# Integrating sequence-based GWAS and comparative genomic analysis reveals conservation and species-specificity of putative functional variants influencing tail length and tail abnormalities in pigs and sheep

**Authors:** Xuying Zhang, Johanna Mainzer, Isabella Giambra, Tong Yin, Petra Engel, Hannah Hümmelchen, Henrik Wagner, Axel Wehrend, Christiane Egerer, Katharina Gerhards, Gerald Reiner, Sven König

PMC · DOI: 10.1371/journal.pone.0343836 · PLOS One · 2026-03-03

## TL;DR

This study identifies genetic factors influencing tail length and abnormalities in pigs and sheep, offering insights for breeding strategies to avoid harmful practices like tail docking.

## Contribution

The study integrates sequence-based GWAS and comparative genomics to reveal conserved and species-specific genetic variants affecting tail traits in pigs and sheep.

## Key findings

- A conserved genomic region on SSC18 in pigs and OAR4 in sheep contains six shared genes associated with tail length.
- Species-specific candidate genes for tail length and abnormalities were identified in pigs and sheep.
- Common carbohydrate metabolism pathways and species-specific immune and TGF-β signaling contribute to tail variation.

## Abstract

Long tails trigger tail biting in pigs and increase the risk of flystrike infections in sheep. Tail docking has been a common management practice in both species for decades, but increasingly conflicts with legal animal welfare guidelines. Sustainable solutions require breeding strategies targeting shorter tails. In consequence, the aims were to conduct whole-genome sequencing (WGS)-based genome-wide association studies (GWAS) and comparative genomic analyses (CGA) to explore functional elements influencing tail traits. Phenotypically divergent experimental populations of pigs and sheep were established through unified selection and mating experiments. Tail traits included tail length (TL) measured at birth, and tail abnormalities (TA) assessed radiographically at 14 weeks of age. WGS-based GWAS identified a significant locus on SSC18 in pigs and suggestive loci for TL in both species, which, together with previously reported loci for TA, were further analyzed by CGA. The genomic windows of the significant locus on SSC18 in pigs and the TL GWAS locus on OAR4 in sheep were found to be conserved, harboring six common genes with predicted functional variants. These variants were jointly associated with TL (Plm < 0.05) in both species in linear regression models adjusted for sex, age of the dam, body length, and body weight. In other GWAS locus windows (±1 Mb), species-specific TL candidate genes were identified in sheep (HOXB13, MUC5B, EPB41L3, MTCL1, PIEZO2, MPPE1, and LOXHD1) and in pigs (KNL1, DISP2, SPRED1, TGFB2, and HAND1), each harboring associated putative functional variants. For TA, sheep-specific candidates (PGM2, LRRC66, CRACD, LOC105601916, and SH2D4B) and pig-specific candidates (MYOT, TMCO6, and PCDHAC2) were revealed using logistic regression models (Pglm < 0.05). GO analyses of candidate genes predicted shared biological processes between sheep and pigs, whereas pathway analyses indicated that common carbohydrate metabolism pathways, along with species-specific immune and inflammatory signaling, and pig-specific TGF-β signaling and endochondral ossification, may contribute to tail length variation and abnormalities. These findings provided deeper insights into the genetic basis of differential embryonic tail morphogenesis and perinatal tail development across species.

## Linked entities

- **Genes:** HOXB13 (homeobox B13) [NCBI Gene 10481], MUC5B (mucin 5B, oligomeric mucus/gel-forming) [NCBI Gene 727897], EPB41L3 (erythrocyte membrane protein band 4.1 like 3) [NCBI Gene 23136], MTCL1 (microtubule crosslinking factor 1) [NCBI Gene 23255], PIEZO2 (piezo type mechanosensitive ion channel component 2) [NCBI Gene 63895], MPPE1 (metallophosphoesterase 1) [NCBI Gene 65258], LOXHD1 (lipoxygenase homology PLAT domains 1) [NCBI Gene 125336], KNL1 (kinetochore scaffold 1) [NCBI Gene 57082], DISP2 (dispatched RND transporter family member 2) [NCBI Gene 85455], SPRED1 (sprouty related EVH1 domain containing 1) [NCBI Gene 161742], TGFB2 (transforming growth factor beta 2) [NCBI Gene 7042], HAND1 (heart and neural crest derivatives expressed 1) [NCBI Gene 9421], PGM2 (phosphoglucomutase 2) [NCBI Gene 55276], LRRC66 (leucine rich repeat containing 66) [NCBI Gene 339977], CRACD (capping protein inhibiting regulator of actin dynamics) [NCBI Gene 57482], LOC105601916 (zinc finger protein 211-like) [NCBI Gene 105601916], SH2D4B (SH2 domain containing 4B) [NCBI Gene 387694], MYOT (myotilin) [NCBI Gene 9499], TMCO6 (transmembrane and coiled-coil domains 6) [NCBI Gene 55374], PCDHAC2 (protocadherin alpha subfamily C, 2) [NCBI Gene 56134]

