Exploring the influence of nanosilica on monoterpene biosynthesis, PAL1 and LS gene expression in cumin (Cuminum cyminum L.) under water-deficit stress

TL;DR

This study shows that nanosilica can boost essential oil production in cumin under moderate drought by enhancing key gene activity, but its benefits decrease under severe drought.

Contribution

The study introduces nanosilica as a novel tool to enhance drought tolerance and essential oil yield in cumin through gene regulation.

Findings

Nanosilica significantly upregulated PAL1 and LS gene expression, increasing essential oil yield in cumin under moderate drought.

Essential oil yield in cumin increased from 2.19 to 5.14 kg/ha in the Isfahan landrace with 6 mM nanosilica at 60% field capacity.

Nanosilica's effectiveness declined under extreme drought, with cuminaldehyde content dropping over 50% despite treatment.

Abstract

Drought stress considerably influences plant growth, physiological processes, and secondary metabolite synthesis, such as essential oil in Cumin (Cuminum cyminum L.), a medicinal and aromatic plant. The present expriment explores the possibility of using nanosilica (nSi) to enhance essential oil yield in cumin under various drought conditions. The cumin seeds utilized in this study were sourced from pakan bazr Isfahan, an Iranian seed company. Two Iranian cumin landraces, Isfahan and Semnan, were subjected to three drought levels (60, 40, and 20% of field capacity, FC) combined with three concentrations of nanosilica (0 as control, 4, and 6 mM) using a factorial experiment based on a randomized complete block design (RCBD). The study evaluate the levels of phenylalanine ammonia-lyase 1 (PAL1) and limonene synthase (LS) expression, essential oil yield and quality through the utilization of gas chromatography-mass spectrometry (GC-MS).

The results indicated that nSi application considerably upregulated PAL1 (peaked at 60% FC, increasing by 3.3 fold-change with 6mM nSi application) and LS expression (up to 3.6 fold-change under moderate drought) under drought conditions, promoting drought tolerance and essential oil production. The highest essential oil yield was recorded at 60% FC with 6 mM nSi, which was raised from 2.19 to 5.14 Kg.ha-1 in Isfahan landrace and from 2.92 to 7.22 Kg.ha-1 in Semnan landrace. The α-pinene (reaching 8.6 at 20% FC, 4 mM nSi, Isfahan landrace), β-pinene (31.5 at 20% FC, 4 mM nSi, Semnan landrace), and cuminaldehyde (6.3 at 60% FC, 4 mM nSi in Semnan landrace) content of monoterpenes changed with the variation of drought stress and nSi treatment, indicating continuous improvement of secondary metabolite synthesis by nSi under stress.

Findings demonstrate that nanosilica enhancing PAL1 and LS, key metabolic pathways genes in cumin under drought stress. Nanosilica’s efficacy diminished under extreme stress, where cuminaldehyde content still dropped by over 50% despite treatment. These results underscore nanosilica’s potential to improve secondary metabolite and crop resilience under moderate water deficit, though integrated strategies are required for severe drought conditions.

Figures

Relative expression of LS and PAL1 genes on diffrent concentration of foliar nanoslica at drought stress levels in isfahan and Semnan landraces. Error bars represent the standard error (SE) of the mean. Columns with different letters have significant differences as determined by Fisher’s LSD test (*p* < 0.05)

Interaction effect of nanosilica×drought strees on essential oil yield in isfahan and Semnan landraces. Error bars represent the standard error (SE) of the mean. Columns with different letters have significant differences as determined by Fisher’s LSD test (*p* < 0.05)

Interaction effect of drought stress × nanosilica in Isfahan and Semnan landraces on α –Pinene, Sabinene, β-Pinene, α-Phellandrene, ρ-cymene,γ-terpinene, Cuminaldehyde, Safranal, and Cuminalcohol content in the essential oil. Error bars represent the standard error (SE) of the mean. Columns with different letters have significant differences as determined by Fisher’s LSD test (*p* < 0.05)

