Host-specificity assessment of feline alphaherpesvirus-1 derived immunocontraceptive candidates in non-feline models
Ellen Cottingham, Natali Krekeler, Thurid Johnstone, Carol Hartley, Joanne Devlin
TL;DR
This study assesses whether a cat-specific virus can infect non-feline species and found no evidence of infection or reproductive disruption.
Contribution
The study provides new evidence supporting the feline-specificity of FHV-1 as a potential vaccine vector.
Findings
FHV-1 and its variants did not replicate in non-feline cell lines.
No clinical signs or reproductive tissue disruption was observed in the murine model.
Findings support FHV-1's use as a feline-specific viral vector.
Abstract
Feline alphaherpesvirus-1 (FHV-1) is generally considered to have a narrow host range restricted to the Felidae family. As a result, FHV-1 has been proposed as a potential vaccine vector to carry foreign pathogen or immunocontraceptive antigens, for use in domestic cat (Felis catus) populations. The species-specificity of FHV-1 has been described previously in the 1970s where several non-feline hosts were assessed for their inability to be infected by FHV-1. However, more recently, evidence of FHV-1 infection in BALB/c mice was reported, furthering the need for additional investigation into the host range potential of FHV-1. This study investigated the species-specificity of FHV-1 and three modified FHV-1 variants containing antigens intended as immunocontraceptive targets. Their ability to replicate in respiratory tissue, cause clinical signs and induce disruptions in female…
Genes, proteins, chemicals, diseases, species, mutations and cell lines named across the full text — each resolved to its canonical identifier and authoritative record.
Click any figure to enlarge with its caption.
Figure 1
Figure 2
Figure 4
Figure 4- —https://doi.org/10.13039/501100020071Cybec Foundation
Peer Reviews
No public reviews on file for this paper yet. If you reviewed it on a platform where reviews are public (OpenReview, ICLR, NeurIPS, ICML), you can paste yours below so the community can read it here.
Videos
No videos yet. Explain this paper in a talk, walkthrough, or lecture? Add one.
Taxonomy
TopicsViral-associated cancers and disorders · Cytomegalovirus and herpesvirus research · Herpesvirus Infections and Treatments
Introduction
Herpesvirus are double-stranded DNA viruses and are generally considered to have a high level of species-specificity, and members of the Herpesviridae family have been identified in a wide variety of animal phyla, from Mollusca to Chordata [1]. The species-specificity of herpesvirus is thought to be due to early infection of an ancestral host and consequent co-evolution. However, species restriction of herpesvirus can vary and herpesvirus infections outside of the expected natural host range can occur. On these occasions, the infection may result in more significant disease than in a natural host [1–3].
Species-specificity is a key requirement for potential immunocontraceptive agents involving virus vectors and restriction to a host range is essential to mitigate unwanted contraceptive impacts in non-target hosts [4].
Feline alphaherpesvirus-1 (FHV-1) commonly causes respiratory infection in domestic cats (Felis catus) and replicates in feline primary and immortalised cell lines [5]. However other members of the Felidae family can also become infected with FHV-1 including lions (Panthera leo) [6], cheetahs (Acinonyx jubatus) [7] and tigers (Panthera tigris) [8].
In a review of FHV-1 in 1979, the ability of FHV-1 to infect non-feline hosts both in vivo and in vitro was discussed [5]. Feline alphaherpesvirus-1 could not infect continuous kidney epithelial cell lines derived from several species, namely cow (Bos taurus), sheep (Ovis aries), pig (Sus domesticus), rabbit (Oryctolagus cuniculus), chicken (Gallus gallus domesticus), dog (Canis familiaris), human (Homo sapiens), African green monkey (Chlorocebus sabaeus), dolphin (Delphinus delphis) and whale. In vivo, inoculation of dog (Canis familiaris), rat (Rattus norvegicus), mice (Mus musculus), guinea pig (Cavia porcellus) and rabbit (Oryctolagus cuniculus) with FHV-1 via intranasal, intramuscular or intraperitoneal injection did not result in infection [5]. However more recently, BALB/c mice inoculated with an FHV-1 strain of B927 at a titre of 10^5^ TCID50/100 µL reportedly developed signs of infection, and FHV-1 viral DNA (vDNA) was detected in several tissue types [9].
FHV-1 contains a large double stranded DNA genome allowing for stable integration of transgenes and has been proposed as an immunocontraceptive vector to manage overabundant cat populations by inducing an immune response in cats that disrupts their reproductive potential [10–12]. Feral cats are an invasive species in locations such as Australia and New Zealand and pose a significant threat to native species [13, 14]. Both Australia and New Zealand do not contain native felines, and their isolated locations have resulted in unique native species that cannot interbreed with domestic cats. This divergence may enable the use of FHV-1 derived immunocontraceptives to manage feral cats as FHV-1 is unlikely to cross species barriers to impact native wildlife.
The FHV-1 immunocontraceptives described previously [15] have been developed as a potential population control tool for feral cats in Australia, with attenuated variants developed as both a potential contraceptive, and vaccine against FHV-1. These strains were derived from the F2-like strain and were modified to contain feline gonadotropin releasing hormone (GnRH) and zona pellucida subunit 3 (ZP3), which are common reproductive targets for immunocontraceptive development. This study sought to further investigate the species-specificity of FHV-1 and the three FHV-1 derived immunocontraceptives in in vivo and in vitro systems of non-feline hosts. The results have important implications for the safety of FHV-1 vectored immunocontraceptive agents and contribute additional evidence supporting FHV-1 restriction to feline hosts.
Materials and methods
Murine in vivo study design
The study was conducted with approval from the Animal Ethics Committee at the University of Melbourne (ethics ID 10492). One hundred, 6-week-old BALB/c mice (50 females and 50 males) were sourced from the Animal Resource Centre (Perth, Australia). Mice were divided into five groups of 20 mice (10 male and 10 female) and housed in bioresource facilities within the University of Melbourne in filter top boxes (5 mice of a single sex per box) under barrier conditions. Mice were provided access to food and water ad libitum.
On day 0, mice were anesthetised by inhalation with 4% v/v isoflurane in oxygen which was then dropped to 1–2% to maintain anaesthesia and inoculated intranasally with 50 µL of virus inoculum at a concentration of 10^6.15^ TCID50/mL of either FHV-1, FHV-GZeG, FHV-GZeGTmC, FHV-GZeGTmC2 or sterile DMEM (mock infected group). Inoculation occurred in a biological class 2 safety cabinet (BSC-II) and surfaces were disinfected with 80% v/v ethanol and ten minutes of ultraviolet irradiation (UV) between strain inoculations to ensure no cross contamination occurred between treatment groups. Mice were returned to their boxes and monitored until fully recovered from anaesthesia. Five mice from each group were euthanised on day 1, 4, 8 and 14 post-inoculation (Fig. 1). Prior to inoculation, mice were weighed to calculate pre-experimental body weight. Following inoculation, mice were observed for any signs of illness twice per day in the first week, dropping to once per day in the second week.
The unused portion of the virus inoculums was retained and stored at −70°C. A portion of the inoculums were thawed and titrated using a TCID_50_ assay on CRFK cells to confirm inoculation had occurred with the correct dosage.
Fig. 1. Experimental outline of 14-day assessment of FHV-1 derived immunocontraceptives in a murine model. Inoculation with either mock, FHV-1, FHV-GZeG, FHV-GZeGTmC or FHV-GZeGTmC2 occurred on day 0. Five mice per group were euthanised on days 1, 4, 8 and 14 post infection. Lung tissue and blood samples were taken from all mice on each of these days, and ovaries and testes were collected on day 14
Viruses
The FHV-1 derived strains used in this study have been described previously [15]. This study also utilized the FHV-1 F2 like-vaccine strain [16] which is the parent strain of the viruses engineered to contain immunocontraceptive antigens, hereinafter referred to as “FHV-1”. Briefly, the immunocontraceptive candidate FHV-GZeG contains GnRH, ZP3 and enhanced green fluorescence (eGFP). Derived from FHV-GZeG, the immunocontraceptive candidates FHV-GZeGTmC and FHV-GZeGTmC2 both retain GnRH, ZP3 and eGFP but also contain codon usage bias deoptimization of the thymidine kinase (TK) gene and incorporation of a red fluorescence gene (mCherry). The two codon deoptimized strains vary with regards to the promoter used to drive mCherry expression. Strain FHV-GZeGTmC contains an mCherry coding region under the control of a CMV promoter whereas strain FHV-GZeGTmC2 contains an mCherry fused to the 3’ deoptimized TK coding sequence and is under the control of the endogenous TK promoter. Virus titres were determined in Crandell Rees feline kidney (CRFK) cells [17] before being frozen, thawed and centrifuged (5,000 × g, 5 min, 4 °C) to remove cell debris as described previously [15]. Virus aliquots were stored at −70°C.
