Chlorogenic Acid Ameliorate Lipopolysaccharide Induced Intestinal Acute Inflammatory Injury via Inhibiting Cytokines Production and Activating Intestinal Stem Cells

TL;DR

Chlorogenic acid protects the intestines from inflammation by reducing harmful immune responses and supporting stem cells.

Contribution

This study reveals a new mechanism by which chlorogenic acid alleviates intestinal injury via JAK/STAT pathway inhibition and stem cell preservation.

Findings

Chlorogenic acid preserves intestinal barrier integrity by maintaining tight junction gene expression.

Chlorogenic acid suppresses pro-inflammatory cytokines and enhances anti-inflammatory cytokines in LPS-induced injury.

Chlorogenic acid sustains intestinal stem cell activity and inhibits JAK/STAT pathway activation.

Abstract

Several studies have confirmed that chlorogenic acid (CGA) has beneficial effects on intestinal health. This study aimed to investigate the protective effect and underlying mechanism of CGA in lipopolysaccharide (LPS)‐induced intestinal injured mice. Histological analysis of duodenal epithelial morphology and tight junction‐related gene expression indicated that CGA helps preserve intestinal barrier integrity. Quantitative PCR analysis showed that CGA suppressed the expression of pro‐inflammatory factors including interferon‐γ (Ifn‐γ), interleukin‐7 (Il‐7), tumor necrosis factor‐α (Tnf‐α), and upregulated the anti‐inflammatory cytokines interleukin‐10 (Il‐10) in LPS‐induced enteritis mice. Furthermore, compared to LPS‐treatment mice, CGA supplementation sustained intestinal stem cell (ISCs) activity, including proliferation and differentiation. Additionally, CGA inhibited LPS‐induced activation of the Janus kinase/signal transducers and activators of transcription (JAK/STAT) pathway, as evidenced by a reduction in the expression of Jak2, Jak3, and Stat1. This effect was comparable to that of Tofacitinib, a known JAK/STAT pathway inhibitor. Collectively, these findings suggest that CGA protects intestinal epithelial integrity and alleviates intestinal injury by suppressing inflammatory responses and preserving ISC activity via inhibition of the JAK/STAT signaling pathway.

This study aimed to investigate the protective effect and underlying mechanism of CGA in lipopolysaccharide (LPS)‐induced intestinal injury mice. The findings suggest that CGA alleviates intestinal injury by suppressing inflammatory response and preserving ISCs activity via inhibition of the JAK/STAT signaling pathway. All the results highlight that CGA has the potential to serve as a natural food compound for alleviating intestinal inflammation.

Figures

Protective effect of CGA on intestinal barrier in LPS‐induced mice. (A) Proportion of solution intake and body weight in normal drinking mice and CGA exposed mice. (A, B) Small intestine (SI) length of each group. (C) Body weight loss ratio in normal drinking mice and CGA exposed mice. (D) Representative HE‐stained sections of the distal colonic tissues from the control, LPS, and CGA + LPS group. (E, F) Villus Heights (B) and Crypt depth (C) of duodenum in the control, LPS, and CGA + LPS group. (G–J) The relative mRNA expression of genes encoding the tight‐junction‐related proteins Cldn1 (G), Cldn7 (H) and occludin Ocln (I), Zo‐1 (J) in duodenum tissue. Scale bar: 100 μm. The data are expressed as the mean ± SD. One way ANOVA with Duncan's post hoc test was used to perform the comparison of means. Means with the same letters are significantly different (p ≤ 0.05).

The effects of CGA on inflammatory cytokines in LPS‐induced mice. (A–D) The relative gene expression of Ifn‐γ (A), Il‐7 (B), Tnf‐α (C), Il‐10 (D) in duodenum tissue. The data are expressed as the mean ± SD. One‐way ANOVA with Duncan's post hoc test was used to perform the comparison of means. Means with the same letters are significantly different (p ≤ 0.05).

The effects of CGA on ISCs activity in LPS‐induced mice. (A, B) The relative gene expression of stem cell marker genes Lgr5 and Olfm4. (C–G) The relative gene expression of absorptive cell (Cdx2) and secretory cell (ChgA, Muc2, Lyz, and Gcg) marker genes in duodenum tissue. (H, I) EdU analysis from the control, LPS, and CGA + LPS group. Scalebar: 100 μm. The data are expressed as the mean ± SD. One‐way ANOVA with Duncan's post hoc test was used to perform the comparison of means. Means with the same letters are significantly different (p ≤ 0.05).

The effect of CGA inhibits LPS‐induced JAK/STAT signal pathway activation. Jak2, Jak3 and Tyk2 are members of the JAK family. STAT1 belongs to the STAT family. (A–C) Relative mRNA expression of Jak2, Jak3 and Stat1 in duodenal tissue from CON, LPS and CGA + LPS mice. (D–F) Relative mRNA expression of Jak2, Jak3 and Stat1 in duodenal organoids from CON, LPS, LPS + T and CGA + LPS groups. T denotes tofacitinib (200 μg/mL), a JAK/STAT pathway inhibitor. The data are expressed as the mean ± SD. One way ANOVA with Duncan's post hoc test was used to perform the comparison of means. Means with the same letters are significantly different (p ≤ 0.05).

