NeuroViOme: a viral orfeome collection for studies of neurodegenerative disease

TL;DR

NeuroViOme is a comprehensive collection of viral genes that may help study how viruses contribute to neurodegenerative diseases like Alzheimer's and Parkinson's.

Contribution

The paper introduces NeuroViOme, the most comprehensive viral ORFeome resource for studying viral-host interactions in neurodegeneration.

Findings

NeuroViOme includes protein-coding sequences from nine viruses linked to neurodegenerative diseases.

The resource enables systematic studies of viral-host protein interactions in conditions like ALS and MS.

It provides a foundation for interactome mapping and functional genomics in neurodegeneration research.

Abstract

Neurodegenerative diseases such as Alzheimer’s and Parkinson’s disease, Amyotrophic Lateral Sclerosis (ALS), and Multiple Sclerosis (MS) pose a global health challenge due to their progressive course and lack of curative therapies. These conditions lead to severe neurological decline, significantly impacting patient independence and quality of life, and ultimately result in lethal outcome. Emerging evidence suggests that viral infections contribute to the onset and progression of these neurological diseases, Leblanc and Vorberg (PLoS Pathog 18:e1010670, 2022), either by directly inducing neurological symptoms or by triggering immune responses resulting in neuropathology. Nevertheless, systematic studies of the direct interplay between viral and host proteins in neurodegeneration remain scarce. A key aspect of viral pathogenesis is direct interaction between viral and host proteins (protein–protein interactions, PPIs), which are essential for viral replication and can disrupt or redirect host cell function Kim et al. (Nat Biotechnol, 2022); Zhou et al. (Res Sq, 2022), potentially contributing to the development of diseases traditionally considered non-communicable. Understanding these molecular mechanisms is crucial for advancing diagnostic and therapeutic strategies in neurodegenerative conditions, particularly ALS and MS. To enable systematic studies of these interactions, we introduce NeuroViOme as ORFeome resource encompassing nearly all protein-coding sequences from nine viruses selected based on their prevalence, neurotropism, and mechanistic or epidemiological links to neurodegenerative processes. NeuroViOme includes ORFs from Enteroviruses (EV-A71, EV-D68, CVB3, Echovirus E30), Herpesviruses (HSV-1, EBV, HHV3/Varicella Zoster), the endogenous retrovirus HERV-K, and Polyomavirus JCPyV. To our knowledge, this represents the most comprehensive viral ORF set assembled for neurodegeneration research to date. The collection builds the foundation for interactome mapping and functional genomics analyses and provides a valuable basis for systematic studies of viral perturbations of host pathways.

The online version contains supplementary material available at 10.1007/s13365-025-01303-5.

Full text

Introduction

Increasing evidence suggests that viral infections can contribute to long-term conditions that extend beyond acute illness, including several neurodegenerative disorders (Levine et al. 2023). Although a direct causal relationship between viral exposure and diseases such as ALS has been examined for decades (Salazar-Grueso and Roos 1995), conventional attempts to detect persistent viral material in patient tissues have yielded limited success (Celeste and Miller 2018). Nonetheless, it is now widely recognized that viral insults can produce delayed or lasting neurological effects even after the primary infection has resolved (Carfi et al. 2020; Choutka et al. 2022; Greenhalgh et al. 2024), underscoring the need to better understand how viruses influence neurodegenerative processes.

Mechanistically, viruses may contribute to neurodegeneration because their replication depends on viral proteins that interact with, and modulate, host cellular pathways (Basic et al. 2014). Experimental studies have shown that even asymptomatic viral infections can interact with host genetic susceptibility to trigger chronic disease-like phenotypes (Cadwell et al. 2010). Virus–host protein–protein interactions (PPIs), while essential for viral propagation, can perturb neuronal homeostasis and reshape host interaction networks involved in neurodegenerative diseases (Wan et al. 2020). Previous systematic interactome studies from our group and others have demonstrated that mapping such molecular perturbations yields powerful mechanistic insights into how microbial and viral factors alter human cellular systems (Altmann et al. 2020; Calderwood et al. 2007; Gulbahce et al. 2012; Mukhtar et al. 2011; Wessling et al. 2014) (Kim et al. 2022; Osborne et al. 2023).

To enable similar approaches towards understanding viral contributions to neurodegenerative disorders we present the NeuroViOme, an open reading frame collection (ORFeome) for ORFs of nine viruses suspected to play a role in ALS, MS, AD and other neurodegenerative disorders.

Enabling systems-level analysis of viral drivers in neurodegeneration

Although ORFeome libraries are well established for many model organisms, comparable resources for viruses remain limited. Early initiatives showed that, despite the large number of sequenced viral genomes, only a small proportion of viral ORFs has been cloned in experimentally tractable formats, and usually only for individual pathogens, resulting in fragmented and heterogeneous collections (Pellet et al. 2010). Reviews in virus–host interactomics emphasize that, because comprehensive viral ORFeomes exist for only a few species, high-throughput studies typically rely on self-assembled, virus-specific ORF sets that are often incomplete or inconsistent across studies. Differences in cloning strategy, vector context, and annotation impact on experimental results (Braun et al. 2009; Varjosalo et al. 2013) and thus complicate integration of data across viruses and impede systematic comparisons of their host-targeting strategies, conserved mechanisms, or characteristic network perturbations (de Chassey et al. 2008; Pellet et al. 2010). Despite extensive progress in viral genome sequencing, only a fraction of viral coding sequences has been formatted for standardized functional assays, underscoring a persistent gap between available sequence information and experimentally accessible viral gene resources.

This gap is particularly important in neurodegeneration research, where viral exposure is increasingly recognized as a potential environmental contributor to disorders such as ALS, MS, Alzheimer’s disease, or Parkinson’s disease. Cohort studies and mechanistic analyses indicate that viral factors may act as biological “hits”, which, according to the multiple-hits hypothesis (Patrick et al. 2019), interact with host genetic or immune susceptibilities to promote chronic neuroinflammation, protein aggregation or e.g. defective proteostasis towards neuronal dysfunction. Evaluating such mechanisms systematically often requires the ability to compare viral proteins across diverse viral families in a comprehensive manner, an undertaking that is now facilitated by the availability of a coherent viral ORF collection.

NeuroViOme directly addresses these challenges by providing an experimentally consistent platform for studying viral proteins from nine viruses spanning four viral families. By bringing these ORFs together in a single resource, cross-virus comparisons become feasible in ways that were previously limited by heterogeneous constructs and fragmented ORF availability. Importantly, ORF-based resources also lower the practical and biosafety barriers to virology, as isolated viral open reading frames can be examined without handling infectious virus. This greatly facilitates studies focused on the functions of individual viral proteins or their interactions with host factors, which can be performed without biosafety-level facilities and are therefore accessible to neurodegeneration laboratories that may not have specialized virological infrastructure. While ORFeome collections are not intended to model all aspects of viral infection, such as entry, replication, or immune evasion, they provide a powerful and complementary approach for dissecting protein-level mechanisms that contribute to host perturbation.

Within their intended scope, viral ORFeomes offer an accessible means to conduct reproducible and scalable functional assays, integrate viral perturbations into established disease models, and identify virus-specific or convergent pathways that may influence neuronal vulnerability. Ultimately, such a resource expands the toolkit available for probing the molecular interface between viruses and neurodegenerative processes.

Evidence linking selected viral families to neurodegenerative processes

The NeuroViOme viral ORFeome comprises nine viruses selected for their documented or emerging relevance to neurodegenerative processes, their representation of diverse viral families, and their compatibility with systematic ORF-level functional studies. These viruses encompass high-prevalence pathogens with lifelong persistence, classically neurotropic agents causing CNS injury, and viruses associated with proteinopathy, neuroinflammation, or demyelinating pathology. This evidence-supported panel enables comparative analyses across heterogeneous viral mechanisms and provides a foundation for identifying convergent host pathways targeted by distinct viruses.

Herpesviruses constitute a central part of the collection due to their ubiquity, latency, and extensive neurological impact. Epstein–Barr virus (EBV) shows the strongest epidemiological link between a virus and a neurodegenerative condition: longitudinal cohort studies demonstrate that EBV seroconversion precedes multiple sclerosis (MS) onset and massively elevates MS risk (Bjornevik et al. 2022). Beyond MS, experimental work suggests that EBV may contribute to neurodegenerative conditions through mechanisms involving neuroinflammation, blood–brain barrier disruption, and viral activity within CNS-resident or infiltrating immune cells (Tiwari et al. 2022). Herpes simplex virus type 1 (HSV-1), another globally prevalent neurotropic virus, has been associated with Alzheimer’s disease pathology, supported by evidence that HSV-1 infection promotes amyloid-β accumulation, tau phosphorylation, and microglial activation (De Chiara et al. 2010; Wozniak et al. 2007). Epidemiological interactions with APOE-ε4 further strengthen this link(Itzhaki et al. 1997). Beyond Alzheimer’s disease, HSV-1 has also been reported to modulate neuroimmune and autophagy-related pathways, including optineurin, an autophagy receptor that restricts neuroinvasive HSV-1 infection and is implicated in ALS-related neurodegenerative mechanisms (Ames et al. 2021). Varicella–zoster virus (HHV3) has similarly been connected to neurodegenerative trajectories: reactivation induces neuroinflammation and can exacerbate pathology in the presence of latent HSV-1 (Cairns et al. 2022), while population-level studies report an elevated dementia risk following HHV3 infection (Blandi et al. 2025). Observational associations between shingles vaccination and reduced dementia incidence (Eyting et al. 2025) highlight the relevance of HHV3 as a potentially modifiable risk factor.

Enteroviruses add a distinct set of neurodegeneration-relevant mechanisms to the NeuroViOme panel. Enterovirus D68 (EV-D68) has been linked to acute flaccid myelitis and selective injury of anterior horn motor neurons, the same cellular population vulnerable in ALS and other motor neuron disorders, through combined viral, inflammatory, and protease-mediated mechanisms (Vogt et al. 2022). Enterovirus A71 (EV-A71) promotes neurodegeneration via astrocytic apoptosis (TLR7/IL-6 signaling) (Luo et al. 2019), motor neuron ferroptosis (Chooi et al. 2024), and TDP-43 cleavage (Wo et al. 2021). Coxsackievirus B3 (CVB3) contributes to neuropathology in both Parkinson’s disease and ALS models by inducing α-synuclein(Park et al. 2021) and TDP-43 pathology (Xue et al. 2022), impairing proteostasis, and accelerating disease progression in genetically susceptible mice. Echovirus 30 (E30), a leading cause of aseptic meningitis and encephalitis, shows neuroinvasive capacity and elicits chronic inflammatory and synaptic gene-expression changes that overlap with pathways implicated in neurodegeneration(Li et al. 2022).

The neurovirulent polyomavirus JCPyV adds a distinct glial component to the panel. Beyond its established role in progressive multifocal leukoencephalopathy, transcriptomic analyses reveal extensive immune activation, blood–brain barrier disruption, and potential neuronal involvement even outside classical immunosuppressed contexts (Honkimaa et al. 2024).

Finally, HERV-K, an endogenous retrovirus belonging to the human endogenous retroviral repertoire that comprises about 8% of the genome, was included based on evidence that its reactivation is associated with autoimmune diseases, cancers, and neurological disorders (Garcia-Montojo et al. 2024), and that its envelope protein contributes to neurotoxicity and TDP-43 pathology in ALS(Steiner et al. 2022).

Viruses were further evaluated for feasibility and completeness of ORF annotation to ensure compatibility with our sequence-verified Gateway cloning pipeline. HTLV-1, despite neurological relevance, could not be incorporated because its ORFs are absent from the human ORFeome collection, while HIV-1 was excluded due to its distinct research landscape and availability of existing dedicated ORFeomes. The resulting set captures major neurotropic, neuroinflammatory, and neurodegenerative mechanisms while enabling systematic, cross-virus analyses that can reveal shared host targets and convergent pathogenic pathways. Comprehensive analyses of the virus–host interactome derived from this resource, including extensive functional validation, are currently ongoing and will be reported in a dedicated manuscript upon completion.

Key clinical and mechanistic features, along with a qualitative evidence level for neurodegenerative involvement, are compiled for all included viruses (see Table 1).Table 1. Neurological relevance of viruses included in the NeuroViOme ORFeome – summaryVirusViral GroupMain clinical manifestationsNeurotropism (main)Key neurodegenerative mechanisms (examples)Level of evidenceEBVHerpesviridaeInfectious mononucleosisCNSEpidemiological link to MS; evidence for AD-related Aβ and tau changes; immune-mediated neurodegenerationStrongHSV-1HerpesviridaeOral herpes, encephalitisTrigeminal ganglia, latentPromotes Aβ accumulation, tau phosphorylation, neuroinflam-mation; AD, MS, ALS associationStrongHHV3(Varicello-virus)HerpesviridaeVaricella, shinglesPeripheral ganglia, latentReactivation triggers neuroin-flammation, may induce HSV 1 reactivation and AD like patho-logy; epidemiological links to dementiaModerateEV-D68Enterovirus DRespiratory disease, acute flaccid myelitis (AFM)Motor neurons in anterior horn of spinal cordMotor neuron infection, inflammation, disruption of nucleocyto-plasmic transport; relevance to motor neuron disease mechan.EmergingEV-A71Enterovirus Ahand, foot, and mouth disease (HFMD)Astrocytes, motor neuronsTLR7/IL-6–mediated astrocytic apoptosis, ferroptosis in motor neurons, TDP-43 cleavageModerate–EmergingCVB3Enterovirus BMyocarditis, meningitisCNSInduction of α-syn aggregates, TDP-43 mislocalization, exacerbation of ALS-like pathology in susceptible modelsModerateE30Enterovirus BHFMD, AFM, aseptic meningitisCNS, neurons, gliaChronic inflammation, impaired neurogenesis, synaptic gene dysregulation; mechanistic overlap with neurodegenerative pathwaysEmergingHERV-KHuman endogenous retrovirusEndogenous, reactivated in diseaseNeurons, neural stem cellsTDP-43 proteinopathy, direct neurotoxicity of env, ALS-like degeneration in transgenic modelsStrongJCPyVPolyomaviridaePMLOligodendrocytes glia, CNSDemyelination, neuroinflammation, BBB disruption**Strong******Evidence level integrates epidemiology, neurotropism, and mechanistic data

Methods

Viral protein-coding ORFs were obtained from several sources or generated in Entry vectors for compatibility with the Gateway cloning system(Walhout et al. 2000). This recombinational cloning system enables the highly efficient transfer of ORFs into identical expression plasmids and is therefore uniquely suited for standardized functional assays (Altmann et al. 2018; Walhout et al. 2000). A comprehensive collection of HSV-1 ORFs in pENTR207 (NovoPro Bioscience Inc. Cat.#: V011826) or pENTR221 (Thermo Fisher Cat.#: 12536017) were acquired from the DNASU Plasmid Repository(Rolfs et al. 2008; Seiler et al. 2014; Yu et al. 2014). An EBV ORF collection in pENTR223 (NovoPro Bioscience Inc. Cat.#: V011817) was obtained from the Center for Cancer Systems Biology (CCSB) at the Dana-Farber Cancer Institute(Calderwood et al. 2007). All remaining ORFs were generated by gene synthesis. To ensure a coherent and reproducible ORFeome suitable for systematic functional studies, we defined explicit criteria for ORF identification. Reference genome sequences and their annotations were downloaded from the NCBI database to identify protein-coding ORFs for Varicella Zoster Virus (HHV3: NC_001348.1), Polyomavirus (JCPyV: NC_001699.1), HERV-K (HERV-K113: NC_022518.1), Enterovirus 71 (EV-A71: MG208882.1), Enterovirus D68 (EV-D68: NC_038308.1), Echovirus 30 (E30: ON129560.1), Coxsackievirus B3 (EV-B3: U57056.1) and Epstein-Barr virus (EBV: NC_007605.1). ORFs were derived from the respective NCBI reference genome annotation and each coding sequence was evaluated for uniqueness determined at the protein-sequence level. ORFs encoding identical amino-acid sequences were represented once, whereas annotated internal ORFs were treated as separate entities. Proteolytic cleavage products of polyproteins derived from one transcript were also treated as separate entities (ORFs), when annotated in the respective reference genome. Partial constructs covering specific protein domains were incorporated only when they were present in existing validated libraries (e.g., DNASU HSV-1). These constructs were not counted as independent ORFs but were retained as optional tools for domain-specific analyses. For genes subject to long-range alternative splicing, specifically from herpesvirus genomes, in line with established approaches for ORFeome collections for, e.g., the human ORFeome (Luck et al. 2020), the longest mRNA structure as represented in the respective reference genome was chosen in order to ensure consistency and comparability across viruses.

Sequences for EBV ORFs obtained from CCSB were aligned to the respective coding sequences from the reference genome. Of the 87 ORFs in the reference genome, 7 differed in sequence and 4 were missing from the CCSB collection. Therefore 10 of these 11 ORFs were included for gene synthesis. The ORFs for EBV protein BPLF1 and gp24 of HHV3 could not be synthesized due to their sizes of > 9 kb and > 8 kb, respectively. In addition, the HHV3 reference genome contains three ORF pairs with identical sequences.

In total, 122 viral ORF sequences were compiled for gene synthesis. For all sequences, a translational start codon was added, if not present in the native sequence. Two nucleotides (gc) were added in front of the translational start codon for in-frame fusion to N-terminal tags in Gateway expression plasmids upon LR recombination reaction. Stop codons were removed, where present, and replaced with a unified stop codon, TAA, to facilitate its potential removal by PCR with a universal primer for applications requiring C-terminal fusion constructs. Sequences were then uploaded to the gene synthesis web interface from Twist Bioscience (San Francisco, CA, USA) for evaluation. Eight sequences were not accepted for synthesis due to long direct repeats, small repeats, areas with high GC content or a combination thereof. These sequences were codon optimized for S. cerevisiae, producing synthesizable sequences for seven of these ORFs. From the four Enteroviruses, gene synthesis for the respective proteolytic cleavage product ORF 3B was not possible due to high repeat density in the corresponding annotated nucleotide sequences, even after codon optimization. For these small ORFs of 66 nucleotides, each ORF was placed in three tandem repeats, separated by a glycine linker (ggtggc), followed by codon optimization, yielding synthesizable sequences. Finally, the reference sequence for ORF 3 C from the polyprotein of EV-A71 contained degenerate base code at three positions. This sequence was aligned to GenBank accession LC626894.1 (Enterovirus A71 2488-Yamagata-2006 RNA) to replace the degenerate code with the respective nucleotides at those positions.

ORF sequences > 300 nucleotides were generated as clonal genes in pTwistENTR (Twist Biosciences) and NGS-verified at Twist Bioscience (n = 117). For sequences < 300 nucleotides, Gateway recombination sites were added to the 5’-end (attB1: GGGGACAAGTTTGTACAAAAAAGCAGGCT) and 3’-end (attB2: ACCCAGCTTTCTTGTACAAAGTGGTCCCC) and subsequently synthesized as gene fragments (n = 16). The obtained fragments were cloned into pDONR223 by BP recombination reaction. The resulting Entry clones were isolated from single colonies and verified by Sanger sequencing.

Results

The NeuroViOme ORFeome as Gateway Entry clone collection, represents, to our knowledge, the most comprehensive viral ORF collection associated with neurodegenerative disease risk assembled to date. Covering almost 90% of the protein-coding capacity of nine neurodegeneration-associated viruses, this resource provides an important foundation for systematic studies of viral contributions to human neurological disorders. The breadth of the collection, containing the genomes of the Enteroviruses EV-A71, EV-D68, CVB3 and Echovirus E30, the human endogenous retrovirus HERVK, the Herpesviruses HSV-1, EBV and HHV3/Varicella Zoster, and the Polyomavirus JCPyV (s. Table 2) enables parallel interrogation of conserved and virus-specific mechanisms across distinct viral families, spanning positive-sense RNA viruses, herpesviruses, retroviruses, and polyomaviruses.Table 2. NeuroViOme coverage and Composition - SummaryVirusAccession ## of unique ORFs in ref. seq.# of unique, full-length ORFs in NeuroViOmeCoverageTotal # of ORFs in NeuroViOmeSourceEBVNC_007605.1877586%80CCSB/gene synthesisHSV-1X14112.1745980%181DNASUHHV3NC_001348.1706390%63Gene synthesisEV-D68NC_038308.1111091%10Gene synthesisEV-A71MG208882.1111091%10Gene synthesisEV-B3 (CVB3)U57056.1111091%10Gene synthesisEV30 (E30)ON129560.1111091%10Gene synthesisHERV-KNC_022518.144100%4Gene synthesisJCPyVNC_001699.166100%6Gene synthesisTotal28524787%374

In total, the NeuroViOme ORFeome contains 247 of the 285 unique ORFs within the reference genomes from the nine viruses as full-length Entry clones. The clones were compiled from several sources. HSV-1 ORFs were acquired from the DNASU plasmid repository, covering 59 of 74 ORFs from the HSV-1 reference genome (accession #: X14112.1) as full-length clones. Six additional ORFs are only covered as partial sequences encoding N- or C-terminal fragments of the viral protein, respectively. Such partial sequences also exist for 15 further ORFs that are also available as full-length constructs. Moreover, many constructs are available as open (lacking a stop codon) and closed (with stop codon) forms.

Of the 87 ORFs in the EBV reference genome, 75 are included in the ORFeome collection. