E‐cigarette exposure impairs skeletal muscle mitochondrial function in male mice

TL;DR

E-cigarette vapor harms muscle mitochondria in male mice, similar to tobacco smoke, but through a different biological pathway.

Contribution

Shows E-cig vapor causes mitochondrial dysfunction in skeletal muscle via AHR-independent mechanisms.

Findings

E-cig vapor reduced mitochondrial respiration in mouse muscle cells and mice.

Both E-cig and tobacco smoke impaired mitochondrial function in mice, but only tobacco smoke activated the AHR pathway.

Muscle contractility was unaffected by chronic exposure to either vapor or smoke.

Abstract

While conventional tobacco‐cigarette smoking continues to decline, e‐cigarette (E‐cig) use is rising, yet its physiological consequences remain poorly characterized. Chronic activation of the aryl hydrocarbon receptor (AHR) by tobacco smoke impairs skeletal muscle mitochondrial function. Here, we evaluated whether E‐cig vapor elicits AHR activation and mitochondrial dysfunction in skeletal muscle. C2C12 mouse myoblasts were exposed to 1% dimethyl sulfoxide (vehicle), 0.02% tobacco‐smoke condensate (TSC), or vape condensate (VC) at 0.006%, 0.06%, and 0.3%. Cell viability, AHR‐pathway gene expression (Ahr, Ahrr, Cyp1a1), and mitochondrial respiration were assessed. Male C57BL/6J mice (12–16 weeks; n = 4–5/group) underwent acute 2‐h or 4‐week exposure to room air, tobacco smoke, or E‐cig vapor. Serum cotinine, gastrocnemius AHR‐pathway genes, muscle contractility, and mitochondrial function were evaluated. In myoblasts, 0.02% TSC and 0.3% VC upregulated Ahrr and Cyp1a1 (p < 0.0001) and reduced complex I state‐3 respiration (p < 0.05) without affecting viability. In mice, acute exposure to tobacco smoke and E‐cig vapor significantly increased serum cotinine (p < 0.0001), but only tobacco‐smoke activated AHR‐pathway. Chronic exposure to tobacco smoke and E‐cig vapor reduced mitochondrial complex I and II state‐3 respiration (p < 0.05), without altering muscle contractile function. These findings suggest that AHR‐independent mechanisms contribute to mitochondrial dysfunction with E‐cig vapor exposure.

E‐cigarette vapor induces skeletal muscle mitochondrial dysfunction through AHR‐independent pathways.

Figures

Tobacco smoke and E‐cig vapor condensates activate the AHR pathway and alter mitochondrial respiration in cultured muscle cells. (a) C2C12 myotubes were treated for 16 h without affecting cell viability. (b–d) mRNA expression of Ahr, Ahrr, and Cyp1a1 in treated myotubes. (e) Schematic overview of mitochondrial assay. (f, g) Mitochondrial respiration assessed using respirometry. Data analyzed using Kruskal‐Wallis test. N = 4–6 biological replicates per group. Error bars represent the standard deviation.

A single 2‐h E‐cig exposure does not activate the AHR pathway in skeletal muscle. (a) Graphical depiction of experimental groups and exposure time. (b) Serum cotinine levels measured immediately after (0 h post) and 6 h post exposure. (c–f) mRNA expression of Ahr, Ahrr, Cyp1a1, and Cyp1b1 in gastrocnemius muscle from male mice. Data analyzed using Kruskal–Wallis test. N = 5 per group. Error bars represent the standard deviation.

Chronic tobacco smoke or E‐cig exposure reduces skeletal muscle mitochondrial respiration but not contractile function in male mice. (a) Graphical depiction of experimental groups and exposure time. (b) Body weight. (c) Mass of hindlimb muscles normalized by body weight. (d) Schematic overview of mitochondrial assay. (e–h) Mitochondrial respiratory function. (i) Schematic overview of in situ muscle function testing. (j–k) Plantar flexor muscle contractile strength measured in situ. Data analyzed using Kruskal–Wallis test. N = 4 per group. Error bars represent the standard deviation.