Tables

TABLE 1. Nucleotide sequences of primers.

Gene	Forward primer	Reverse primer
Gapdh	GCATGGCCTTCCGTGTTCCTA	GATGCCTGCTTCACCACCTTCT
Ifn‐γ	GCCAAGCGGCTGACTGAACTC	TCCTCCCATCAGCAGCACCTC
Il‐7	CTACACCCACCTCCCGCAGAC	GGGCAGTCTCTCAGGTCTCCAC
Il‐10	GAGGATCAGCAGGGGCCAGTAC	AAGGCAGTCCGCAGCTCTAGG
Tnf‐α	AAGGGAGAGTGGTCAGGTTGCC	TGTGAGGAAGGCTGTGCATTGC
Tnf‐β	CCCACAGTCTCCAGCCTTCCC	TGAGTCGTCCCCTGAGCATCTG
Cldn‐1	TCTACGAGGGACTGTGGATG	TCAGATTCAGCAAGGAGTCG
Cldn‐7	GGGAGATGACAAAGCGAAGA	CAGAAGGACCAGAGCAGACC
Zo‐1	GCTAAGAGCACAGCAATGGA	GCATGTTCAACGTTATCCAT
Stat1	CACCTGCTGTGCCTCTGGAATG	TCCCTGGCTGCTGGTCCTTG
Jak2	GCACAGCACTGAAGAGCACCTC	CGCACTGTAGCACACTCCCTTG
Jak3	GCGGCTGCTGGAGGAGGAG	GCTGCGGCGGAGAATGTAGG
Tyk2	CACAGAGTCTTCCGCCGCTTC	TGCCAGGACCTCCAGATGACAC
Lgr5	CTTTGACACACATTCCCAAG	AAATTCTGTAGCGCTTCCTC
Olfm4	CCTTAGCATTCGCCGCCAGATC	GTTCACCACGCCACCATGACTAC
Cdx2	TGTAAATGCCAGAGCCAACCTGGA	AGATCAGTGACTCGAACAGCAGCA
ChgA	CGATCCAGAAAGATGATGGTC	CGGAAGCCTCTGTCTTTCC
Gcg	TGAAGACAAACGCCACTCAC	TGACGTTTGGCAATGTTGTT
Lyz	ATGGCTACCGTGGTGTCAAG	CGGTCTCCACGGTTGTAGTT
Muc2	CTGACCAAGAGCGAACACAA	CATGACTGGAAGCAACTGGA

Full text

Introduction

1

Intestinal inflammation, injury and disease are common conditions that can result in a wide range of symptoms and complications. Theses disorder are triggered by variety factors, including infections, autoimmune diseases, and environmental exposures (Loftus Jr. 2004; Brain and Savage 1994). The subsequent damage to the intestinal lining often manifests as increased permeability, impaired nutrient absorption, and heightened susceptibility to infection (Yan and Polk 2002; Baumgart and Carding 2007).

Phenolic acids, a class of secondary plant metabolites, have recently garnered attention for their potential protective and reparative effect on intestinal tract (Tajik et al. 2017). Among them, CGA—the most abundant phenolic acid in the human diet—is widely found in foods, such as coffee, apples, and blueberries (Tajik et al. 2017). Extensive research has demonstrated that CGA exhibits multiple pharmacological properties, including antioxidant, antihypertensive, and antiviral activities (Ohishi et al. 2021). In addition, CGA also possesses anti‐inflammatory activity that has been shown to ameliorate dextran sulfate sodium (DSS)‐induced acute colitis and inhibit oxidative stress‐mediated viability of human colon cancer cells (Zhang et al. 2017). Furthermore, CGA reduces neuroinflammation in LPS‐induced models (Xu et al. 2022) and modulates inflammation across different tissues to preserve cell viability and mitigate disease progression (Mansour et al. 2021; Zhou et al. 2021; Owumi et al. 2021). However, the precise mechanism by which CGA exerts protective effects against intestinal inflammatory damage remains incompletely understood.

Current research primarily focuses on the anti‐inflammatory pathway of CGA. CGA can attenuate oxidative stress by activating the nuclear‐factor‐erythroid‐derived‐2‐like 2 (Nrf2)‐Keapl‐ARE‐signaling pathway or by inhibiting the protein kinase D‐nuclear factor kappa‐light‐chain‐enhancer of activated B cells (PKD‐NF‐Kb) signaling pathway (Liang and Kitts 2018; Shin et al. 2017). It also mitigates oxidative stress‐induced intestinal inflammation by co‐regulating the phosphatidylinositol‐3‐kinase/protein kinase B (PI3K/Akt) and I kappa B alpha/NF‐kappa B (IκBα/NF‐κB) signaling pathway (Chen et al. 2021). Moreover, CGA has been shown to alleviate ulcerative colitis via MAPK/ERK/JNK signaling (Gao et al. 2019), and to enhance intestinal barrier function in weaned pigs by suppressing the TLR4/NF‐κB signaling pathway and activating Nrf/HO‐1 signaling pathway (Chen et al. 2018). Additional studies have highlighted CGA's role in alleviating intestinal mucosal disruption and colitis through gut microflora modulation (Zhang et al. 2017, 2019; Xie et al. 2021; Ye et al. 2021; Wu et al. 2018).

