-Gene Q system, according to the manufacturer’s amplification instructions. β actin (Forward: 5′-CATTGCTGACAGGATGCAGAAGG-3′) and (Reverse: 5′-TGCTGGAAGGTGGACAGTGAGG-3′) was used as housekeeping gene. Results were assessed, and relative quantification was performed using 2-ΔΔCt method [29, 30].

Histopathology

After fixation in NBF 10% for 24 h, renal tissue samples were dehydrated in ascending concentrations of ethanol (70–100%), cleared in xylene, embedded in molten paraffin to obtain blocks, sliced into 4 µm sections, mounted on glass slides, and processed for hematoxylin and eosin (H&E), Periodic Acid Schiff (PAS), picrosirius red, and aldehyde fuchsin staining [31].

Immunohistochemistry

Anti-VEGF (cat# VEGF (C-1), sc-7269) and anti-eNOS (cat# NOS3 (A-9): sc-376751) primary antibodies were sourced from SANTA CRUZ BIOTECHNOLOGY, INC (mouse, monoclonal, dilution 1/200). Five-µm-thick paraffin sections were dewaxed in ascending ethanol concentrations. Then, H_2_O_2_ was used to clog the endogenous peroxidase. After washing with PBS, sections were incubated with biotinylated rabbit anti-mouse IgG (1/100 dilution) (Vector Labs, VA, USA) for 60 min. The sections were re-washed and left in avidin-biotin-peroxidase complex (Vector Lab. Inc., U.S.A) for another h. 3,3′ diaminobenzidine H_2_O_2_ was used to evoke the immune reaction. Counterstaining was implemented using hematoxylin. The immune response was distinguished by replacing the primary antibody with PBS as a negative control [32].

Image acquisition, morphometry, and image analysis

All sections were assessed and shot by an expert histologist unaware of the study design, using conventional light microscopy (Carl Zeiss, Jena, Germany) connected to an HD IP camera (5 megapixels). Each image was modified for contrast, brightness, and color balance without picking a particular focus via the MacBook Pro built-in system (macOS, ver.13.5.1), and the authors preserved the original copies. The morphometric measurements and image analysis were performed using ImageJ software v.1.53t; Wayne Rasband and contributors (NIH, USA) in five non-overlapping randomly chosen high-power fields from each slide.

Statistical analysis

Data were presented as mean ± SD and analyzed employing GraphPad Prism version 8.0.2 (La Jolla, CA, USA). For the intergroup comparison, we used two-way repeated measures ANOVA for analysis of SBP over time across the studied groups and one-way ANOVA for analysis of the biochemical and histological results, followed by Tukey’s post-hoc test (p-value < 0.05).

Results

Effect of DLG on L-NAME-induced HTN and body weight

A significant elevation in SBP was observed after 1 week of L-NAME administration in both HTN and HTN+DLG groups that persisted for the remainder of the study. At the end of the experiment, HTN group exhibited a considerable increase in SBP compared to both the control and DLG groups (1.4- and 1.5-fold, respectively), whereas SBP in HTN+DLG group was reduced significantly compared to HTN group (p < 0.05).

L-NAME administration led to significant weight loss in HTN group compared to the control and DLG groups. DLG administration appeared to exert a protective effect against L-NAME in HTN+DLG group (p < 0.05) (Fig. 2 and Table 1).Fig. 2SBP measurements on Day 0, Day 7, and Day 47 in all experimental groups. Data are mean ± SD (n = 6). Two-way repeated measures ANOVA and post-hoc Tukey test. , #, and @ are significant variances vs. control, DLG, and HTN groups respectively, p < 0.05Table 1Effect of DLG on SBP, body weight, and renal function biomarkers in L-NAME-induced HTNephParameterControlDLGHTNHTN + DLGSBP (mmHg)108.02 ± 5.5110.6 ± 9.92159.52 ± 10.5^#^137.35 ± 12.34^#@^Body weight (g)279 ± 25285.83 ± 24197.83 ± 14^#^242.17 ± 8^#@^Urine volume (mL/24 h)16.83 ± 2.614.67 ± 2.347.17 ± 1.47^#^11 ± 1.55^#@^Urine albumin (mg/dL)0.21 ± 0.010.30 ± 0.030.62 ± 0.11^#^0.39 ± 0.03^@^Serum creatinine (mg/dL)0.67 ± 0.150.69 ± 0.131.48 ± 0.4^#^0.94 ± 0.38^@^Serum urea (mg/dL)42.08 ± 9.2836.37 ± 11.4262.55 ± 10.76^#^43.61 ± 9.58^@^UACR (mg/g)13.01 ± 4.4512.77 ± 1.2443.92 ± 16.82^#^17.59 ± 6.84^@^CrCl (mL/min)0.32 ± 0.120.37 ± 0.120.058 ± 0.03^*#^0.27 ± 0.19^@^Data are mean ± SD (n = 6). One-way ANOVA and post-hoc Tukey test. *, #, and @ are significant variances vs. control, DLG, and HTN groups respectively, p < 0.05