Pearson’s correlation coefficients between the studied genes, essential oil content and yield

Full text

Introduction

Drought is an abiotic stress that affects plant growth and yield extensively on a global scale. It also interrupts different physiological processes in plants, such as photosynthesis, nutrient absorption, and transpiration of water, reducing the metabolic pathways of organisms [1]. The SLM046 cultivar had the lowest reduction of seed (27%) and essential oil yield (33%) under drought stress, compared to the control condition in Brassica napus L [2]. Plants deployment a host of strategies at the morphological, physiological, biochemical, cellular, and molecular [3] levels to offset the effects of drought. This includes closing stomata, osmotic adjustment, and the production of antioxidants or hormonal mediation [4–6]. Foliar application of elicitors help plant to improve the deployment, as [7] reported Regardless to melatonin application, in Thymus vulgaris under 40% FC conditions the activity of superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) were considerably more than those in control plants (100% FC) by 4.1, 1.8, and 0.64 times respectively.

Cumin (Cuminum cyminum L.) is an important medicinal plant that belongs to the Apiaceae family. Because of their medicinal and culinary properties have been valued traditionally and still today. With a combination of relatively high tolerance for drought and minor economic motivation to farmers, any reduction in yield under severe drought conditions will trickle down in reverse onto the farmer himself. Therefore, it is necessary to enhance the drought tolerance of cumin plants. As a result, this would maintain the quality and quantity of its essential oils which are prerequisite for industrial applications [8]. PGPR and nanotechnology are both promising tools for enhancing essential oil, yield, and drought resistance. Foliar application of iron (Fe) and zinc (Zn) nanoparticles on quinoa increased growth and biochemical characteristics under drought stress [9].

Mohammadi-Cheraghabadi et al. [10] show that the highest concentration of 1.8-cineole, camphor, α-thujone, β-thujone, CS, SS, and BPPS were obtained in the irrigation regime of 80% ASWD with the application of 0.75 mM putrescine, also [11] reported foliar application of D-ornithine improves drought tolerance in sage under stressful conditions by promoting photosynthetic pigments, relative water content (RWC), and leaf area index (LAI).

Nanosilica (nSi) has emerged as an agricultural tool with the potential to alleviate the impact of drought on plants. The role of nanosilica in alleviating drought stress includes enhancing water relations between plants and providing a buffer against oxidative damage, thereby maintaining plant health under stressful conditions [12]. Many important genes play significant roles in the plant secondary metabolic pathway, like limonene synthase (LS) and phenylalanine ammonia-lyase 1 (PAL1). One of the main monoterpenes was limonene whose amounts was 20.57% and 13.41% during vegetative and flowering stages, respectively and play important role in plant physiological and antioxidant response to drought stress [13, 14]. PAL regulates plant stress tolerance by changing the contents of salicylic acid and lignin, which were considered to have broad-spectrum resistance [15]. Therefore, these genes are crucial for helping plants develop increased resistance to drought conditions and for both the quality and quantity of essential oils [16].

Owing to their bioactive composition, essential oils are essential in both medicine and food and can be used for body care products. They are also part of the defence mechanisms. Its urgently need to improve the quality and quantity of essential oils to meet the demands of industry and also help plants resist environmental stress [8, 17]. The aim of this study was to examine how nanosilica may protect cumin plants from drought and enhance the production of essential oils. This study hypotheses was nanosilica may cause structural interference at key points in secondary metabolic pathways, thus enhancing both the output and quality of cumin essential oil. The innovation of this study lies in the utilization of nanosilica to improve drought resistance and enhance essential oil quality and yield in cumin plants. While a number of previous studies have explored the role of nanosilica in agriculture, its direct effects on cumin in terms of both drought-resistance improvements and changes in essential oil quality are not known. Therefore, this study advances the knowledge of how nanotechnology can be combined with well-known farming methods to enhance a range of crop management practices from drought control through irrigation systems and other inputs such as fertilizers under adverse environmental conditions improving productivity while also conserving natural resources.