The intestinal epithelium serves as the first line of defense, playing critical roles in digestion, nutrient absorption, and immune surveillance. It comprises a dynamic monolayer of cells maintained by intestinal stem cells (ISCs), which reside at the base of the crypts and continuously replenish the epithelial lining. ISCs differentiate into various specialized cell types, including enterocytes, goblet cells, enteroendocrine cells, and Paneth cells, all of which contribute to intestinal homeostasis (Allaire et al. 2018). However, this delicate barrier is frequently challenged by pathogenic bacterial infections, viruses, acute or chronic inflammatory stimuli, and oxidative stress. Notably, Gram‐negative bacteria in the gut microbiota produce LPS, which directly disrupt tight junctions of the intestinal epithelium, elicits inflammatory responses, compromises immunity, and ultimately damages the intestinal epithelium (Stephens and von der Weid 2020; Halfvarson et al. 2017; Mao et al. 2018).

Despite substantial evidence of CGA's anti‐inflammatory properties, it remains unclear whether CGA protects intestinal epithelial barrier integrity and modulates ISC function to enhance epithelial regeneration during inflammation. Therefore, the present study was designed to evaluate the protective effects of CGA on intestinal epithelial morphology and barrier function in an LPS‐induced acute small‐intestinal injury model, and elucidate whether these effects are associated with regulation of inflammatory cytokine production, ISC activity, and JAK/STAT signaling. Our data demonstrate that CGA preserves villus–crypt architecture and tight junction gene expression, attenuates the inflammatory response, and maintains ISC proliferation and differentiation through inhibition of the JAK/STAT pathway.

Materials and Methods

2

Animals

2.1

All experiments were performed using 8‐ to 10‐week‐old male C57BL/6 mice (Zhejiang Academy of Medical Sciences, Hangzhou, China). The animals were housed in a temperature‐controlled (22°C ± 2°C), humidity‐regulated (50% ± 5%) facility with a 12‐h light/dark cycle. Mice had ad libitum access to a standard laboratory diet and water. All procedures were approved by the Animal Care and Use Committee of Zhejiang Gongshang University (AP2025‐01‐0436) and conducted in accordance with the National Institutes of Health Guidelines for the Care and Use of Animals.

Mice were matched by sex and weight and were randomly assigned into three groups (n = 10): control (CON), lipopolysaccharide treatment (LPS) and CGA + LPS treatment. Mice in the LPS and CON group received an intraperitoneally injection of LPS (10 mg/kg) and phosphate‐buffered saline (PBS), respectively, after 14 days of free access to water. Mice in the CGA + LPS group (CON) were administrated LPS (10 mg/kg) after 14 days of free drinking 0.1 mM CGA solution. Body weight of mice was recorded every 2 days, and fluid consumption was monitored daily. To eliminate the influence of body weight on water intake, consumption data were normalized to a standard body weight of 20 g.

Histological Staining

2.2

Duodenal tissues were collected from mice 24 h after intraperitoneal injection, fixed in 4% paraformaldehyde (PFA), and embedded in paraffin. Paraffin‐embedded duodenal sections were stained using hematoxylin. Images were captured using a light microscopy (NOVEL, XD‐202), and the villus height and crypt depth were measured using image J software.

EdU Incorporation

2.3

EdU incorporation experiment was conducted using the BeyoClickTM EdU‐647 Cell Proliferation Assay Kit (Beyotime Biotechnology, C0081S) according to the manufacturer's instructions. Mice received a single intraperitoneal injection of EdU at 5 mg/kg body weight 1 h after LPS treatment. Duodenal tissue was harvested 24 h after EdU injection, fixed with 4% PFA, and dehydrated with 30% sucrose overnight. Tissues were embedded in Tissue‐Tek O.C.T. Compound (Sakura, 4583) and cryosectioned. Sections were permeabilized with 0.5% Triton X‐100 for 20 min and incubated in the Click Reaction Buffer (containing 86 μL click reaction buffer, 4 μL CuSO4, 0.2 μL Azide488, 10 μL click additive solution) for 30 min at room temperature in the dark. Sections were washed three times with PBS solution and then counterstained with 5 μg/mL DAPI, and finally mounted with histology mounting medium (Sigma, F6182). Fluorescence images were obtained using a Leica Sp8 confocal laser microscope (Leica, German).

Duodenal Organoids Culture and Treatment

2.4

Duodenal crypts were isolated and organoid were cultured as previously described (Zhou et al. 2021). Briefly, untreated 8‐ to 10‐week‐old male C57BL/6 mice were euthanized, and approximately 2 cm of duodenum was isolated and washed with ice‐cold Dulbecco's phosphate‐buffered saline (DPBS). Crypts were isolated using 5 mM EDTA and seeded 25 uL Matrigel (Corning, 354,230) in the middle of a 48‐well plate (Corning, 3548), with a density of 250–300 crypts per well. Organoids were cultured in Advanced Dulbecco's modified Eagle medium/F12 (DMEM/F12) medium supplemented with 10 mM HEPEs (Thermo Fisher, cat. no. 15630080), 2 mM GlutaMAX (Thermo Fisher, 35,050,061), 3% (v/v) R‐spondin‐conditioned medium, 10% (v/v) Noggin‐conditioned medium, 1% N2 (v/v, Thermo Fisher, 17,502–048), 2% B27 (v/v, Thermo Fisher, 12587‐010), 10 μM Y27632 (Sigma‐Aldrich, Y0503), and 50 ng/mL epidermal growth factor (PeproTech, 315‐09). The medium was replaced every 2 days, and organoids were sub‐cultured weekly.

After three passages, duodenal organoids were used for JAK/STAT pathway analysis and were divided into four groups corresponding to Figure 4D–F: control (CON), LPS, LPS + tofacitinib (LPS + T) and LPS + CGA. LPS was applied at 200 μg/mL and CGA at 0.1 mM, as described above. Tofacitinib (T, 200 μg/mL, MedChemExpress, HY‐40354) was used as a pharmacological JAK/STAT inhibitor. For the LPS + T group, organoids were incubated with LPS (200 μg/mL) and tofacitinib (200 μg/mL) simultaneously for 24 h. For the LPS + CGA group, organoids were incubated with LPS (200 μg/mL) and CGA (0.1 mM) for the same duration. Tofacitinib was only applied in these in vitro organoid experiments and was not administered to mice.

The concentration of CGA (0.1 mM) was chosen to approximate the luminal concentrations achievable when CGA is supplied at 0.1 mM in drinking water and lies within the range (0.05–1 mM) reported to exert protective effects on intestinal epithelial cells without cytotoxicity (Liang and Kitts 2018; Chen et al. 2021, 2022). The LPS dose of 200 μg/mL falls within the μg/mL range commonly used to model acute endotoxin exposure in intestinal epithelial or immune cell cultures (Yu et al. 2019; Yan et al. 2017).

Quantitative RT‐PCR Analysis

2.5

Duodenal tissues were collected 24 h after intraperitoneal injection of EdU, and treated organoids were used for total RNA extraction using the TRIzol reagent (Thermo Fisher, 15596026). Complementary DNA (cDNA) was synthesized using PrimeScript RT reagent Kit with gDNA Eraser (Takaro, RR047A). Quantitative PCR was performed using SYBR Premix Ex Taq II (Thermo Fisher, A25742). Mouse GAPDH was used as the internal reference gene. The relative mRNA level was calculated using the 2^−ΔΔCt^ method. Primer sequences are listed in Table 1.

Statistical Analysis

2.6

Images obtained from the experiments were analyzed using Image J and GraphPad Prism 9 software. Statistical comparison between groups was performed using one way ANOVA followed by Duncan's post hoc test. All data are shown as mean ± standard error of the mean (SEM), and p < 0.05 was considered statistically significant.

Results

3

CGA Protects Intestinal Barrier in LPS‐Treated Mice

3.1

In order to investigate the effect of chlorogenic acid on intestinal injury, mice treated with CGA or water were intraperitoneally injected with LPS. After 24 h, the LPS‐treated mice exhibited pathological symptoms including fever, diarrhea, and hematochezia. Moreover, LPS stimulation significantly shortened the length of the small intestine, whereas CGA treatment alleviated this reduction, though the difference was not statistically significant (Figure 1A,B). Compared to control mice, CGA has no significant effect on LPS‐induced weight loss (Figure 1C). Histological analysis revealed that LPS exposure caused severe epithelial disintegration, loss of tissue architecture, and disruption of the crypt‐villus structure (Figure 1D). CGA treatment ameliorated these pathological changes, as evidenced by reduced crypt collapse and increased crypt and villi height (Figure 1E,F). Moreover, quantitative PCR assay results confirmed that CGA treatment upregulated the expression of tight junction‐related genes, including Cldn1, Cldn7, Ocln, Zo‐1 (Figure 1G–J), suggesting a protective role of CGA in maintaining intestinal epithelium. Taken together, these data show that CGA exerts a protective effect on the intestinal barrier in LPS‐induced intestinal injury mice.