Effect of DLG on renal function biomarkers in L-NAME-induced HTNeph

HTN group exhibited marked renal impairment, demonstrated by a 57.40% reduction in 24-h urine volume and a 2.9-fold increase in urinary albumin, and significantly higher serum creatinine and urea levels relative to the control and DLG groups (p < 0.05). In contrast, DLG significantly enhanced urine output, attenuated albuminuria, and reduced serum creatinine and urea compared to HTN group (p < 0.05).

Additionally, HTN group presented a 3.3-fold rise in UACR and a significant decline in creatinine clearance (CrCl) versus controls. While co-administration of DLG led to substantial improvements in kidney function by increasing CrCl and decreasing UACR relative to HTN group (Table 1).

Effect of DLG on renal tissue oxidative enzymes in L-NAME-induced HTNeph

HTN group recorded a significant increase in MDA and a significant decrease in GSH levels compared to control and DLG groups. Those results were reversed in HTN+DLG group, which exhibited a considerable decline in MDA and a substantial increase in GSH levels compared to the untreated hypertensive rats (p < 0.05) (Fig. 3).Fig. 3. Effect of DLG on renal tissue oxidative enzymes (MDA and GSH), serum inflammatory markers (IL-10 and TNF-α), and renal tissue PPARγ expression in L-NAME-induced HTNeph. Data are mean ± SD (n = 6). One-way ANOVA and post-hoc Tukey test. *, #, and @ are significant variances vs. control, DLG, and HTN groups respectively, p < 0.05

Effect of DLG on inflammatory markers (IL-10 and TNF-α) in L-NAME-induced HTNeph

HTN group exhibited a significant decrease in the anti-inflammatory cytokine IL-10 and a significant increase in the pro-inflammatory protein TNF-α compared to the control and DLG groups. On the contrary, HTN+DLG group showed a significant elevation of IL-10 and a significant reduction of TNF-α levels compared to HTN group (p < 0.05) (Fig. 3).

Effect of DLG on renal tissue PPARγ expression in L-NAME-induced HTNeph

Hypertensive rats showed a remarkable downregulation of PPARγ gene expression compared to the control and DLG groups. However, DLG could effectively increase PPARγ gene expression when administered to hypertensive rats compared to rats receiving L-NAME solely (p < 0.05) (Fig. 3).