Full text

INTRODUCTION

1

While tobacco cigarette use continues to decline, e‐cigarette (E‐cig) use is rapidly increasing (Mokdad et al., 2018). Among U.S. adults, the prevalence of cigarette smoking decreased from 41.9% in 1965 to 14.2% in 2019, with a decrease from 20.6% to 14.2% in just the last decade (2009–2019) (Health NCfCDPaHPUOoSa, 2014). Initially introduced in 2006 as a smoking cessation tool, E‐cig adoption was slow; however, its use has rapidly increased since 2015, as reflected in the proliferation of hundreds of brands and thousands of flavors available to consumers (Zhu et al., 2014). As of 2021, the prevalence of E‐cig use among U.S. adults was 4.5%, reflecting an upward trend across all age groups with the highest prevalence (11%) observed among younger adults aged 18–24 years (Bandi et al., 2021; Fadus et al., 2019). Notably, the use of E‐cig products with higher nicotine concentrations, often ranging from 3% to 5%, has surged in recent years, raising additional concerns about potential adverse health effects (Cho et al., 2025; Romberg et al., 2019).

Despite its growing popularity, the biological effects of E‐cig use remain poorly understood. This is partly attributed to the absence of long‐term epidemiological studies and limited regulatory requirements for reporting E‐cig vapor compositions, since most labels list only a few ingredients such as nicotine, vegetable glycerin, and propylene glycol (Farber, 2025; Fetterman et al., 2020). Nevertheless, multiple studies and case series have reported associations between E‐cig use and adverse health outcomes, including increased risk of bronchiectasis, asthma exacerbations, reduced myocardial blood flow, increased arterial stiffness, and endothelial cell dysfunction (Kanithi et al., 2022; Pitzer et al., 2023). Additionally, some studies in cell and animal models suggest that E‐cig use may alter mitochondrial respiration and skeletal muscle function (Chitteti et al., 2025; Fitzgerald et al., 2024; Lei et al., 2017; Nogueira et al., 2022).

Tobacco smoke impairs skeletal muscle mitochondrial function via chronic activation of the aryl hydrocarbon (AHR) receptor pathway (Mitchell & Elferink, 2009). AHR is a ligand‐activated transcription factor that regulates numerous cellular processes, particularly those involved in inflammation and metabolism, in response to a multitude of environmental and endogenous ligands (Blau et al., 1983). Among these ligands, Dioxin, or more specifically 2,3,7,8‐Tetrachlorodibenzo‐*p‐*dioxin (TCDD), is one of the most well‐studied AHR activators and is a major constituent of tobacco smoke. However, it remains unknown whether E‐cig products also contain exogenous AHR ligands capable of activating this pathway. Thus, we aimed to: (i) determine whether E‐cig products activate the AHR pathway in cultured muscle cells and in mice, and (ii) assess whether chronic E‐cig exposure negatively impacts skeletal muscle function in situ. We hypothesized that E‐cig vapor exposure would activate the AHR pathway in muscle, leading to mitochondrial dysfunction and impaired muscle contractility.

MATERIALS AND METHODS

2

Cell culture

2.1

C2C12 myoblast cell lines were obtained from ATCC (Cat. No. CRL‐1772) and cultured in Dulbecco's Modified Eagle Medium (DMEM, ThermoFisher, Cat. No. 10567022) supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin, in standard conditions (37°C, 5% CO_2_). Myoblast differentiation was initiated by serum withdrawal using DMEM supplemented with 2% heat‐inactivated horse serum and 1% penicillin/streptomycin. All culture experiments were performed using three biologically independent lots. Myotubes were treated for 16 h with either 1% dimethyl sulfoxide (DMSO; vehicle control), 0.02% tobacco smoke condensate (TSC), or vape condensate (VC) at concentrations of 0.006%, 0.06%, and 0.3% to assess their effects on AHR activation. Tobacco smoke condensate was purchased from Murty Pharmaceuticals (NC1560725) and was prepared using the University of Kentucky's 3R4F Standard Research Cigarettes on an FTC Smoke Machine. The TSC concentration was selected based on our previous study, which demonstrated its efficacy in activating the AHR pathway in muscle cells (Margham et al., 2021). Vaping condensate was generated in our lab using a negative pressure vacuum system. A standard E‐cig liquid, filled with flavorless 48 mg/mL nicotine 50/50 propylene glycol/vegetable glycerin (PG/VG) e‐juice (VaporVapes, Sand City, CA), was used to produce E‐cig vapor, which was subsequently passed over dry ice to generate condensate. A 4.8% nicotine concentration was selected to reflect the typical nicotine concentrations currently found in commercial E‐cig products (DeVito & Krishnan‐Sarin, 2018).