Protective effect of CGA on intestinal barrier in LPS‐induced mice. (A) Proportion of solution intake and body weight in normal drinking mice and CGA exposed mice. (A, B) Small intestine (SI) length of each group. (C) Body weight loss ratio in normal drinking mice and CGA exposed mice. (D) Representative HE‐stained sections of the distal colonic tissues from the control, LPS, and CGA + LPS group. (E, F) Villus Heights (B) and Crypt depth (C) of duodenum in the control, LPS, and CGA + LPS group. (G–J) The relative mRNA expression of genes encoding the tight‐junction‐related proteins Cldn1 (G), Cldn7 (H) and occludin Ocln (I), Zo‐1 (J) in duodenum tissue. Scale bar: 100 μm. The data are expressed as the mean ± SD. One way ANOVA with Duncan's post hoc test was used to perform the comparison of means. Means with the same letters are significantly different (p ≤ 0.05).

CGA Suppresses LPS‐Induced Intestinal Inflammatory

3.2

To assess the anti‐inflammatory effect of CGA on LPS‐induced intestinal injury, quantitative PCR analysis was performed on duodenal specimens. Compared to the LPS group, CGA‐treated mice exhibited significantly reduced mRNA expression levels of inflammation‐associated cytokines including Ifn‐γ, Il‐7, and Tnf‐α (Figure 2A–C), and an increased expression of anti‐inflammatory cytokine Il‐10 (Figure 2D). Furthermore, CGA‐treated mice exhibited nearly normalized inflammatory levels. Taken together, these data show that CGA mitigates intestinal injury, at least in part, by downregulating pro‐inflammatory cytokines and upregulating anti‐inflammatory cytokines.

The effects of CGA on inflammatory cytokines in LPS‐induced mice. (A–D) The relative gene expression of Ifn‐γ (A), Il‐7 (B), Tnf‐α (C), Il‐10 (D) in duodenum tissue. The data are expressed as the mean ± SD. One‐way ANOVA with Duncan's post hoc test was used to perform the comparison of means. Means with the same letters are significantly different (p ≤ 0.05).

CGA Enhances the Activity of Lgr5+ ISCs

3.3

To elucidate the correlation between CGA‐mediated intestinal protection and ISCs, intestinal lineage marker expression was analyzed in the duodenal epithelium. Quantitative PCR results showed that CGA treatment prevented the LPS‐induced downregulation of ISCs markers Lgr5 and Olfm4 (Figure 3A,B), the absorptive lineage marker Cdx2 (Figure 3C), and the secretory lineage marker ChgA (Figure 3D). No significant changes were observed in other secretory lineage markers, including Muc2, Lyz, and Gcg (Figure 3E–G). EdU incorporation assays further confirmed that CGA preserved the proliferative capacity of ISCs impaired by LPS (Figure 3H,I). Taken together, these data show that ISCs may be a potential key cellular target underlying the intestinal healthy benefits of CGA.

The effects of CGA on ISCs activity in LPS‐induced mice. (A, B) The relative gene expression of stem cell marker genes Lgr5 and Olfm4. (C–G) The relative gene expression of absorptive cell (Cdx2) and secretory cell (ChgA, Muc2, Lyz, and Gcg) marker genes in duodenum tissue. (H, I) EdU analysis from the control, LPS, and CGA + LPS group. Scalebar: 100 μm. The data are expressed as the mean ± SD. One‐way ANOVA with Duncan's post hoc test was used to perform the comparison of means. Means with the same letters are significantly different (p ≤ 0.05).

CGA Inhibits LPS‐Induced Activation of JAK/STAT Signaling Pathway

3.4

To explore the molecular mechanism underlying the protective effect of CGA, we investigated the activation status of the JAK/STAT signaling pathway, which was required for ISCs regeneration under acute intestinal inflammation (Richmond et al. 2018). LPS treatment significantly upregulated the expression of Jak2, Jak3, and Stat1 in duodenal tissue and organoids (Figure 4A–F). CGA supplement markedly suppressed the LPS‐induced expression of Stat1 and Jak2, while Jak3 expression also reduced, though not significantly. Notably, the inhibiting effects of CGA were comparable to that of tofacitinib, a known JAK/STAT pathway blocker (Figure 4D–F). Taken together, these data show that the suppression of JAK/STAT pathway activation contributes to the protective effect of CGA against LPS‐induced intestinal injury.

The effect of CGA inhibits LPS‐induced JAK/STAT signal pathway activation. Jak2, Jak3 and Tyk2 are members of the JAK family. STAT1 belongs to the STAT family. (A–C) Relative mRNA expression of Jak2, Jak3 and Stat1 in duodenal tissue from CON, LPS and CGA + LPS mice. (D–F) Relative mRNA expression of Jak2, Jak3 and Stat1 in duodenal organoids from CON, LPS, LPS + T and CGA + LPS groups. T denotes tofacitinib (200 μg/mL), a JAK/STAT pathway inhibitor. The data are expressed as the mean ± SD. One way ANOVA with Duncan's post hoc test was used to perform the comparison of means. Means with the same letters are significantly different (p ≤ 0.05).