Materials and methods

Exprimental site and design

A factorial experiment based on a randomized complete block design (RCBD) with three replications was conducted in Bafq, Iran (Yazd province, 31° 58’ N 55° 04’ E), with detailed site provided in Tables 1 and 2. Each replication consisted of 4 rows, each 2 m long, with 25 cm spacing between rows. The study aimed to investigate the effects of Nanosilica (nSi) foliar application and drought stress on cumin’s gene expression pattern, essential oil yield and monoterpene compounds. The experimental treatments consisted of a 3 × 3 factorial arrangement of drought stress levels (60, 40, and 20% of field capacity, FC) and nSi foliar concentrations (0 as control, 4, and 6 mM). The cumin commercial landraces, Isfahan and Semnan landraces was selected for this study due to its widespread commercial use, and to ensure comparability with the vast majority of prior studies in the field. The seeds were obtained from pakan bazr Isfahan, an Iranian seed company. Land preparation began in autumn with deep plowing (30 cm depth) to reduce soil compaction and improve drainage, followed by initial leveling, soil texture, and nutrient analysis.

Table 1. Geographical and climatic characteristics of the study areaRegionLatitudeLongitudeAltitude (m asl)Annual Rainfall(mm)Mean AnnualTemperature(°C)Bafgh31°58’55°4’9956019.2

Table 2. Geographical features and meteorological data (obtained from the Iran’s meteorological organization’s official website) during the 2023 cumin planting season at Bafq experimental sitesLocationAT (°C)AR (mm)ARH (%)Eva (mm. day^− 1^)AST (°C)BafqFebruary17.630.0027.425.367.22March21.470.0924.137.5810.90April25.060.1018.9410.2114.13May31.360.0013.5212.1018.29June37.620.0012.9315.7224.63AT Average temperature, AR Average rainfall, ARH Average relative humidity, Eva Evaporation, AST Average soil temperature

Treatments and crop management

Foliar applications were performed twice: after the six-leaf stage (late March) and before flowering (mid-April). Control plants received distilled water with foliar spray soap to account for potential surfactant effects. Drought stress was imposed after the six-leaf stage, once plants were established. Soil moisture levels were monitored using the pressure plate method, which involved saturating soil samples under specific pressures and drying them to determine moisture content. Based on soil moisture content and apparent specific soil mass, volumetric moisture at FC and permanent wilting point (PWP) was calculated for each drought level.

RNA isolation and gene expression analysis

Sample prepration and RNA isolation

Plant Samples were collected 24 h after applying drought stress from each replication and immediately frozen in liquied Nitrogen. The TRIzol reagent method using 50 mg of leaf tissue was used for RNA isolation [18]. nanodrop and 1% agarose gel electrophoresis with 1X TAE buffer were employed to quantify and assess the quality of the extracted RNA. The gel was subjected to electrophoresis at a constant 90 V for 1 h. RNA integrity was confirmed by a clear 28 S/18S rRNA band ratio (~ 2:1) on the agarose gel (Fig. 1). All RNA samples used for cDNA synthesis had an A260/A280 ratio between 1.9 and 2.1 and an A260/A230 ratio greater than 2.0, indicating high purity.

Fig. 1A High-quality, intact RNA with clear 28S and 18S rRNA bands. B Agarose gel (1.5%) electrophoresis indicating the amplification of a single PCR product of the expected size for Actin, LS, and PAL 1 genes in Cumin (C) amplification curves for Actin, LS, and PAL 1 genes in Cumin (D) melting curves for Actin, LS, and PAL 1 genes showing single peaks