Cell viability was assessed by incubating cells with 10 μM Ethidium Homodimer‐1 (EtHD‐1, Millipore Sigma #46043) in warm Hank's Balanced Salt Solution (HBSS, Gibco #24020) for 15 min at 37°C in 5% CO_2_. After the incubation, HBSS and EtHD‐1 were aspirated and fresh HBSS was added to the plate for imaging on an Evos FL2 Auto inverted fluorescent microscope (ThermoScientific; Cat. No. AMAFD2000) equipped with a 10x objective lens and EVOS FL Auto imaging software. EtHD‐1 is a cell‐impermeant viability indicator that is strongly fluorescent when bound to DNA; EtHD‐1‐positive myotube nuclei indicate cells with permeabilized plasma membranes. Myotubes treated with 0.25% Triton X‐100 were used as a positive control. EtHD‐1‐positive nuclei were quantified by a blinded investigator using ImageJ.

Myotube mitochondrial function

2.2

Following treatment, myotubes were washed with 1× phosphate buffered saline, trypsinized, collected, and centrifuged at 800g for 5 min. Pelleted cells were then resuspended in Buffer D (105 mM K‐MES, 30 mM KCl, 1 mM EGTA, 10 mM K_2_HPO_4_, 5 mM MgCl_2_‐6H_2_O, 2.5 mg/mL BSA, pH 7.2) supplemented with 20 mM creatine (Millipore sigma; Cat. No. C3630). Respiratory function was assessed via the OROBOROS O2k Oxygraph at 37°C. First, intact cell respiration was measured, followed by the addition of digitonin (10 μg/mL; ThermoFisher Scientific; Cat. No. BN2006) to permeabilize the myotubes. Pyruvate (5 mM; Combi‐Blocks; Cat. No. QA‐116), octanoylcarnitine (0.2 mM; Millipore sigma; Cat. No. 50892), and malate (2.5 mM; Millipore sigma; Cat. No. M7397) were added to induce state 2 respiration, followed by the addition of 4 mM ADP (Millipore sigma; Cat. No. A5285)to stimulate state 3 respiration. Exogenous cytochrome c (0.005 mM; Millipore sigma; Cat. No. C2506) was then added to confirm the outer mitochondrial membrane integrity. The rate of oxygen consumption (JO_2_) was normalized to the protein content measured by a bicinchoninic acid (BCA) protein assay (ThermoFisher Scientific, Cat. No. A53225).