Cell lines
Crandell Rees feline kidney (CRFK) [18] cells were used to prepare the stocks of FHV-1, FHV-GZeG, FHV-GZeGTmC and FHV-GZeGTmC2 that were used to inoculate BALB/c mice. Various other non-feline cell lines were used to test for cross species infectivity of FHV-GZeG, including Madin-Darby bovine kidney (MDBK, bovine kidney epithelial cell type), Madin-Darby Canine Kidney [19] (MDCK, canine kidney epithelial cell type), JU56 [20] (wallaby fibroblast cell line), Ptk1 [21] (potoroo epithelial cell line), Vero [22] (African green monkey kidney epithelial cell line) and LA-4 [23] (mouse lung epithelial cell line). Cells were grown in growth medium which was Dulbecco’s Modified Eagle Medium (DMEM, Sigma Aldrich) containing 5% v/v foetal bovine serum (FBS, Gibco), 10 mM N-2-hydroxyethylpiperazine-N’−2-ethanesulfonic acid (HEPES, pH 7.7), 50 µg/mL ampicillin and 50 µg/mL of gentamicin in a humidified atmosphere of 5% v/v CO_2_ in air at 37°C. Maintenance medium was of the same composition with the exception of FBS that was reduced to 1% v/v.
Inoculation of cell lines with FHV-GZeG
Cell lines MDBK, MDCK, JU56, Ptk1, Vero, LA-4 and CRFK were infected with the immunocontraceptive candidate FHV-GZeG and examined for their ability to support infection as measured by the presence of viral RNA transcripts (vRNA), expression of GFP and cytopathic effect (CPE). All cell lines were seeded onto 6 well plates and allowed to reach 80% confluency with growth media. Each cell line had a total of three replicates inoculated with FHV-GZeG at a multiplicity of infection (MOI) of 10 while an additional replicate was left uninfected as a negative control. After 4 h of incubation at 37°C, the inoculum was removed, and monolayers were washed 10 times with 2 mL of phosphate buffered saline (PBS, 137 mM NaCl, 2.7 mM KCl, 10 mM Na_2_HPO_4_ and 1.8 mM KH_2_PO_4_, pH 7.4). Cell culture maintenance medium was then added to wells and plates were returned to the incubator for 7 days. Cells were viewed with an inverted microscope using both light and fluorescence microscopy every 48 h to detect green fluorescence or CPE compared to the uninfected controls. At 7 days post inoculation, cells were harvested for extraction and detection of vRNA.
A second experiment using cell lines Vero, LA-4, JU56 and CRFK inoculated with FHV-GZeG was conducted to quantify vDNA by qPCR at 0, 3 and 7 days post inoculation. Cells were prepared and inoculated as described above, and well contents were collected at day 0 (immediately after washing with PBS), day 3 and day 7.
Serum, lung and reproductive tissue collection
On days 1, 4, 8 and 14 post inoculation mice were euthanised via cervical dislocation under deep anaesthesia (5% v/v isoflurane in oxygen). At days 1, 4, 8 and 14, blood and lung samples were collected post-mortem. Blood samples were centrifuged at 4000 × g for 5 min at room temperature to allow for collection of serum. The serum was stored at −70°C until required. Lung samples were minced with a sterile scalpel blade prior to storage in DMEM at −70°C. Collection of lung homogenate occurred in a BSC-II and surfaces were disinfected with 80% v/v ethanol and ten minutes of UV to ensure no cross contamination occurred between treatment groups. On day 14 post inoculation, ovaries and testes were collected in paraformaldehyde (4% w/v in PBS).
DNA and RNA extraction, and generation of cDNA
Extraction of vRNA and vDNA from cell cultures inoculated with 10 MOI of FHV-GZeG was performed using RNeasy mini kit (QIAGEN). For the detection of vRNA, any remaining DNA was removed using the Turbo DNA-free kit (Life Technologies) and the samples were reverse transcribed using random hexamers (Thermo Fisher Scientific) and SuperScript™ III Reverse Transcriptase (Thermo Fisher Scientific) to produce cDNA. The resultant cDNA samples were stored at −20°C until used as template in RT-qPCR. For the detection of vDNA, the extracts were stored at −20°C without DNase treatment for use as template in qPCR.
Extraction of vDNA from mouse lung tissue was conducted using 200 µL of homogenised lung suspension and the MagMax™ CORE purification kit (Thermo Fisher Scientific) according to manufacturer’s instructions. Extractions were performed using the automated KingFisher™ Flex System (Thermo Fisher Scientific) and stored at −20°C. Positive extraction controls utilised 200 µL of lung homogenate from mock infected negative control mice spiked with 3 µL of FHV-1 stock (10^3.65^ TCID50). Negative extraction controls utilised sterile DMEM.