Target gene sequence and primer designing

Phenylalanine ammonia-lyase 1 and Limonene synthase gene sequence retrived from cumin sequence read archive (SRA), sequences of cumin were obtained from the NCBI database. The raw sequencing reads were assembled using MEGAHIT Galaxy Version 1.2.9 + galaxy1. Carrot (Daucus carota) a closely related Apiaceae species, served as the reference organism (Table 3). Target genes identified in the carrot were aligned with the assembled cumin sequences to facilitate homology-based analysis. Primer pairs for these target genes were subsequently designed using Geneious Prime 2021.1.1 software. For normalization, the actin gene was chosen as the endogenous control due to its well-documented stability and widespread validation as a reliable internal standard in gene expression studies, as supported by previous literature [19]. actin gene sequence obtined from NCBI data base (SRX6810150) and a Primer pairs also designed by using Geneious Prime 2021.1.1 software.

cDNA syntesis and qRT-PCR

cDNA synthesis was performed using the RevertAid Reverse Transcriptase enzyme, following the guidelines provided by Yektatajhiz Co. Kit. The qRT-PCR reactions were performed using the Bioer Real-Time PCR System and SYBR Green PCR Master Mix (Ampliqun, Denmark). Each reaction was run in three technical replicates. The thermal cycling protocol consisted of an initial denaturation step at 94 °C for 3 min, followed by 35 cycles of denaturation at 94 °C for 30 s, annealing at 60–65 °C (gene-specific) for 30 s, and extension at 72 °C for 45 s. Following amplification, melt curve analysis was performed from 58 °C to 95 °C (increment of 2 °C for 5 s) to confirm the specificity of the amplification product (Fig. 1). The cycle threshold (Ct) values for the target and reference genes across all samples ranged from 18 to 31 cycles. As many reports show and validate actin as a commonly evaluated housekeeping gene for qPCR normalization in plants [20–23] and studies in carrot (Daucus carota), a key Apiaceae species, confirm actin as one of the most stable reference genes across abiotic stresses (heat, cold, salt, and drought) and hormone stimuli ranked highest overall by geNorm and NormFinder [19, 24] it was used for normalization.

Table 3. Designed primers characteristicGene NamePrimer(5’→3’)Tm(°C)Product size (bp)Reference Gene NCBI IDActin 7Forward: CAGGAATCCACGAGACAACTTACAACReverse: CAGTGGTGGTTCAACTATGTTTCCG62107LOC108202619Phenylalanine ammonia-lyase 1Forward: AAAGATTTGCTCAGAGTTGTGGACCReverse: GAACTTGAGCACATCCATCTTCCA65161LOC108223317Limonene SynthaseForward: CTGTCCCTTAACAATTTCGCCAGReverse: GCTCGGTGGTATTACAGTGGATAT62144KX827596

Essential oil extraction and analysis

Hydrodistillation and yield calculation

At physiological maturity, 50 g seeds were harvested to extract essential oil and to calculate its yield. The cumin seeds were crushed into a fine powder using a mixer. Essential oil was extracted from each sample through hydrodistillation using a Clevenger apparatus for 2 h. The extracted oil was dried using anhydrous sodium sulfate, and the essential oil yield was calculated as a percentage (%) of the seed dry weight using the following formula: Essential oil yield (%) = (Weight of extracted essential oil / Dry weight of seeds) × 100. This percentage was then converted to and reported as kg.ha^-1^ based on the seed yield per hectare [25].

Gas chromatography (GC-MS)

GC-MS was analyzed using an Agilent 7890 gas chromatograph equipped with a 5975 C mass selective detector and an HP-5MS column (30 m × 0.25 mm × 0.25 μm). The operating conditions were as follows: samples (2 µL) were diluted to 1% with n-hexane, and helium was used as the carrier gas at a 1.0 mL.min⁻¹ flow rate. The oven temperature program began with an initial hold at 60 °C for 3 min, followed by a ramp to 150 °C at a rate of 3 °C.min⁻¹, then a further ramp to 260 °C at 3 °C.min⁻¹, and a final hold at 260 °C for 10 min. The injector and detector temperatures were set to 230 °C and 250 °C, respectively. Oil components were identified by comparing their retention indices to those of C₈–C₂₅ n-alkanes and using the Wiley commercial library [26, 27].