Animal experiments

2.3

Male C57BL/6J mice (aged 12–16 weeks) were purchased from Jackson Laboratories (Stock No. 000664) and were housed under controlled environmental conditions with a light (12:12 light dark cycle), temperature (22°C), and humidity (50%). Animals were fed a standard rodent diet (Teklad 2018, ENVIGO, 18.6% crude protein). Four to five mice were randomly assigned to one of three exposure conditions: (1) room air as a control, (2) tobacco cigarette smoke, or (3) E‐cig vapor. The sample size was determined using G*Power (effect size of Cohen's d = 4.21; α = 0.05; power = 0.8), based on the primary outcome of AHR signaling informed by our previous study reporting an approximately 60‐fold increase in Cyp1a1 expression 6 h after 2‐h exposure to tobacco smoke compared with room air controls (Fitzgerald et al., 2024). A custom‐designed ljari™ system (La Jolla, CA) was used to deliver the tobacco smoke (1R6F certified reference cigarette purchased from CTRP at the University of Kentucky) and E‐cig vapor generated from flavorless, 48 mg/mL nicotine, 50/50 PG/VG e‐juice. Dedicated exposure cages free of food, water or bedding were used for each group during every 2‐h experiment. The animals were returned to their standard cages for the non‐exposure period to avoid secondhand or oral ingestion effects. Tobacco cigarette smoke was created by filling 0.3 g of research cigarette contents into each of the Ijari™ provided combustion atomizer tanks and burning the contents for 27 s with pre‐set voltage settings, while negative air pressure delivered the created smoke into the sealed animal chamber, every 10 min, for two consecutive hours, administering 6 full cigarettes during each exposure. The E‐cig vapor was achieved using 4.8% E‐cig juice poured into the sub‐ohm tank provided with the Ijari™ system, which generated two 7‐s heat cycles “puffs” every 5 min for two consecutive hours, delivering approximately 5 mL of E‐cig juice with each exposure. A key difference between our animal smoke exposure system and human smoking is the delivery of smoking. In contrast to humans, who actively inhale concentrated smoke directly into the lungs, animals are exposed to secondhand smoking and inhale smoke diluted in the chamber air, which is continuously suctioned through the ventilatory system. To account for this difference, nicotine delivery was tested through serum analysis using a cotinine ELISA kit (Calbiotech, Cat. No. CO096D‐100) at 0‐ and 6‐h post‐exposure. The acute group received a single 2‐h exposure, whereas the chronic group underwent 4 weeks of exposure (2 h/day, 5 days/week).

RNA‐isolation and RT‐qPCR

2.4

Total RNA was extracted from the cells or mouse gastrocnemius muscle using Direct‐zol RNA MiniPrep kit (Zymo Research, R2052) in accordance with the manufacturer's instructions. cDNA was generated from RNA using the LunaScript RT Supermix kit (New England Biolabs, E3010L) according to the manufacturer's directions. Real‐time PCR (RT‐PCR) was performed on a Quantstudio 3 (ThermoFisher Scientific) using Luna Universal qPCR master mix (New England Biolabs, M3003X) and the following primers: Ahr (Forward‐AACATCACCTATGC CAGCCG, Reverse‐GGTCTCTGTGTCGCTTAGAAGG), Ahrr (Forward‐CACCAGTCTGTGCGAATCGGAA, Reverse‐CAGTCTGTTCCCTGAGCACCAA), Cyp1a1 (Forward‐CAGCCTTCCCAAATGGTTTA, Reverse‐GCCTGGGCTA CACAAGACTC), Cyp1b1 (Forward‐GCCACTATTACGGACATCTTCGG, Reverse‐ACAACCTGGTCCAACTCAGCCT), and L32 (Forward‐TTCCTGGTCCACAATGTCAA, Reverse‐GGCTTTTCGGTTCTTAGAGGA), which was used as a control. Relative gene expression was calculated using the 2^−ΔΔCT^ method, normalized to the control group.

Nerve‐mediated muscle contractile function

2.5

Skeletal muscle contractile function was assessed in situ in the plantar flexor complex (gastrocnemius, plantaris, and soleus muscles) following stimulation of the sciatic nerve. Mice were anesthetized with ketamine (90 mg/kg) and xylazine (10 mg/kg); the Achilles tendon was carefully isolated and a silk ligature was tied and attached to the lever arm of the force transducer (Cambridge Technology; Model: 2250). Force frequency curves were created by stimulating at 1, 40, 80, 100, and 150 Hz with 1‐min rest between contractions, as previously described (Palzkill et al., 2025). Specific force was determined by normalizing peak force to muscle weight.