Detection and quantification of vDNA and cDNA
The cDNA or vDNA were used as template (3 µL) in qPCRs targeting the FHV-1 infected-cell polypeptide 4 (ICP4) or thymidine kinase (TK) genes. In all samples glyceraldehyde 3-phosphate dehydrogenase (GAPDH) primers was also used in qPCR to ensure the extraction process had been successful. The reactions utilised GoTaq^®^ DNA polymerase (Promega) according to the manufacturer’s reaction mixture conditions with the addition of SYTO™ 9 green fluorescent nucleic acid stain (Thermo Fisher Scientific) to allow for detection of DNA using the Aria Mx Real-time PCR system (Agilent) in a total reaction volume of 25 µL. Cycling conditions were as follows: 95°C for 3 min (m), 35 cycles of 90°C for 30 s (s), 58°C for 30 s, 68°C for 20 s and a final step of 95°C for 30 s, 65°C for 30 s and 95°C for 30 s.
The qPCR assays included standards containing known quantities of template. For this, partial coding regions of ICP4, TK and GAPDH were amplified using GoTaq^®^ polymerase and the primers found in Table 1. These primers were validated previously [15]. These PCR fragments were ligated separately into pGEM-T plasmid vector (Promega) using DNA ligase (NEB) and amplified in JM109 electrocompetent Escherichia coli after blue-white selection and gel electrophoresis to detect colonies containing inserts of the expected size. Following plasmid extraction (Wizard Plus SV Minipreps DNA Purification System, Promega) and quantification (Thermo Fisher NanoDrop™ spectrophotometer), 10-fold dilutions of plasmid (10^8^ to 10^2^ copies per reaction) were prepared and used to generate standard curves. Negative control samples (sterile DMEM) and positive control samples (DNA extractions of stock material of FHV-1 and FHV-1 derived immunocontraceptives) were also included.
Table 1. Primers used in RT-qPCR, qPCR and conventional PCR. The primers displayed in this table were used for reverse transcription quantitative polymerase chain reaction (RT-qPCR), qPCR and conventional PCRPrimer sequence 5'−3'Target region (fragment size in base pair)DirectiongccatcaatgaccccttcatFeline GAPDH (164 bp for feline GAPDH gene, approximately 80 bp for murine GAPDH)ForwardgccgtggaatttgccgtFeline GAPDH (164 bp for feline GAPDH gene, approximately 80 bp for murine GAPDH)ReversetagatcaccccctctttccFHV-1 ICP4 (201 bp)ForwardccactactttcacgtcctcFHV-1 ICP4 (201 bp)ReversecagtgttttcaaagcccgggFHV-1 wildtype thymidine kinase (TK) (150 bp)ForwardgcggggcacattcatcFHV-1 wildtype thymidine kinase (TK) (150 bp)ReverseccgatgctatattggcgaFHV-1 deoptimized thymidine kinase (TK) (137 bp)ForwardgcaaatcgcgcttgataatFHV-1 deoptimized thymidine kinase (TK) (137 bp)Reverse
The stored vDNA extracts originating from mouse lung homogenates were used as template (3 µL) in conventional PCRs targeting the FHV-1 ICP4 and TK genes, and the GAPDH gene (using feline GAPDH primers that also amplify murine GAPDH) (Table 1). Reactions also utilised GoTaq^®^ DNA polymerase according to manufacturer’s recommendations with cycling conditions as follows: 95°C for 2 m, 35 cycles of 95°C for 30 s, 58°C for 30 s and 68°C for 1 m, followed by final extension of 68°C for 5 m. Positive control samples included mock infected mouse lung homogenate spiked with laboratory stocks of FHV-1, and also samples containing 1/300 dilution of pGEM-T vectors separately carrying ICP4, TK and GAPDH inserts that were previously generated for qPCR analyses. The negative control sample was sterile DMEM media. Amplification of target DNA was assessed by gel electrophoresis using a 2% w/v agarose gel in SYBR™ Safe DNA gel stain (Thermo Fisher, Life Technologies Australia).