Statistical analysis

Statistical analyses were conducted using SAS software 9.4 M6 version, with treatment effects considered fixed. Means of main factors were compared using the protected Fisher’s LSD test at a significance level of P < 0.05, while interactions were analyzed using the LS means procedure. Graphs were generated using Microsoft Excel 2019 and JMP Pro software. To determine the fold change in gene expression, the Livak method [28] was applied using the following formula:

\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\text{Fold change in gene expression}=2^{\left( -\triangle\triangle Ct \right)}$$\end{document}

Results

Gene expression pattern

As the water suply reduced an cumin plant imposed to drought stress, PAL1 gene expression dramaticaly changed. The expression level of the PAL1 gene under conditions without nSi foliar application gradually decreases with increasing drought stress levels. Foliar aplication of 6 mM nSi leads to increase 3.35 times of PAL1 levels in 60% FC compared to control In Isfahan landrace. In Semnan landrace too, PAL1 levels changed. there is 3.19 fold change with 4 mM nSi application in 60% FC compared to control. This reduction in expression intensity is more pronounced at higher nSi foliar application levels in the Semnan landrace. It should be noted that the decrease in gene expression levels without nSi foliar application under varying drought stress levels is not statistically significant. Increasing the concentration of nSi foliar application significantly enhances gene expression levels, despite its declining trend with elevated drought stress. However, the increase in expression from 4 mM to 6 mM did not exhibit substantial variations. In the absence of nSi, the gradual decrease in PAL expression with increasing drought stress levels might indicate that the plant’s ability to maintain defense responses diminishes under severe stress conditions. When drought stress was increased, variability in rate of LS gene expression levels should be appear. As shown in Fig. 2 LS levels increase from 1.51 at 60% FC without nSi application to 4.56 with 4 mM nSi, then 5.025 with 6 mM nSi application In Isfahan landrace. This trend was not observed in Semnan landrace, though, the values are more than Isfahan landrace. Specifically, as the drought stress intensity increased from 60 to 40% FC, the gene expression level increased; however, further intensification of stress from 40 to 20% FC resulted in a decline in gene expression. Within this pattern, nSi foliar application enhanced gene expression. Treatment with 4 mM nSi significantly increased gene expression compared to the control, like application at 6 mM, though, they have not statistically significant difference. In the Semnan landrace, significant differences were observed between 4 mM and 6 mM nSi treatments only under the 40% FC condition, whereas in all other treatments, significant differences were solely detected when compared to the control group.

Fig. 2. Relative expression of LS and PAL1 genes on diffrent concentration of foliar nanoslica at drought stress levels in isfahan and Semnan landraces. Error bars represent the standard error (SE) of the mean. Columns with different letters have significant differences as determined by Fisher’s LSD test (p < 0.05)

Essential oil yield and composition

The results of Fig. 3 showed that with increasing concentration of nSi, the essential oil yield increased at 60% FC from 2.19 to 5.14 Kg.ha^− 1^ in Isfahan landrace at the same time. In Semnan landrace the same trend have seen, essential oil yield content increase from 2.92 Kg.ha^− 1^ at 60% FC without nSi to 7.22 Kg.ha^− 1^ at 60% FC with 6 mM nSi, and fluctuates at lower levels under more severe drought. This suggests that essential oil yield may initially decrease under moderate drought stress (60% FC) but can be partially restored with nSi application. Application of nSi (4 and 6 mM) appears to influence essential oil yield, but the intensity of effect is depending on drought severity and genetic background. in Isfahan landrace, under 60% FC, essential oil yield is higher with 4 mM (4.174 Kg.ha^− 1^) and 6 mM (5.147 Kg.ha^− 1^) nSi than control (2.19 Kg.ha^− 1^). In Semnan landrace, under 60% FC, essential oil yield at 4 mM (7.059 Kg.ha^− 1^) and 6 mM (7.22 Kg.ha^− 1^) nSi are higher than control with a value of 2.92 Kg.ha^− 1^. This indicates that nSi application may enhance essential oil yield under moderate drought stress, potentially aiding in stress tolerance (Fig. 3).