Effect of DLG on the renal vasculature in L-NAME-induced HTNeph

H&E-stained sections from the control and DLG groups showed normal renal arteries with a thin intima comprising endothelium with flat to ovoid nuclei. The tunica media comprised a few layers of spindle myocytes with cigar-shaped nuclei. HTN group showed marked vascular histological changes in the form of perivascular edema, significantly thickened arterial wall compared to the control and DLG groups (p < 0.05), and narrowed lumen, and proliferated intimal cells. The media displayed circular myocytes’ hyperplasia with cytoplasmic vacuolar degeneration compressing their nuclei. DLG’s use to treat hypertensive rats markedly amended the vascular histopathological changes and reduced perivascular edema. The arterial wall appeared significantly less thickened compared to HTN group (p < 0.05) with a broader lumen and less folded intima with flattened endothelial cells. The medial layer showed fewer layers of myocytes with fewer cytoplasmic vacuolations. PAS-stained sections revealed thin, mildly folded basement membranes (BM) in the control and DLG groups. HTN group exhibited a wrinkled, thickened BM encroaching on the arterial lumen. HTN+DLG group showed a thinner, less folded BM. Aldehyde fuchsin-stained sections demonstrated thin folded internal elastic lamina (IEL) and delicate external elastic lamina (EEL) in the control and DLG groups. HTN group showed substantially thickened, corrugated, and reduplicated IEL and clear thickened EEL compared to the control and DLG groups (p < 0.05). In HTN+DLG group, the IEL restored, at least partly, its thin contour and appeared considerably thinner and less folded with thinner EEL compared to HTN group (p < 0.05) (Fig. 4).Fig. 4. Microscopic sections showing renal arteries of all experimental groups. Control and DLG groups showing normal renal arteries, thin intima, endothelium with flat to ovoid nuclei, and tunica media formed of a few layers of spindle myocytes with cigar-shaped nuclei (H&E), thin, mildly folded BM (PAS), thin, mildly folded IEL and delicate EEL (aldehyde fuchsin). HTN group showing marked perivascular edema, thickened arterial wall with narrow lumen, proliferated endothelial cells, wrinkled thickened intima encroaching on the arterial lumen, media showing circular myocytes’ hyperplasia with cytoplasmic vacuolar degeneration compressing their nuclei (H&E), thickened markedly folded BM (PAS), thick, corrugated, and reduplicated IEL and clear, thickened EEL (aldehyde fuchsin). HTN+DLG group showing less perivascular edema, less thickened arterial wall with wider lumen, mildly folded intima with flattened endothelial cells, media showing fewer myocytes, and fewer cytoplasmic vacuolations (H&E), thinner, less folded BM (PAS), thinner, less folded IEL and thinner EEL (aldehyde fuchsin). Key: A: artery, E: endothelium, I: intima, BM: basement membrane, IL: internal elastic lamina, M: media, N: nuclei, V: vacuole, EL: external elastic lamina, star: perivascular edema. Data are mean ± SD (n = 5). One-way ANOVA and post-hoc Tukey test. *, #, and @ are significant variances vs. control, DLG, and HTN groups respectively, p < 0.05

Effect of DLG on glomerular histology in L-NAME-induced HTNeph

H&E-stained sections from the kidney of the control and DLG groups showed normal tufts of glomerular capillaries surrounded by Bowman’s capsule (BC) enclosing regular Bowman’s space (BS). The renal tubules were lined with cuboidal epithelium with eosinophilic cytoplasm and vesicular, rounded nuclei. HTN group showed collapsed glomerular tuft with irregularly widened BS, shreddy parietal epithelium, marked perivascular inflammatory cellular infiltrates, distended tubules with luminal homogenous eosinophilic colloid casts, causing flattening of the lining epithelium. HTN+DLG group showcased markedly ameliorated histopathological changes in renal parenchyma. The glomeruli looked normal, surrounded by typically looking tubules with empty lumen. PAS-stained sections from the control and DLG groups showed a thin BC, thin glomerular BM, and salient apical brush border in renal tubules. HTN group showed markedly thickened BC, dense glomerular BM, and marked PAS-stained mesangial deposits. HTN+DLG group showed thinner BC and less PAS-stained mesangial deposits (Fig. 5).Fig. 5. Microscopic examination of renal tissue sections from all experimental groups. Control and DLG groups showing normal glomeruli (G) surrounded by regular Bowman’s space (B), renal tubules (T) lined with cuboidal epithelium with eosinophilic cytoplasm, and vesicular rounded nuclei (N) (H&E), thin Bowman’s capsule (BC) and salient apical brush border (BB) in renal tubules (PAS), minimal periglomerular and interstitial collagen fibers (arrows) (Picrosirius red), and intense cytoplasmic glomerular and tubular reaction against eNOS and VEGF. HTN group showing collapsed glomeruli (G), irregular widened Bowman’s space (B), shreddy parietal epithelium (P), marked inflammatory cellular infiltrates (IC), tubules distended with homogenous eosinophilic colloid casts in the lumen (CC) with flattened epithelial lining (arrows) (H&E), markedly thickened Bowman’s capsule (B) and PAS-stained mesangial deposits (arrowheads) (PAS), dense periglomerular and peritubular collagen fiber deposition (black and white arrows) (Picrosirius red), and minimal cytoplasmic reaction against eNOS and VEGF (arrow). HTN+DLG group showing normal glomeruli (G) and tubules with empty lumen (T), and some arterial pathological changes (A) (H&E), thinner Bowman’s capsule (BC) and fewer mesangial deposits (arrowheads) (PAS), and less collagen deposition (arrows) (Picrosirius red), and moderate positive reaction against eNOS and VEGF (arrows). Data are mean ± SD (n = 5). One-way ANOVA and post-hoc Tukey test. *, #, and @ are significant variances vs. control, DLG, and HTN groups respectively, p < 0.05