Preparation of FHV-1 antigen for enzyme linked immunosorbent assay (ELISA)
FHV-1 antigen was purified by infecting a cell culture flask containing 75 cm^2^ CRFK cells at 100% confluency with FHV-1 until all cells showed CPE. Viral supernatant was removed and cleared of cell debris by centrifugation at 5000 × g for 5 min at 4°C. The virus was then pelleted from the supernatant at 40,000 × g for 1 h at 4°C. The supernatant was removed, and the pellet was resuspended in TNE (10 mM Tris-HCl pH 7.4, 100 mM NaCl, 1 mM EDTA) buffer. Virus in suspension was then overlaid on a continuous gradient of 5–15% w/v Ficoll in TNE. The tube was centrifuged at 15,000 × g for 2 hours at 4°C with no break. A band of virus was visualised, and an 18-gauge needle inserted just below the band in order to collect the band. The fraction was diluted with TNE buffer and further pelleted at 40,000 × g for 1 h at 4°C. Supernatant was removed and the pellet finally resuspended in 100 μL of TNE buffer to form the purified FHV-1 antigen.
Detection of antibodies to GnRH and FHV-1 by ELISA
To detect IgG antibodies, purified GnRH (Thermo Fisher Scientific Cat #PEP-168) and purified FHV-1 were coated at 5 µg per well in coating buffer (32 mM Na_2_CO_3_, 38 mM NaHCO_3_, pH 9.6) onto 96 well plates (Maxisorb, Nunc). Detection of IgM antibodies against FHV-1 was conducted on plates coated with 2.5 µg of FHV-1 antigen per well. Once coated with antigen, the plates were wrapped in cling film and incubated overnight at 4°C. Excess coating antigen was removed by aspiration and wells were washed with PBS containing 0.05% v/v tween 20 (PBS-T) at a pH of 7. Unoccupied sites were blocked with 100 µL of bovine serum albumin (BSA) blocking buffer in PBS-T (1% w/v BSA Fraction V (Roche), 5% v/v normal sheep serum, 10% v/v PBS-T) for a minimum of 2 h at 37°C. Serum samples were prepared at a 1/20 dilution in a BSA diluent buffer (0.5% w/v BSA Fraction V, 2.5% v/v normal sheep serum in PBS) and 50 µL added to wells as the primary antibody. Polyclonal antibodies to GnRH (ThermoFisher Cat # PA1-121) at 1/500 dilution in PBS-T were used as a positive control primary antibody for the GnRH ELISA. The positive control primary antibody for the FHV-1 ELISA was serum diluted 1/1000 in PBS-T from a domestic/owned cat that had a neutralising antibody titre to FHV-1 of 160 [24] (reciprocal of the highest dilution of the serum capable of neutralising FHV-1). The primary antibodies were incubated for 2 h at room temperature followed by four washes with PBS-T. The secondary antibodies were then added at a 1/500 dilution in BSA diluent and incubated for 45 min. The secondary antibodies for detection of IgG antibodies to FHV-1 and GnRH in the mouse serum was horse radish peroxidase (HRP) labelled sheep anti-mouse IgG (Cytiva Cat #NA931V). Detection of IgM antibodies against FHV-1 used HRP labelled anti-mouse IgM antibodies raised in goat (Sigma-Aldrich Cat #A8786) as the secondary antibody. For the GnRH antibody positive control, the secondary antibody was HRP conjugated anti-rabbit IgG raised in pig (Agilent DAKO Cat #PO217). The secondary antibody used in the FHV-1 positive control was anti-feline IgG antibodies raised in goat (Thermo Fisher Scientific Cat #A18757).
After incubation, the solutions containing secondary antibody were aspirated and wells washed four times with PBS-T. One hundred microlitres of substrate, 1-Step™ ABTS Substrate Solution (Thermo Fisher Scientific Cat #37615), was allowed to develop for 20 min at room temperature. Wells were then read in an FLUOstar Omega Microplate Reader (BMG LABTECH) at an absorbance of 410 nm.
Histology of reproductive tissues
On day 14 post infection, ovaries and testes were removed from mice at post-mortem for histological examination and identification of any changes resulting from immune-directed disruption. Once removed, ovaries and testes were placed directly into paraformaldehyde (4% w/v in PBS) and then processed by the Melbourne Histology Platform at the University of Melbourne, which included embedding in paraffin and preparation of slides at the depth of 5 μm depth before staining using hematoxylin and eosin (H&E). In total, 3 ovaries and 2 sets of testes per experimental group was collected. When examining the ovaries, the number of corpora lutea was compared between mice inoculated with FHV-1 or FHV-1 derived immunocontraceptive strains to the mock infected group. Characterisation of the number of corpora lutea is consistent with other studies examining the effect of GnRH inhibition and impact on the consequent release of FSH and LH which in turn regulate maturation of follicles and ovulation. Mice immunized with a GnRH vaccine typically display reduced number of corpora lutea as a result of inhibited production of LH and FSH [25]. When examining testes, the morphology of the tissue was noted, including the presence or absence of apoptotic cells and sperm in seminiferous tubules.