Discussion

4

The intestine serves not only the largest organ responsible for digestion and absorption but also functions as a vital mucosal immune organ. It acts as a defense barrier against harmful external substances (Camilleri et al. 2012). Patients with inflammatory bowel disease often exhibit an imbalance in intestinal flora, leaving the intestinal epithelium susceptible to significant exposure to harmful bacteria and elevated levels of bacterial products, such as LPS (Halfvarson et al. 2017; Shin et al. 2012). Prolonged LPS exposure can trigger inflammation and diminish the viability of intestinal epithelial cell (Yu et al. 2019; Yan et al. 2017). Consequently, this study developed a model of small intestinal inflammation utilizing LPS‐induced mice. Inflammation is a natural physiological response to tissue injury within the intestine. However, dysregulated inflammation is a known contributor to both acute and chronic diseases. Specifically, inflammatory bowel diseases (IBD) are characterized by chronic and recurrent inflammation that damages the intestinal lining (Sohail et al. 2018). While anti‐inflammatory medications have been designed to target the underlying mechanisms of inflammation, they are not without their drawbacks, as they may increase the likelihood of ulcers and intestinal bleeding, among various other side effects. This has spurred a substantial rise in the quest for novel drugs or methods to mitigate inflammation, particularly focusing on the bioactive properties of phytochemicals due to their relative safety. Recent studies have highlighted the health benefits of CGA, which exhibits antioxidant, antihypertensive, and antiviral properties that have shown efficacy in clinical contexts and can help reduce inflammatory stress within the body (Li et al. 2020; Santana‐Gálvez et al. 2017; Pimpley et al. 2020).

CGA is commonly found in both herbal remedies and food sources. Multiple investigations involving cell lines and animal models have confirmed that CGA provides protective effects against intestinal inflammation (Zhang et al. 2017; Zhou et al. 2022; Chen et al. 2022). To further validate this observation, we conducted a study using an LPS‐induced enteritis model to mimic acute inflammation. This model caused a collapse of crypt structures, leading to considerable damage to the intestinal mucosa, including the loss of crypt glands (Figure 1D), which is similar to conditions seen in human intestinal diseases (Feuerstein and Cheifetz 2017). The crypt plays a pivotal role in sustaining the stability of the intestinal epithelial structure (Kai 2021), serving as a sanctuary for intestinal stem and progenitor cells responsible for crucial functions such as proliferation and differentiation (O'Brien et al. 2001). The structural collapse of crypts can alter morphology and integrity of the intestinal epithelium (Figure 1E–J). CGA supplementation ameliorated the detrimental effects of LPS‐induced inflammation on the intestinal epithelium (Figure 1D–J). Compared with LPS‐treated mice, animals pretreated with CGA displayed better preserved villi‐crypt architecture, with increased villi height and crypt depth, together with higher expression of tight junction‐related genes. Histological analysis of H&E‐stained duodenal sections therefore supports a protective role of CGA in maintaining epithelial structure and barrier integrity during acute inflammatory injury. However, our assessment of barrier integrity was based on histology and tight‐junction mRNA levels, without protein‐level confirmation or direct permeability measurements, which is an important limitation of the present study.

Inflammation occurs as a physiological response to intestinal tissue injury. Upon LPS stimulation, the level of inflammation‐associated cytokines Tnf‐α, Il‐7, and Ifn‐γ was significantly elevated (Figure 2A–C). Papadakis and Targan (2000) demonstrated that inflammatory mediators, such as Tnf‐α, are believed to contribute to intestinal inflammatory diseases and directly cause damage to mucosal tissue. Il‐7 is an important homeostatic cytokine for lymphocyte survival and epithelial support, but it is also upregulated in the inflamed intestinal mucosa and can amplify mucosal immune activation in IBD; blockade or genetic reduction of Il‐7/Il‐7R signaling has been shown to alleviate experimental colitis (Watanabe et al. 1995). CGA supplementation significantly reduced the surge of pro‐inflammatory cytokines induced by LPS stimulation (Figure 2A–C). Furthermore, the expression of anti‐inflammatory factors Il‐10 significantly increased following CGA treatment, aligning with previous findings that CGA's ability to diminish the release of infection‐mediated inflammatory factors from HSV‐1‐activated microglial cells (Guo et al. 2015). In addition, some former studies also indicated that CGA can enhance the expression of the inducible cytokine messages, particularly Il‐10 in mast cells (Chen et al. 2000).