Isolation of skeletal muscle mitochondria

2.6

The gastrocnemius and plantaris muscles were carefully excised and cleared of blood, fat, and connective tissue, then finely minced on an ice‐chilled Petri dish using scissors. The minced tissue was incubated in an ice‐cold trypsin solution (0.025% w/v trypsin in 10 mM EDTA, prepared in 1× PBS) for 3 min and then centrifuged at 800×g for 5 min at 4°C. The trypsin‐containing supernatant was discarded, and the pellet was resuspended in approximately 12 mL of mitochondrial isolation medium (MIM; 50 mM MOPS, 100 mM KCl, 1 mM EGTA, 5 mM MgSO_4_) supplemented with 0.02% w/v bovine serum albumin (2 g/L BSA; Millipore sigma; Cat. No. A7030). The sample was homogenized on ice using a glass‐Teflon homogenizer and centrifuged at 800×g for 10 min at 4°C. The supernatant was collected and centrifuged again at 10,000×g for 10 min at 4°C to obtain a mitochondria‐enriched pellet. The pellet was washed to remove damaged mitochondria and gently resuspended in MIM without BSA.

Assessment of mitochondrial function

2.7

Maximum respiratory capacity was assessed using the high‐resolution OROBOROS O2k system with mitochondrial assay buffer D supplemented with 20 mM creatine monohydrate. Mitochondria were initially energized by the addition of 2.5 mM malate and 5 mM pyruvate (state 2). Subsequently, 4 mM ADP was introduced to stimulate maximal oxidative phosphorylation capacity (state 3), followed by 0.005 mM cytochrome c to verify mitochondrial membrane integrity. Finally, 10 mM succinate (Millipore sigma; Cat. No. S3674) was added to activate complex II‐linked respiration. The oxygen consumption rate (JO_2_) was normalized to protein content quantified via BCA assay (ThermoFisher Scientific, Cat. No. A53225).

Statistical analysis

2.8

All data are presented as the mean ± standard deviation (SD). Normality was assessed by the Shapiro–Wilk test and inspection of QQ plots. For experiments with sample size of less than n = 6, a non‐parametric Kruskal–Wallis test was used. For repeated‐measures comparisons, data were analyzed using repeated measures analysis of variance (ANOVA) followed by Tukey's post‐hoc test or two‐way ANOVA, as appropriate. All statistical analyses were conducted using GraphPad Prism software (version 10.0). A p‐value <0.05 was considered statistically significant.

RESULTS

3

The AHR pathway was activated by tobacco smoke and vape condensate in cultured muscle cells

3.1

Tobacco smoke exposure activates the AHR pathway, which mediates some portion of muscle pathology seen with chronic tobacco smoking (Fitzgerald et al., 2024; Thome et al., 2022). To examine if E‐cig products activate the AHR pathway, we treated cultured C2C12 myotubes with either tobacco smoke condensate or increasing concentrations of E‐cig vapor condensate for 16 h. Neither tobacco smoke condensate nor E‐cig vapor condensates altered cell viability with this treatment protocol (Figure 1a). mRNA analysis revealed that tobacco smoke condensate (0.02%) and 0.3% E‐cig vapor condensate significantly increased expression of Ahrr (Figure 1c) and Cyp1a1 (Figure 1d), two canonical AHR pathway genes activated by ligand binding, without affecting Ahr expression levels (Figure 1b). These findings indicate that E‐cig vapor condensate requires markedly higher concentrations (0.3% VC) than tobacco smoke condensate (0.02% TSC) to produce comparable activation of AHR signaling under in vitro conditions. Next, we permeabilized the myotubes following treatments and performed respirometry to assess mitochondrial function (Figure 1e). Under State 2 conditions, both tobacco smoke and E‐cig vapor condensate reduced respiration when compared to DMSO‐treated control cells (Figure 1f). With State 3 (ADP‐stimulated) conditions, tobacco smoke condensate did not significantly alter respiration (p = 0.21), whereas 0.3% E‐cig vapor condensate significantly reduced State 3 respiration when compared to DMSO‐treated myotubes (Figure 1g).

Tobacco smoke and E‐cig vapor condensates activate the AHR pathway and alter mitochondrial respiration in cultured muscle cells. (a) C2C12 myotubes were treated for 16 h without affecting cell viability. (b–d) mRNA expression of Ahr, Ahrr, and Cyp1a1 in treated myotubes. (e) Schematic overview of mitochondrial assay. (f, g) Mitochondrial respiration assessed using respirometry. Data analyzed using Kruskal‐Wallis test. N = 4–6 biological replicates per group. Error bars represent the standard deviation.