Effect of DLG on the renal interstitial collagen deposition in L-NAME-induced HTNeph

Picrosirius red-stained sections from the control and DLG groups showed minimal collagen deposition in the renal interstitium. Hypertensive rats displayed substantially increased periglomerular and perivascular collagen deposition compared to the control and DLG groups. However, coadministration of DLG to hypertensive rats resulted in a significant decline in deposited collagen compared to HTN group (p < 0.05) (Fig. 5).

Effect of DLG on eNOS and VEGF immunohistochemical expression in L-NAME-induced HTNeph

The glomerular and renal tubular cells exhibited intense immunohistochemical cytoplasmic expression of eNOS and VEGF in the control and DLG groups. HTN group exhibited substantially regressed expression of both markers compared to the control and DLG groups. In contrast, HTN+DLG group showed a significant increment of both markers compared to HTN group (p < 0.05) (Fig. 5).

Discussion

In this work, we specifically examined the renoprotective effects of GLP-1RAs, irrespective of diabetes or obesity, in a model of HTNeph. However, most of the GLP-1RAs clinical evidence now available comes from populations with obesity and T2DM [33, 34], where the renoprotective benefits of these medications have been repeatedly shown. The data on GLP-1RAs in individuals with nephropathy brought on only by HTN is still limited, nevertheless, this information gap highlights our study’s novelty.

In our work, L-NAME-induced-HTN in rats was confirmed by the significant increase in SBP measured one week following L-NAME administration with a persistent rise till the end of the experiment, which is consistent with earlier research that employed elevated SBP as an indicator for HTN in rats [35, 36]. Moreover, renal injury was confirmed biochemically by alterations in both serum and urinary renal biomarkers. A significant decrease in the immunohistochemical expression of renal eNOS and VEGF, coupled with a decline in tissue reno-protective PPARγ, oxidant/antioxidant renal imbalance, and finally, an obvious inflammatory response, as evidenced by increased serum TNF-α with regressed IL-10, confirmed the possible causes of renal injury found in HTN group.

Morphologically, HTN resulted in apparent histopathological alterations to the renal vasculature as well as the glomerular and tubular structures. Coadministration of DLG with L-NAME could significantly decrease SBP and effectively restore almost all serum and urinary biomarkers to nearly normal levels and reinstated the redox balance. Moreover, DLG could improve the histological structure of the renal tissues and vessels, increase the expression of the anti-inflammatory IL-10, the renoprotective PPARγ, the renal tubular eNOS, and VEGF, besides substantially reducing TNF-α expression.

L-NAME was used in the up-to-date study to build up the HTN model. The benefits of adopting a rodent model for HTN include the ability to accurately measure BP using a non-invasive tail-cuff plethysmography, which yields results that closely resemble actual intra-arterial BP [37]. Similarly, several former studies employed L-NAME as HTN-inducer due to various mechanisms include reduced vascular relaxation [38] and increased contraction in the vascular tree [39], sympathetic activity [40], RAAS [41], reactive oxygen species [42], and prostaglandin synthesis [43].

In our work, in comparison to the control and DLG groups, HTN group experienced a substantial decrease in body weight following L-NAME delivery. Similarly, previous studies confirmed L-NAME-induced weight loss but linked it to HTN and its effects rather than a primary weight-loss effect [44]. Even though the L-NAME-induced weight loss appeared to be reversed in HTN+DLG group, the rats’ weight was still less compared to the control values.