Additionally, Ifn‐γ has been identified as a critical mediator of the immune response in ISCs (Li 2008). In the inflamed intestine, T cells infiltrate the crypt and secrete Ifn‐γ, mediating the JAK–STAT signaling pathway that targets ISCs and prompting apoptosis (Li 2008; Ferran et al. 1991; Musch et al. 2002). The rapid regeneration of intestinal epithelium involves a complex process driven by the proliferation of Lgr5^+^ ISCs situated at the crypt base. Recent studies have demonstrated that inflammatory cytokines play an essential role in regulating stem cells, particularly concerning tissue injury and regeneration (Chen et al. 2000; Sonnenberg and Artis 2015). These inflammatory mediators can impair stem cell function and obstruct the replenishment of the stem cell pool, ultimately compromising the integrity of the intestinal barrier. Our findings indicate that CGA supplementation can downregulate the expression of Ifn‐γ within intestinal tissue (Figure 2A). This mechanism may have significant implications for alternation in intestinal epithelial lineages. Supporting evidence is provided by observations of ISCs (Figure 3A,B,H,I), wherein CGA supplementation mitigated the decrease in activation and expression of ISCs that was provoked by LPS infection.

Moreover, CGA supplementation demonstrated protective effects on both absorptive and secretory lineage cells (Figure 3C–G). Inflammatory mediators, such as Tnf‐α, were found to compromise cell permeability by altering the expression of tight junction proteins, which consequently leads to the formation of loose junctions between intestinal epithelial cells and disrupting the integrity of intestinal barrier against external stimuli (Camilleri et al. 2012; Chen et al. 2000). The tight junctions among intestinal epithelial cells serve as an effective barrier that prevents antigenic substance within the intestinal lumen from translocating into the intestinal lamina propria. During the occurrence of IBD, inflammatory mediators present in the intestinal lumen are modulated through various signaling pathways, resulting in alternation in the expression and distribution of tight junction proteins, enabling the entry of harmful substances into lamina propria, which in turn, incites secondary immune reactions (Capaldo and Nusrat 2015). CGA supplementation was associated with an upregulation of tight junction proteins Claudin‐1 and Claudin‐7 (Figure 1A,B). The distribution of Claudin‐1 and Claudin‐7 along the intestinal crypt and villi is not uniform and critically facilitates the regulation of ion and small molecule transport through the pore pathway, a function that is vital for maintaining homeostasis within the intestinal epithelium. Claudn‐1 is predominantly localized in Paneth cells, whereas Clandin‐7 is primarily found in absorptive cells (Holmes et al. 2006). These results align with the protective role of CGA on the intestinal epithelium and its associated cell lineages.

The JAK–STAT pathway is recognized as a pivotal communication nodes regarding cellular function, as well as a classical signaling cascade involved in inflammation and apoptosis (Owen et al. 2019). The JAK family comprises four members: Jak1, Jak2, Jak3, and Tyk2. Patients with IBD frequently exhibited a pronounced activation of JAK/STAT signaling (Salas et al. 2020). A similar phenomenon was observed in mice stimulated by LPS (Figure 4A–C). In the intestine compromised by inflammatory damage, T cells infiltrate into the crypt and secrete Ifn‐γ, thereby mediating the JAK–STAT signaling pathway aimed directly at ISCs. Our research substantiates the protective influence of CGA on ISCs. Furthermore, CGA displays an inhibitory effect on the expression of JAK/STAT pathway genes (Figure 1A–F). The data suggest that CGA can suppress the hyperactivation of the JAK/STAT pathway by suppressing the phosphorylation of JAK (Janus kinase) and reducing the activation level of STAT. In the context of inflammatory responses, cytokines (such as Il‐6, Tnf‐α) promote the release of inflammatory mediators through the JAK/STAT pathway. Chlorogenic acid exerts anti‐inflammatory effects through the inhibition of the JAK/STAT signaling pathway, thus decreasing the production of pro‐inflammatory cytokines. Additionally, research on various tumors has indicated that CGA may also impede tumor cell proliferation by regulating downstream target genes (e.g., Bcl‐2, Cyclin D1, etc.) within the JAK/STAT pathway.