Acute exposure to tobacco smoke, but not E‐cig vapor, activated the AHR pathway in skeletal muscle from male mice

3.2

Next, we performed a single 2‐h passive exposure to either room air, tobacco smoke, or E‐cig vapor (Figure 2a). Serum samples were collected immediately after the exposure and again 6 h later, with cotinine measurements confirming that both tobacco and vapor exposures resulted in significant nicotine delivery compared with those exposed to room air (Figure 2b). Serum cotinine levels following E‐cig and tobacco smoke exposure are comparable to those observed in human moderate‐to‐heavy smokers (Zhang et al., 2016). Six hours after the acute exposure, gastrocnemius muscles were harvested for analysis of genes associated with AHR signaling. In contrast to the cell culture system, only tobacco smoke exposure significantly activated the AHR pathway in skeletal muscle (Figure 2d–f) without alteration of Ahr levels (Figure 2c).

A single 2‐h E‐cig exposure does not activate the AHR pathway in skeletal muscle. (a) Graphical depiction of experimental groups and exposure time. (b) Serum cotinine levels measured immediately after (0 h post) and 6 h post exposure. (c–f) mRNA expression of Ahr, Ahrr, Cyp1a1, and Cyp1b1 in gastrocnemius muscle from male mice. Data analyzed using Kruskal–Wallis test. N = 5 per group. Error bars represent the standard deviation.

Chronic tobacco smoke or E‐cig vapor impaired skeletal muscle mitochondrial respiratory function, but not contractile function in male mice

3.3

Next, we performed a four‐week in vivo chronic exposure to either room air, tobacco smoke, or E‐cig vapor, consisting of 2 h/day and 5 days/week, using male C57BL/6J mice (Figure 3a). Compared to the room air control group, neither tobacco smoke nor E‐cig vapor groups showed significant changes in body weight (Figure 3b) or absolute hindlimb muscle mass. However, hindlimb muscle masses normalized by body weight were significantly reduced following 4 weeks of exposure to E‐cig vapor, with a trend toward decrease in the tobacco smoke group (Figure 3c). Using mitochondria isolated from the gastrocnemius and plantaris muscles, high‐resolution respirometry (Figure 3d) revealed that both chronic exposure to tobacco smoke and E‐cig vapor reduced State 3 respiration rates compared with room air controls (Figure 3f–h) with comparable State 2 respiration rates (Figure 3e). However, nerve‐mediated contractile testing (Figure 3i) exhibited no differences in absolute force, specific force, or fatigability of the plantar flexor complex (Figure 3j,k).

Chronic tobacco smoke or E‐cig exposure reduces skeletal muscle mitochondrial respiration but not contractile function in male mice. (a) Graphical depiction of experimental groups and exposure time. (b) Body weight. (c) Mass of hindlimb muscles normalized by body weight. (d) Schematic overview of mitochondrial assay. (e–h) Mitochondrial respiratory function. (i) Schematic overview of in situ muscle function testing. (j–k) Plantar flexor muscle contractile strength measured in situ. Data analyzed using Kruskal–Wallis test. N = 4 per group. Error bars represent the standard deviation.

DISCUSSION

4

This study evaluated the impact of acute or chronic exposure to E‐cig vapor and tobacco smoke on the activation of the AHR pathway, mitochondrial respiration and contractile function in murine skeletal muscle. Whereas both tobacco smoke and E‐cig vapor condensates activated the AHR signaling pathway in cultured muscle cells, only tobacco smoke exposure activated the AHR pathway in skeletal muscle in vivo. This finding suggests that E‐cig products contain AHR ligands, but the quantity or potency of these ligands was insufficient to activate the AHR pathway in skeletal muscle with the exposure conditions used in our study. This finding is likely due to the fact that E‐cig products contain less than 200 chemical compounds, in contrast to the thousands of compounds identified in traditional cigarettes, including potent AHR ligands such as TCDD (Rinaldi et al., 2012). These findings highlight gaps in our knowledge, including the precise chemical composition of E‐cig vapor and its biological effects.