Renal damage brought on by chronic HTN is known as primary HTNeph, and because it rarely exhibits noticeable clinical manifestations, it can be challenging to diagnose [45]. Inducing HTNeph was demonstrated in our study by a notable rise in serum urea and creatinine with subsequent increase in urine albumin and UACR, as well as a significant decline in CrCl. Increased serum creatinine and urea signify renal failure and predict the development of end-stage kidney disease [46, 47]. Chronic kidney disease (CKD) is diagnosed by microalbuminuria and elevated UACR, which are also independent predictors of HTN [48]. The precise mechanism behind the correlation between UACR and HTN remains unknown. HTN may have glomerular ED as a root cause [49]. Microalbuminuria plays a role in developing CKD and may be a sign of ED [50]. In patients with microalbuminuria, UACR elevation may also be linked to vascular calcification and loss of vasorelaxation [51]. Additionally, prior research has linked HTNeph to a decline in CrCl in rats [52, 53].

In the current study, L-NAME-induced HTN led to a marked reduction in the expression of the renal eNOS and VEGF. In an attempt to elucidate the underlying mechanisms correlating VEGF reduction and HTN, Pandey et al. denoted NO as the primary downstream mediator of VEGF signaling pathway, whereas VEGF receptor-2 is autophosphorylated upon VEGF binding, which raises intracellular calcium via PI3K/Akt. This acutely activates calmodulin, and it binds to eNOS to activate it. Moreover, VEGF signaling raises eNOS protein and mRNA levels, which improves eNOS expression over the long run [54]. The ensuing rise in NO production enhances vascular permeability and endothelial cell survival; NO also diffuses to vascular smooth muscle cells and facilitates endothelium-dependent vasodilation [55]. Likewise, it has been discovered that the blockade of VEGF receptor-2 reduced eNOS expression, resulting in HTN [56].

Moreover, the notable inflammatory response observed in our study’s HTN group in the form of perivascular edema and inflammatory cellular infiltration together with increment in serum TNF-α expression and decline in serum IL-10 expression might be attributed to VEGF decline. VEGF attenuates its anti-inflammatory role via reducing platelet aggregation and inhibiting leukocyte adherence to endothelial cells, thus preserving endothelial health [57]. Similarly, Walshe et al. found that VEGF suppression accounts for inflammatory response via increasing leukocyte adhesion by impairing endothelium-mediated vasodilatation and upregulating the expression of surface adhesion molecules [58].

In this work, HTN caused evident glomerular lesions in the form of collapsed glomerular tufts with irregularly widened BS, mesangial expansion with tubular luminal colloid casts, and dense glomerular BM. In an attempt to link these histopathological alterations to VEGF decline in our study, former studies declared the crucial role of VEGF-induced NO production in the preservation of glomerular membrane endothelial cell fenestrations and podocyte integrity, which support standard filtration and barrier function [59]. Additionally, Eremina et al. found that mice with podocyte-specific deletion of VEGF-A gene could develop endotheliosis, loss of podocyte foot processes, endothelial fenestrations, and glomerular destruction, causing nephrotic syndrome [60].

Hypertensive rats in this study showed significantly higher periglomerular and perivascular collagen deposition. We attributed the observed renal fibrosis to reduction in the expression of eNOS, as NO was proved to reduce collagen deposition, renal fibrosis, and endothelin activation [61] via stimulation of cGMP synthesis, triggering cGMP-dependent protein kinases and inhibiting the RhoA/ROCK pathway linked to renal fibrosis [62]. The involvement of VEGF in renal fibrosis has been the subject of numerous studies; however, the findings have been inconsistent. In one investigation, VEGF supplementation reduced fibrosis and vascular damage in a CKD rat model [63]. In contrast, another study demonstrated that VEGFR-2 was involved in the process by which Gremlin, a bone morphogenetic protein antagonist, upregulated the epithelial-to-mesenchymal transition, promoting renal tubulointerstitial fibrosis [64]. Therefore, it is unclear if VEGF is advantageous when renal fibrosis is present [65].

Moreover, one of the primary causes of renal fibrosis is hypoxia. In severe renal inflammation, VEGF levels decreased at the expense of hypoxia [66]. Similarly, our results revealed a substantial rise in MDA level with a significant decline in the GSH profile in the kidney tissues of the hypertensive rats, indicating an oxidant/antioxidant imbalance.