Furthermore, tofacitinib, the first clinically approved oral JAK inhibitor, is classified as a targeted synthetic disease‐modifying antirheumatic drug rather than a classical non‐steroidal anti‐inflammatory drug and serves as an important therapeutic option for patients with IBD (Salas et al. 2020). It notably diminished JAK/STAT activation in LPS‐stimulated duodenal organoids, with CGA exhibiting similar inhibitory effectiveness (Figure 4). Compared with synthetic anti‐inflammatory drugs, CGA offers notable benefits in both efficacy and safety. Unlike non‐steroidal anti‐inflammatory drugs (NSAIDs), which primarily inhibit prostaglandin synthesis via cyclooxygenase (COX) suppression, CGA targets multiple inflammatory pathways. It not only suppresses the release of pro‐inflammatory mediators but also indirectly attenuates inflammation by scavenging reactive oxygen species (ROS), thereby exerting both antioxidation and anti‐inflammation (Gu et al. 2023). NSAIDs, by contrast, have limited influence on oxidative stress and immune modulation. Clinical and epidemiological studies in humans indicate that CGA is generally well tolerated, with only mild gastrointestinal discomfort reported at high supplemental doses or after consumption of CGA‐rich beverages (Tajik et al. 2017; Li et al. 2020; Santana‐Gálvez et al. 2017). Conventional anti‐inflammatory drugs often present a less favorable safety profile. Non‐selective COX inhibitors (e.g., ibuprofen) can cause gastrointestinal ulcers, while COX‐2 selective inhibitors (e.g., celecoxib) increase cardiovascular risk (Weintraub 2017). Biologics therapies such as TNF inhibitors (e.g., adalimumab) may lead to tuberculosis‐like infections or allergic reactions (Byun et al. 2015), and IL‐17 inhibitors (e.g., secukinumab) may heighten susceptibility to fungal infections (Khan et al. 2024). Although CGA shows promise in managing chronic or mild‐to‐moderate inflammatory conditions, current evidence is largely limited to experimental models and small clinical studies in metabolic and cardiovascular disorders and experimental colitis (Tajik et al. 2017; Li et al. 2020; Santana‐Gálvez et al. 2017; Pimpley et al. 2020; Gu et al. 2023). Its efficacy in severe systemic inflammatory diseases has not yet been established, and in such settings standard guideline‐based anti‐infective and immunosuppressive therapies remain indispensable. Despite the high efficacy of biologics, their cost and adverse effects restrict broader application (Salas et al. 2020; Byun et al. 2015; Khan et al. 2024). Thus, while CGA offers compelling advantages in efficacy and safety, further work is needed to optimize its clinical application. In addition, our analysis of cytokines was restricted to mRNA levels in whole duodenal tissue, without protein‐level confirmation or immune cell profiling, which is an important limitation of the present study and will be addressed in future work. Future research should prioritize formulation strategies (e.g., nano‐delivery systems), dosage standardization, and synergistic effects with existing anti‐inflammatory agents.

Additionally, the bioavailability of chlorogenic acid (CGA) in the stomach and small intestine is limited; the majority reaches the colon, where it undergoes microbial metabolism to yield biologically active derivatives, including phenylpropionic acid, caffeic acid, and 3‐hydroxyphenylpropionic acid (Tajik et al. 2017; Li et al. 2020; Santana‐Gálvez et al. 2017). These microbial metabolites can serve as energy substrates for colonocytes and, together with other microbiota‐derived metabolites, have been implicated in promoting intestinal stem cell (ISC) proliferation in part through activation of the mammalian target of rapamycin (mTOR) signaling pathway (Ma et al. 2022). Previous studies have demonstrated that CGA reshapes gut microbial composition, enriches SCFA‐producing bacteria, and alleviates colitis in a microbiota‐dependent manner (Zhang et al. 2017, 2019; Chen et al. 2018; Xie et al. 2021; Ye et al. 2021; Wu et al. 2018; Ma et al. 2022). Thus, it is plausible that in our in vivo system some of the protective effects of CGA on barrier integrity and ISC activity are mediated or amplified by microbiota‐derived metabolites acting along a “microbiota‐metabolism‐immune/stem cell” axis. By contrast, the duodenal organoid experiments, which are performed in the absence of a complex microbiota, indicate that CGA can also directly attenuate LPS‐induced JAK/STAT activation at the epithelial level. Moreover, CGA has demonstrated efficacy in mitigating mucosal barrier disruption associated with colitis and significantly enriches SCFA‐producing microbial populations (Ye et al. 2025). In the same study, the protective effects are dependent on an intact gut microbiota, highlighting its potential as a microbiota‐targeted therapeutic strategy for IBD (Ye et al. 2025). Furthermore, CGA may preserve ISC function by promoting a balanced gut microbial ecosystem and enhancing the production of beneficial microbial metabolites (Ma et al. 2022).

In conclusion, our findings reveal a possible mechanism on the CGA and its protective effect on mice with small intestinal inflammation. CGA exhibited anti‐inflammatory activity, including attenuating LPS‐induced inflammatory symptoms in the small intestine, inhibiting the expression of inflammatory factors, promoting the expression of anti‐inflammatory factors, and blocking JAK/STAT signaling activation. CGA also showed protection on the proliferation and differentiation ability of ISCs, which play a crucial role in maintaining the integrity of the intestinal barrier. All the results highlight that CGA has the potential to serve as a natural food compound for alleviating intestinal inflammation.

Author Contributions

Kejin Li: conceptualization (equal), data curation (equal), formal analysis (equal), investigation (equal), methodology (equal), software (equal), writing – original draft (equal), writing – review and editing (equal). Lulu Li: data curation (equal), writing – original draft (equal). Weiwei Huang: investigation (equal), visualization (equal). Suqiang Wang: resources (equal), supervision (equal). Guofeng Tan: conceptualization (equal), funding acquisition (equal), resources (equal), supervision (equal), writing – review and editing (equal).

Funding

This work was supported by General Research Project of Zhejiang Provincial Department of Education (Y202353258) and Hangzhou Joint Fund of the Zhejiang Provincial Natural Science Foundation (LHZSZ24C200002).