AHR activation in muscle results in decreased mitochondrial respiratory function, and that deletion of the AHR can partially prevent these effects (Fitzgerald et al., 2024; Thome et al., 2022). The experiments reported here support these findings, as tobacco smoke exposure upregulated AHR signaling pathways and decreased State 3 (ADP‐stimulated) respiration rates in skeletal muscle mitochondria. Interestingly, chronic E‐cig exposure also decreased State 3 (ADP‐stimulated) respiration rates in skeletal muscle mitochondria without affecting AHR‐related gene expression, suggesting a possible AHR‐independent mechanism, such as increased oxidative stress, direct mitochondrial toxicity from solvent compounds like propylene glycol or glycerol degradation products (Correia‐Álvarez et al., 2020), or nicotine‐mediated mitochondriopathy (Chitteti et al., 2025; Malińska et al., 2019), may underlie the mitochondrial dysfunction caused by these products. Although they may lack the combustion‐related byproducts, our data show that even in the absence of robust AHR activation, E‐cig exposure can still impair mitochondrial function. This highlights the need for further investigation into the specific components of E‐cig products responsible for the impaired respiratory function in skeletal muscle, as such mitochondrial impairments may have significant implications for muscle performance, metabolic health, and fatigue in populations with chronic exposure.

Daily exposure to E‐cig or tobacco smoke for 2 h over 4 weeks reduced relative muscle mass although absolute muscle mass did not differ among the three groups. This finding is consistent with previous studies and suggests that smoking may disrupt the balance between muscle protein synthesis and degradation or impair mitochondrial function, thereby compromising the maintenance of muscle mass (Caron et al., 2013; Degens et al., 2015; Petersen et al., 2007). However, there was no impact of 4 weeks of daily tobacco smoke or E‐cig exposure on absolute or specific muscle strength, as measured in situ using the plantar flexor complex. This is consistent with previous studies in which contraction was assessed in the EDL muscle of mice exposed to longer durations of tobacco smoke (Fitzgerald et al., 2024; Rinaldi et al., 2012). This may be related to fiber‐type composition, as both the EDL and the majority of plantar flexor (plantaris and gastrocnemius) muscles in mice have a high proportion of fast‐twitch myofibers. In contrast, the soleus muscle has been shown to develop weakness and increased fatigability following 6 months of tobacco smoke exposure in mice (Rinaldi et al., 2012). In support of this fiber‐type specific susceptibility, Decker et al. (Decker et al., 2023) recently reported that in vitro exposure of striated muscles to tobacco smoke condensate most significantly impaired mitochondrial respiratory function in muscles with higher mitochondrial content.

While skeletal muscle contractile strength was preserved in this model, mitochondrial dysfunction often precedes muscle atrophy and overt functional impairments (Chen et al., 2022; Yamada et al., 2012). This bioenergetic impairment may compromise endurance or recovery from muscle fatigue, especially in aging populations or individuals with comorbidities such as diabetes or peripheral artery disease. Because this study focused primarily on measures of muscle strength, it remains unclear whether the observed mitochondrial deficits translate into impairments in endurance or fatigability. Thus, longitudinal studies incorporating repeated contractions are warranted to assess whether continued E‐cig exposure leads to measurable declines in physical performance, especially among at‐risk populations.

Furthermore, the finding that E‐cig exposure delivered nearly twice the systemic nicotine levels as tobacco smoke highlights another important consideration: the potential for increased nicotine‐related cardiovascular or neuromuscular effects. Nicotine has been shown to independently impair endothelial function, increase sympathetic tone, and modify mitochondrial bioenergetics (Adamopoulos et al., 2008; Malińska et al., 2019). This raises concern that E‐cig use, particularly in high‐dose or prolonged patterns, could result in compounded physiologic stress. From a public health perspective, these results are especially concerning given the rapidly increasing use of E‐cig among adolescents and young adults. The perception that vaping is a “safer” alternative may contribute to its early adoption, yet the mitochondrial effects seen here, even in the absence of overt AHR activation, suggest that long‐term exposure may carry risks that are not fully understood. Moreover, as deeper mechanistic insights surrounding the biology of E‐cig exposure are realized longitudinally, regulatory agencies may need to reassess labeling, flavoring regulations, and marketing practices aimed at youth.