Statistical analysis
Datasets were tested for normality using the Shapiro-Wilk test. Datasets relating to antibody absorbance and ovarian corpora lutea number for each mouse group inoculated with either FHV-1, FHV-GZeG, FHV-GZeGTmC, FHV-GZeGTmC2 was each compared to the mock infected group by two-way ANOVA and one-way ANOVA respectively. A p value less than 0.05 was considered significant. All statistical analyses were conducted using Prism version 9.1.1.
Results
Feline herpesvirus-derived immunocontraceptives did not replicate in the non-feline cell types
No evidence of viral infection was detected in any of the non-feline cells inoculated with FHV-GZeG as determined by lack of CPE and absence of cDNA by RT-qPCR using primers that amplify the wildtype (WT) TK gene. No evidence of viral transcripts could be detected at 7 days post infection in any of the non-feline cell lines (Fig. 2 A). In Vero and LA-4 cells only, some green fluorescence was detected around the edges of the cell culture wells after cells had been inoculated and washed with media (supplementary Fig. 1). The progress of FHV-GZeG infection in these cell lines, and in JU56 and CRFK cells, was analysed by qPCR. There was no evidence of FHV-GZeG infection detected by qPCR using primers to amplify the WT TK gene and a consistent decline in vDNA was observed in JU56, Vero and LA-4 cells from day 0 to 7 (Fig. 2B).
Fig. 2. Growth of FHV-GZeG in non-feline cells. A) RT-qPCR assessment of FHV-GZeG mRNA abundance in the different cell lines 7 days post infection. Data points represent individual scores with mean ± one standard deviation. B) qPCR assessment of FHV-GZeG genome copy number in LA-4, Vero, JU56 and CRFK cells 0, 3 and 7 days post infection. Data points represent average score with ± one standard deviation
FHV-1-derived immunocontraceptive infection was not detected in inoculated BALB/c mice
No clinical signs were observed, nor were any changes in body condition observed in any of the inoculated mice at any period during the study. The lungs from mice inoculated with FHV-1 and FHV-1 derived immunocontraceptives were removed at several time points up until 2 weeks post infection. Viral DNA was detected from 1 out of 25 mice euthanised on day 1. This particular mouse had been inoculated with FHV-1 and returned a positive PCR result using primers capable of amplifying WT TK (Table 1). A product of the correct size was amplified from the mock-infected lung sample spiked with FHV-1, and from positive control samples using TK primers and ICP4 primers. Primers targeting feline GAPDH but capable of amplifying murine GAPDH (Table 1) amplified an 80 bp product and confirmed that DNA extraction had been successful.
Serum samples from mice collected on days 1, 4, 8 and 14 were assessed for the presence of antibodies to GnRH and FHV-1. When comparing groups for FHV-1 IgM or GnRH IgG antibodies, there was no difference in absorbance values between inoculated groups when compared to the mock infected group as assessed by Dunnett’s multiple comparisons test (Fig. 3B, C). Similarly, there was no detectable difference in absorbance values detecting IgG to FHV-1 between inoculated groups and the mock infected group, with the exception between FHV-GZeG and mock infected mice. In this instance the mean absorbance of the mock infected group was higher than the mean absorbance of the FHV-GZeG infected group (P = 0.0396) (Fig. 3 A).
Fig. 3ELISA results for IgG/IgM FHV-1 antibodies and IgG GnRH antibodies (A) FHV-1 IgG antibodies in infected mice (left) and control samples (right) (B) FHV-1 IgM antibodies in infected mice (left) and control samples (right) (C) and GnRH IgG antibodies in infected mice (left) and control samples (right). Shown are average absorbance values for groups inoculated with either mock, FHV-1, FHV-GZeG, FHV-GZeGTmC or FHV-GZeGTmC2 with error bars representing ± standard deviation
No changes were detected in the reproductive tissues of mice inoculated with FHV-1 or FHV-1 derived immunocontraceptive strains.
Assessment of the ovaries of infected mice revealed no significant differences in the number of corpora lutea of mice inoculated with the FHV-1 derived immunocontraceptives compared to mock infected mice (supplementary Table 1, Fig. 4 A and B). Examination of the testes revealed no apparent morphological changes between groups (Fig. 4 C and D) and similar levels of sperm and apoptotic cells, however statistical analyses were precluded by the small number (n = 2) of male mice per group at the final time point which is less than minimum number of samples required for analysis of 2 degrees of freedom (n = 3).