## Full-text entities

- **Genes:** Interleukin-5 [NCBI Gene 443350], PCDHA1 [NCBI Gene 101122108], LRRC66 (leucine rich repeat containing 66) [NCBI Gene 100522021], c-Kit [NCBI Gene 780504], DISP2 [NCBI Gene 101113596], PGM2 [NCBI Gene 101111285], Wnt-3a [NCBI Gene 101123374], PIEZO2 [NCBI Gene 101105203], DISP2 (dispatched RND transporter family member 2) [NCBI Gene 100156025], KEL [NCBI Gene 101121343], HOXB13 [NCBI Gene 101114626], SH2D4B [NCBI Gene 101109766], SPRED1 [NCBI Gene 101112323], LOC105601916 (zinc finger protein 211-like) [NCBI Gene 105601916], EPHA1 [NCBI Gene 101115703], LRRC66 [NCBI Gene 101104319], KNL1 [NCBI Gene 102161250], EPHB6 [NCBI Gene 101120569], EPB41L3 (erythrocyte membrane protein band 4.1 like 3) [NCBI Gene 100520913], SPRED1 (sprouty related EVH1 domain containing 1) [NCBI Gene 100512576], TNF-alpha [NCBI Gene 443540], HOXB13 (homeobox B13) [NCBI Gene 100522893], TGF-beta2 [NCBI Gene 554322], MPPE1 [NCBI Gene 101105710], HAND1 [NCBI Gene 443353], VRTN [NCBI Gene 101106594], HAND1 (heart and neural crest derivatives expressed 1) [NCBI Gene 541594], Pax1 [NCBI Gene 101102749], TGFB2 (transforming growth factor beta 2) [NCBI Gene 397084], CLEC5A [NCBI Gene 101111012], CTCF [NCBI Gene 101114297], BMP2 [NCBI Gene 443173], MPPE1 (metallophosphoesterase 1) [NCBI Gene 100623694], EPB41L3 [NCBI Gene 101106481], TMCO6 [NCBI Gene 101119722], Interleukin-6 [NCBI Gene 443406], CLCN1 [NCBI Gene 101115453], MTCL1 [NCBI Gene 101103445], MGAM [NCBI Gene 101113407], CRACD [NCBI Gene 101108572], MYOT (myotilin) [NCBI Gene 100101550] {aka TTID}, TMCO6 (transmembrane and coiled-coil domains 6) [NCBI Gene 100519892], Lin28 [NCBI Gene 100302344], MYOT [NCBI Gene 101107350], HES7 [NCBI Gene 101121950], PDGFD [NCBI Gene 101117784], SH2D4B (SH2 domain containing 4B) [NCBI Gene 100153283], Interleukin-2 [NCBI Gene 443401], PIEZO2 [NCBI Gene 100620725], ATF2 [NCBI Gene 101108548], MEX3C [NCBI Gene 101113452], Gdf11 [NCBI Gene 101104900], KNL1 [NCBI Gene 101114616], PGM2 (phosphoglucomutase 2) [NCBI Gene 100522261], MUC5B [NCBI Gene 101106755], LOXHD1 [NCBI Gene 101112528], LOXHD1 [NCBI Gene 100520225]
- **Diseases:** developmental defects (MESH:D000094602), skeletal abnormalities (MESH:D009139), WDGV (MESH:C537350), mastitis (MESH:D008413), inflammatory (MESH:D007249), developmental abnormalities (MESH:D006130), TL (MESH:D007870), hydrometrocolpos (MESH:C538159), muscle weakness (MESH:D018908), short necks (MESH:D006258), vaginal atresia (MESH:D014627), perinatal lethality (MESH:C564306), arthrogryposis (MESH:D001176), scoliosis (MESH:D012600), spine deformities (MESH:D016135), spasms (MESH:D013035), AXISD (MESH:C566610), embryonic early death (MESH:D003643), TA (MESH:C562903), infections (MESH:D007239), vertebral defects (MESH:C535781), fertility disorders (MESH:D007246)
- **Chemicals:** glycogen (MESH:D006003), galactose (MESH:D005690), EDTA (MESH:D004492), pentose phosphate (MESH:D010428), sucrose (MESH:D013395), O-glycan (-), amino sugar (MESH:D000606), ENU (MESH:D005038), starch (MESH:D013213), carbohydrate (MESH:D002241)
- **Species:** Ovis aries (domestic sheep, species) [taxon 9940], Sus scrofa (pig, species) [taxon 9823], Mus musculus (house mouse, species) [taxon 10090], Canis lupus familiaris (dog, subspecies) [taxon 9615], Macaca sinica (toque macaque, species) [taxon 9552], Formosa sp. AT (species) [taxon 515984], Bos taurus (bovine, species) [taxon 9913], Danio rerio (leopard danio, species) [taxon 7955], Felis catus (cat, species) [taxon 9685], Homo sapiens (human, species) [taxon 9606]
- **Mutations:** rs427246640, rs81366497, rs420232320, rs344739920, rs3486997775, G > GGA, rs596500732, rs327640688, G > T, rs417947464, rs319509181, rs339415605, R > A, rs690408303, rs403011667, rs416623867, G > C, rs81212592, rs419737652, rs335834834, rs160996012, rs412838553, GGTGGTCACTGTGGAGGCGGGTCCTGTCTCACTGGTGTGGGTGGAGGTCTTCTCA > G, rs334012214, rs425695059, rs325159288, rs424483114, C > T, rs404721484

## Full text

_Full body text omitted from this summary view._ Fetch the complete paper as Markdown: https://tomesphere.com/paper/PMC12956100/full.md

## Figures

5 figures with captions in the complete paper: https://tomesphere.com/paper/PMC12956100/full.md

## References

78 references — full list in the complete paper: https://tomesphere.com/paper/PMC12956100/full.md

---
Source: https://tomesphere.com/paper/PMC12956100