While this study provides important insight into the pathological impact of E‐cig and tobacco cigarette exposure on skeletal muscle and mitochondrial function, several limitations should be acknowledged. First, small sample size may have left the study underpowered to detect changes in mitochondrial or skeletal muscle function since the sample size was determined based on the primary aim of detecting AHR signaling. Future studies with larger sample size are needed to validate these findings and strengthen the robustness of the conclusions. Second, the exclusive use of male mice may limit the applicability and generalizability of our findings to female animals, as prior studies have reported sex‐specific differences in the physiological consequences of AHR signaling differ between male and female mice (Balestrieri et al., 2023; Fitzgerald et al., 2024; Thome et al., 2024). Inclusion of both sexes in future studies will be necessary to fully characterize potential sex‐dependent effects of E‐cig vapor. Third, serum cotinine levels were not comparable between tobacco smoke and E‐cig exposures, with higher levels observed in the animals exposed to E‐cig vapor. These results suggest that, even though the visible smoke concentration in the chamber was standardized, the inherently higher nicotine content of e‐liquids compared to tobacco cannot be ruled out (Goniewicz et al., 2018). Future studies using matched nicotine doses and standardized exposure paradigms are needed to elucidate the mechanisms underlying these differences in nicotine uptake and their impact on skeletal muscle health. Fourth, muscle contractile function was primarily assessed at higher stimulation frequencies, which may have overlooked changes in force generation and rate of fusion occurring at lower frequencies. Future studies including lower frequencies (e.g., 10–20 Hz) could provide a more complete characterization of contractile dynamics and the effects of tobacco smoke and E‐cig exposure. Lastly, while our study provides valuable insights into the effects of tobacco smoke and E‐cig exposure on skeletal muscle, we did not employ unbiased molecular profiling techniques, such as RNA sequencing, which could reveal additional mechanistic pathways. Future studies incorporating such comprehensive approaches are needed to elucidate the molecular mechanisms underlying the divergent effects of these exposures.

In summary, E‐cig exposure impairs skeletal muscle mitochondrial respiration to a similar extent as traditional tobacco cigarette smoke in male mice. In cultured muscle cells, both E‐cig vapor and tobacco smoke condensates activate the AHR pathway, but in vivo, only tobacco smoke exposure activated the AHR pathway in the skeletal muscle of male mice. Future work is needed to quantify the concentration of AHR ligands and detailed chemical analyses in E‐cig products and to elucidate the mechanisms by which E‐cig exposure impairs mitochondrial function.

AUTHOR CONTRIBUTIONS

Conceptualization: Scott A. Berceli, Terence E. Ryan, Scott T. Robinson, Kyoungrae Kim. Investigation: Pavel Mazirka, Jaewon Choi, Samuel Alvarez, Pascual Jahuey, Kyoungrae Kim. Formal analysis: Pavel Mazirka, Jaewon Choi, Kyoungrae Kim. Original draft: Pavel Mazirka, Terence E. Ryan, and Kyoungrae Kim. Review and editing: Pavel Mazirka, Jaewon Choi, Samuel Alvarez, Pascual Jahuey, Kerri A. O'Malley, Scott T. Robinson, Salvatore T. Scali, Terence E. Ryan, and Scott A. Berceli, Kyoungrae Kim. All authors revised and approved the final version of the manuscript.

FUNDING INFORMATION

This research was funded by the James and Esther King Biomedical Research Program (Florida Department of Health), grant number 23K04 awarded to SAB. Additionally, this work was funded by the Interdisciplinary Training for Vascular Surgeon Scientists Grant NIH T32HL160491 (PM, SAB).

CONFLICT OF INTEREST STATEMENT

The authors declare no conflicts of interest.

ETHICS STATEMENT

The authors have nothing to report.