Fig. 4. Ovaries and testes from mice inoculated with FHV-1 immunocontraceptive candidate FHV-GZeG. Panel A and B show scans of H&E stained of ovaries of female mice inoculated with (A) diluent only (negative control) or (B) FHV-GZeG. Oocytes (Oo) and corpus luteum (CI) are marked. Scale bar=200μm. Panels C and D show photomicrographs of H&E stained sections of testes of male mice inoculated with (C) diluent only (negative control) or (D) FHV-GZeG. Seminiferous tubules (ST) containing sperm are surrounded by Leydig (L) cells. Within the seminiferous tubules the lumen (Lu) and spermatozoa (spz) are marked. Scale bar = 100μm
Discussion
Viruses capable of infecting hosts outside of their natural range are often cause for concern due to their potential to become zoonoses or cause severe disease in atypical hosts. While many herpesviruses are generally considered to have a restricted host range, some herpesvirus strains can establish infections in hosts beyond their co-evolutionary range. For example, equine herpesvirus-9 (EHV-9) can infect non-equine mammalian species including dogs [26], cats [27], goats [28], and cattle [29] and can result in severe disease. Should the feline immunocontraceptive candidates previously described [15] be used as a feral cat population suppression tool in locations such as Australia or New Zealand, it is imperative that the virus remains restricted to feline hosts so as not to affect the reproductive potential of non-target species.
In this study, no evidence of immunocontraceptive FHV-GZeG replication in the non-feline cell lines was detected. The FHV-GZeG candidate was chosen to inoculate non-feline cells as it exhibits similar growth characteristics to WT FHV-1 and expresses eGFP [15]. These features allow for detection of virus growth by cytopathic effect (CPE) and detection of protein translation via the detection of green fluorescence, although it is possible that protein translation could occur in the absence of productive infection. While some cell lines such as Vero and LA-4 cells appeared to retain small amounts of FHV-GZeG inoculum even after multiple rounds of washing, the presence of this green fluorescence immediately after washing, combined with the absence of vRNA transcripts and the declining amounts of vDNA over time, indicates that this fluorescence was due to residual inoculum rather than translation of FHV-GZeG in these cell lines. The non-feline cell lines selected for inoculation with FHV-1 in this study represent diverse animal species, including some native Australian species (wallaby and potoroo) that would likely be in contact with feral cats and should therefore be evaluated for their potential to support FHV-1 infection and consequent risk of being impacted by an FHV-1 derived immunocontraceptive. Future FHV-1 inoculation studies should include cell cultures from an even wider range of species likely to be in close proximity to feral cats as these species may encounter viral particles in their shared environment. Additionally, future studies should ensure cell lines are cultured at temperatures consistent with species-specific internal body temperature to provide further confidence in the host-restricted nature of FHV-1 infection. For example, marsupial cell lines are often cultured at 35°C [30] but were cultured at 37°C in this study which may have impacted our ability to detect viral activity if the cell line was negatively affected by the warmer culturing environment. It may also be appropriate to assess viral activity in inoculated cells at time intervals within the first 48 h to determine if any transient viral activity can be detected rather than assessment at 7 days only, and use cell lines derived from respiratory tissue to better reflect the natural FHV-1 replication environment than kidney cells only, which was the most common source of cell lines in this study.
The FHV-1 strain and the derived immunocontraceptive strains could only be detected in the lung tissue of one BALB/c mice one day post intranasal inoculation, despite inoculation with the highest dose available of undiluted virus cultured in CRFK material (50 µL 10^6.15^ TCID_50_/mL). The lack of detectable IgG and IgM to FHV-1 in the inoculated mice is noteworthy, as IgM and IgG antibody production in mice has been reported as early as 3 and 7 days respectively post exposure to some antigens [31]. These findings suggests that the virus was likely cleared by the mouse’s innate immune system and was unable to infect respiratory cells and trigger a detectable adaptive immune response. It would also be valuable to evaluate IgA antibodies which confer protective immunity in the mucosal tissue, a site of FHV-1 replication [32]. In this study we assessed lung tissue for evidence of FHV-1 replication and shedding. Future studies should investigate FHV-1 shedding in upper-respiratory tissue including mucosal, tracheal, turbinate and trigeminal tissue for early FHV-1 viral activity that may not have progressed to the lungs. Indeed, swabs and samples from these tissues should also be collected at additional timepoints within the first 24 h to capture any early FHV-1 replication activity. Immune-directed disruption of reproductive tissues would only occur after an adaptive immune response towards the reproductive antigens encoded by the immunocontraceptives. Consequently, if an adaptive immune response occurred in the inoculated mice, changes in reproductive tissue are expected to be evident by day 14. Other murine studies assessing the impact of immune-directed disruption of GnRH have found reductions in sperm production in males and reduced numbers of corpora lutea in females, but no such changes were detected in this study [25]. However, the number of ovaries from female mice assessed in this study was small (n = 3) which presented limited opportunities to detect pathological changes indicative of an immune directed disruption of reproductive pathways dependent on GnRH and ZP3.
It may also be of benefit to extend the timeframe over which mice are monitored for an adaptive immune response to determine if antibodies appear after 14 days. Future studies should extend the timeline of the study, enabling assessment of immunological responses at various timepoints up to 42 days.
The outcome of this study demonstrated an absence of viral replication in the lung tissue of inoculated mice and no apparent immunological response against reproductive pathways in the gonads of mice. These findings differ to the findings of Silva et al., (2022) which involved a 10-day experiment beginning with immunization of seventeen 4-week-old BALB/c mice with 10µL of FHV-1 (10^5^ TCID50/100µL) and reported evidence of viral particles in lung, spleen, liver and kidney and detection of IgG antibodies against FHV-1. Detection of FHV-1 in the spleen, liver and kidney of mice is not consistent with the dissemination of FHV-1 in felines, where detection of FHV-1 in these organs is rare and often associated with serious disease and coinfection with other pathogens [33–37]. It would be interesting to investigate if the DNA found in the organs collected from mice inoculated by Silva et al., (2022) represented infectious virus, or just the detection of non-infectious vDNA. Differing viral replication phenotypes could be attributed to the different FHV-1 strain used for inoculation. The B927 strain used by Silva et al., (2022) to inoculate BALB/c mice was originally isolated from an oropharyngeal swab from an infected cat and has been used since as a standard laboratory strain that retains wildtype infectivity characteristics [38]. Conversely, the F2 strain used in this study is an attenuated variant that has been studied extensively as a vaccine vector due to minimal clinical signs in immunized cats [11]. Host restriction of FHV-1 appears to occur in the earliest stage of infection where viral entry into host cells occurs via the glycoprotein D (gD) protein that acts as a receptor binding protein [39]. Changes in glycoprotein structure may enhance the chances FHV-1 binding to atypical receptors and entry into a broader range of host cells [40]. It may also be beneficial to determine how readily the immunocontraceptive strains in this study, as well as more infectious FHV-1 variants, can recombine with wild-type feline herpesviruses to generate novel strains with the potential for a broader host range.
The immunocontraceptive strain FHV-GZeG did not replicate in canine (MDCK) cells in this study which is consistent with other studies using more infectious isolates of FHV-1 [41]. However, there is a small possibility that an FHV-1 recombination event resulting in broader host range phenotype could especially affect native canids, such as the Australian dingo (Canis lupus dingo), a top-order predator with a critical role in ecological management [42] which can become infected with canine herpesvirus 1 (CHV-1) as CHV-1 shares antigenic similarity to FHV-1 [43, 44].Thus, host restriction of the immunocontraceptive strains remains an essential research priority. Further development of the FHV-1 immunocontraceptives should consider modifications to restrict replication competency to domestic cats (Felis catus) only, potentially via the use of a ‘molecular switch’ regulatory system whereby the immunocontraceptives would only be able to initiate replication in domestic cats.
Conclusion
In this study, FHV-1 and FHV-1 derived immunocontraceptives were unable to replicate outside of a feline host, with no detectable replication in non-feline cell lines or immunological outcome in a murine in vivo model. The lack of detectable antibody production against FHV-1 and GnRH and absence of changes in the reproductive tissue of inoculation BALB/c mice, alongside the inability of FHV-1 to infect a diverse range on non-feline cell lines in vitro, reinforces the safety profile of FHV-1 as a feline-restricted viral vector. These findings support the continued development of an FHV-1 derived immunocontraceptive as a potential means of population control of feral cats to safeguard native species. Additional studies assessing the host restriction of FHV-1 to the Felidae family is recommended, with assessment of the viral replication potential in a broader range of non-feline species using a range of FHV-1 strains, including those with a wildtype replication phenotype before its immunocontraceptive use in feral cats can be considered.
Supplementary Information
Supplementary Material 1
Supplementary Material 2
The reference list from the paper itself. Each links out to its DOI / PubMed record.