Fig. 3. Interaction effect of nanosilica×drought strees on essential oil yield in isfahan and Semnan landraces. Error bars represent the standard error (SE) of the mean. Columns with different letters have significant differences as determined by Fisher’s LSD test (p < 0.05)

As drought severity increases, the value of essential oil compositions content changed (Fig. 4). α-Pinene is a monoterpene known for its role in plant defense and stress responses. The increase in α-Pinene under moderate drought stress with nSi application suggests that silicon may enhance the plants ability to increase defensive compounds under stress condition. The fluctuation in levels across drought conditions indicates that α-Pinene synthesis is sensitive to water availability. α-Pinene Levels change across drought levels, higher levels observed with 4 mM nSi in Isfahan landrace at 20% FC (8.63).

Fig. 4. Interaction effect of drought stress × nanosilica in Isfahan and Semnan landraces on α –Pinene, Sabinene, β-Pinene, α-Phellandrene, ρ-cymene,γ-terpinene, Cuminaldehyde, Safranal, and Cuminalcohol content in the essential oil. Error bars represent the standard error (SE) of the mean. Columns with different letters have significant differences as determined by Fisher’s LSD test (p < 0.05)

Sabinene is another monoterpene involved in plant defense. Its low levels under severe drought suggest that its synthesis may be inhibited under extreme stress conditions. The slight increase with nSi application at 40% FC indicates that silicon may help maintain Sabinene production under moderate stress. Sabinene levels are generally low across all conditions, the highest levels observed in 4 mM nSi application at 40% FC in Semnan landrace (3.53) and 3.39 in Isfahan landrace in same treatment.

β-Pinene is an important terpene involved in plant defense and stress tolerance. β-Pinene increase under drought stress suggest it plays a protective role, possibly by deterring herbivores or reducing oxidative stress. β-Pinene content generally increase with drought severity, peaking at 40% FC (24.94) and 20% FC (25.49) both of them with 4 mM nSi. Application of nSi influence the composition of essential oils, but the effect varies depending on the component and drought severity.

α-Phellandrene remain relatively stable across drought levels, with slight increases under moderate drought (60% FC) and severe drought (20% FC). NSi application does not significantly alter α-Phellandrene content. α-Phellandrene is a minor terpene with potential of antioxidant properties. Its stability across drought conditions suggests it may not be as responsive to water stress as other compounds. The lack of significant change with nSi application indicates that its synthesis is not heavily influenced by silicon.

p-Cymene levels show variability, higher levels observed with 4mM nSi at 40% FC with the value of 18.2 in Isfahan and 18.15 in Semnan landraces. NSi application slightly increases p-Cymene levels under moderate drought compared to the control. p-Cymene is a monoterpene with antimicrobial properties. Its variability under drought suggests that its synthesis is influenced by water availability.

γ-Terpinene levels are highest with 4 mM nSi at 40% FC in Semnan landrace (23.14), 20% FC (20.94 with 4 mM nSi) and 40% FC with 4 mM nSi in Isfahan landrace (20.84). γ-Terpinene is a terpene with antioxidant and antimicrobial properties. Its decrease under severe drought suggests that its synthesis is limited under extreme stress. The increase with nSi application at 40% FC indicates that silicon may help maintain γ-Terpinene production under moderate stress.

Cuminaldehyde content reduce with increasing drought severity, from 6.57 at 60% FC with 4 mM nSi to 3.01 at 20% FC. NSi application enhances Cuminaldehyde levels under moderate drought.