Our study’s HTN rats displayed significant renal vascular histological alterations, including a wrinkled, thick BM, a thickened arterial wall with constricted lumen, and perivascular edema. Intimal cells proliferated with circular myocytes’ hyperplasia and cytoplasmic vacuolar degeneration in the media. Additionally, these detrimental vascular changes could be linked to VEGF decline in our work, as per Shijubou and colleagues, VEGF inhibitors may encourage endothelial lining abnormalities because they decrease endothelial cell regeneration. This can activate the coagulation cascade by exposing the subendothelial compartment [67].

GLP-1 has many functions, including lowering BP, altering heart metabolism, and enhancing insulin secretion [68]. In our study, coadministration of DLG throughout L-NAME induction of HTN could alleviate glomerular lesions, renal vascular ED, OS, and inflammation. The reno-protective mechanism of DLG might be attributed to the ability of GLP-1 RAs to increase VEGF expression through the CNPY2-PERK pathway, which may promote endothelial cell angiogenesis [8].

In accordance with our biochemical findings, Younes et al. ascribed the decrease in blood urea nitrogen and serum creatinine in HTN pregnant rats to renal vasodilation from GLP-1 RAs-induced activation of eNOS [69]. The previous mechanism was confirmed by Ishii et al. who declared that eNOS is phosphorylated and activated before GLP-1R activation, which increases NO bioavailability by connecting to the cyclic AMP-dependent protein kinase-A and PI3K-Akt pathways, leading to upregulation of endothelial cell function [70].

The renal PPARγ is mainly expressed in podocytes, mesangial cells, and vascular endothelial cells showing many nephroprotective benefits [10].

Our study showed an evident reduced expression, which could explain renal fibrosis and inflammation observed in HTN group. There are several possible routes through which PPARγ activation may provide reno-protective effects. Initially, PPARγ suppresses mesangial cell proliferation and has an anti-glomerular sclerosis impact by downregulating p27 and Bcl-2 expression [12]. Second, PPARγ activation promotes the development of anti-inflammatory M2 macrophages rather than pro-atherogenic M1 macrophages, which lowers the release of inflammatory cytokines like TNF-α [71]. Finally, it has been suggested that endothelial PPARγ guards against OS, inflammation, and cell adhesion by controlling gene targets and preserving the equilibrium between vasodilators and constrictors [72].

In the current study, DLG administration increased PPARγ expression in the renal tissues. Onuma et al. explained this action by assuming the probability that GLP-1 RAs can mimic the action of PPARγ activators via activation of GLP-1 receptors on endothelial cells, leading to increase NO production, which is a crucial factor for vasodilation and preventing ED [14]. Our study indicates that DLG could enhance the inflammatory response seen in the renal tissues and arteries, boost the expression of the anti-inflammatory IL-1 and significantly lower the expression of TNF-α. The activation of protein kinase-A, a critical downstream component of GLP-1 signaling, may explain some of the anti-inflammatory effects of GLP-1 on endothelial cells [14].

Additionally, DLG can reduce inflammation by lowering the release of inflammatory cytokines like TNF-α and IL-1β [73]. Moreover, GLP-1 RAs can reduce vascular inflammation by reversing vascular remodeling through downregulating NF-kB and matrix metalloproteinase 1 [74].

Per our results, DLG demonstrated a significant rise in GSH levels and a decrease in MDA, which may help to restore the redox equilibrium in the renal tissue. According to some data, stimulation of the GLP-1R may mitigate oxidative damage [75], which is accomplished by downregulating the mitogen-activated protein kinase pathway and inhibiting the production of free radicals by cyclooxygenase 2 and NADPH oxidase [76]. Additionally, they may prevent oxidative damage in vascular cells by upregulating protective antioxidative enzymes SOD and CAT and inhibiting NF-kB and protein kinase c-α signaling [77].

Conclusions

Our research highlighted the primary role of reno-vascular ED in the development of HTNeph, which is characterized by suppression of VEGF signaling and a corresponding decrease in eNOS production. We linked DLG’s potent anti-inflammatory, antifibrotic, antioxidant, and vascular endothelium-promoting qualities to its capacity to upregulate the VEGF and PPARγ biomarkers, which confer its reno-protective effects. Therefore, our research presents DLG as a potential treatment option to shield HTN patients from nephropathy. Before being transferred to people, more clinical and in-depth molecular research is needed.