Safranal levels are generally low, with the highest levels observed at 40% FC and 4 mM nSi (26.11) in Isfahan landrace and 27.69 at 60% FC with application of 4 mM nSi in Semnan landrace. Safranal is a compound with potential antioxidant and stress-protective properties. Its low levels under severe drought suggest that its synthesis is inhibited under extreme stress.

The increase with nSi application for Cuminaldehyde, Safranal and Cuminalcohol highlights silicon’s role in supporting the production of aromatic compounds under stress.

Correlation analysis

The Pearson technique was employed to evaluate correlation (Fig. 5). As outlined by the correlation graph, PAL1 and LS displayed an extremely robust beneficial correlation (0.7395) with a p-worth of less than 0.0001. The co-regulation of PAL1 and LS reflects a trade-off between lignin (structural defense) and terpenoids (chemical safety). Reports demonstrate that the phenylpropanoid and terpenoid pathways are typically co-activated under abiotic stress (e.g., drought) to boost resiliency [29]. LS and EOY demonstrated a good substantive correlation (p < 0.0001). Also Cuminaldehyde and Cuminalcohol (0.7982) Shows a very strong positive correlation, suggesting a close relationship between these compounds and p-Cymene and Safranal (0.5980), Indicates a moderate to strong positive correlation. The results show a positive relationship between PAL1 and cuminaldehyde (0.7028). The negative correlation between α-Pinene and Safranal (-0.5739) is intriguing and may reflect competitive inhibition or divergent metabolic pathways. The moderate correlations, such as those between Sabinene and α-Phellandrene (0.5247), suggest potential co-regulation or synergistic effects in their biological activities. However, the weak or negligible correlations, such as between β-Pinene and Cuminaldehyde (-0.0070), imply independent metabolic processes, which could be further explored to understand their distinct roles in plant physiology.

Fig. 5. Pearson’s correlation coefficients between the studied genes, essential oil content and yield

Discussion

Our study elucidates the role of nanosilica (nSi) as a molecular priming agent that transcriptionally reprograms key biosynthetic pathways in cumin (Cuminum cyminum L.) under drought stress. By integrating physiological, biochemical, and gene expression analyses, we demonstrate that nSi does not merely alleviate drought symptoms but dynamically modulates the phenylpropanoid and terpenoid pathways enhancing both stress tolerance and the production of specialized metabolites with functional and economic value.

Nanosilica primes the phenylpropanoid pathway through strategic PAL1 regulation

The drought-induced upregulation of PAL1 further amplified by nSi under moderate stress (60% FC) confirms its role as a pivotal entry point into the phenylpropanoid pathway. This pathway supplies precursors for lignin and protective phenolics, which collectively enhance cell wall fortification, reduce oxidative damage, and improve osmotic adjustment under water deficit [4, 30–32]. The fact that nSi boosted PAL1 expression most effectively under moderate drought aligns with the concept of stress priming, wherein a mild elicitor pre-activates defense mechanisms before severe stress occurs [33, 34]. Under severe drought (40% FC), however, PAL1 induction declined despite nSi application, suggesting either metabolic reallocation toward survival processes or the saturation of signaling cascades under extreme stress [35]. This biphasic response underscores that nSi functions optimally within a defined stress window, fine-tuning rather than overriding the plant’s innate stress-response logic [36, 37].

Limonene synthase expression reflects terpenoid pathway plasticity under drought

LS gene expression followed a pattern similar to PAL1, increasing under moderate drought and responding positively to nSi [38]. As the committed enzyme in limonene biosynthesis [39], LS activity directly influences the flux toward monoterpenes, a class of volatiles with documented roles in stress adaptation, such as antioxidant activity and indirect defense signaling [40, 41]. The parallel enhancement of LS and PAL1 by nSi points to a coordinated upregulation of distinct yet metabolically linked secondary pathways. Under severe drought, however, LS induction was attenuated, indicating that terpenoid biosynthesis may be downregulated when carbon and energy resources are diverted to core maintenance processes. These observations align with models of metabolic trade-offs under stress, where specialized metabolism is prioritized only until survival is threatened [42].

Essential oil yield and composition: an integrated metabolic output

The observed peak in essential oil yield (EOY) at 60% FC with 4–6 mM nSi treatment illustrates how moderate stress, when combined with nSi priming, can stimulate rather than suppress secondary metabolism [43]. This aligns with the eustress concept, where sublethal stress enhances the production of defensive compounds [44]. Notably, nSi not only restored EOY under moderate drought but also qualitatively reshaped the essential oil profile. The significant increase in β-pinene a monoterpene with known antioxidant capacity supports the hypothesis that nSi selectively enhances metabolites with direct protective functions. In contrast, cuminaldehyde a valuable flavor compound declined sharply under severe drought irrespective of nSi, indicating pathway-specific vulnerability. Such selective modulation suggests nSi influences regulatory nodes upstream of terpenoid diversification, possibly through the methylerythritol phosphate (MEP) pathway’s early enzymatic steps or associated transcription factors [45].

Correlative and mechanistic integration of phenylpropanoid and terpenoid pathways

The strong positive correlation (r = 0.7395) between PAL1 and LS expression provides compelling evidence for the co-regulation of phenylpropanoid and terpenoid metabolism under drought. This interconnection may be mediated by shared precursors (e.g., phosphoenolpyruvate), redox signaling, or stress-responsive transcription factors that govern multiple secondary pathways [46–48]. By enhancing PAL1 expression, nSi may bolster the pool of aromatic compounds that interact with terpenoid biosynthesis either through metabolic cross-talk or via improved cellular homeostasis. This integrative effect likely underpins the observed resilience in EOY and the maintenance of essential oil quality under stress.

Landrace-specific responses highlight the role of genetic background

The differential responses of the Isfahan and Semnan landraces particularly in safranal accumulation emphasize that genetic variation shapes how effectively nSi primes defense pathways. Such genotype dependent efficacy is consistent with studies on other elicitors and nanomaterials [49, 50], and it underscores the need for tailored priming strategies in precision agriculture.

Conclusion

This investigation establishes a significant advancement in nano-priming strategies for stress mitigation by demonstrating that nanosilica functions not merely as a passive growth enhancer, but as a targeted molecular elicitor. We reveal a crucial, stress-intensity-dependent role for nanosilica in orchestrating the coordinated upregulation of key biosynthetic genes phenyalanine amonia-lyase 1 in the phenylpropanoid pathway and limonene synthase in the monoterpenoid pathway under moderate drought stress. This selective gene activation, leading to a quantifiable ~ 40% increase in phenyalanine amonia-lyase 1 expression and a ~ 35% increase in limonene synthase expression with 4 mM nanosilica application, represents a form of metabolic priming. Our findings thus move beyond the conventional view of nanosilica as a structural protectant, positioning it as a precision tool for modulating specific stress-responsive metabolic networks. A pivotal and novel contribution of this work is the clear delineation of nanosilica’s efficacy threshold. We demonstrate that while nanosilica application significantly stabilizes essential oil yield (notably increasing it by 25% at 60% Field Capacity) and modulates key monoterpenes under moderate stress, its capacity to reprogram metabolism is fundamentally overwhelmed under severe drought (20% Field Capacity). The observed nanosilica-driven preservation of essential oil yield and composition under sub-lethal stress carries profound implications for the sustainable cultivation of high-value medicinal and aromatic plants (MAPs) in drought-prone regions. By mitigating the qualitative and quantitative volatility of essential oils. However, our data unequivocally argue for an integrated management framework. The future of drought resilience lies not in a single silver bullet but in synergistic strategies: combining genetic selection for drought-tolerant cultivars, This layered approach, grounded in a deep understanding of stress-intensity-dependent metabolic responses, paves the way for developing robust cropping systems capable of sustaining both productivity and phytochemical quality in the face of increasing environmental uncertainty.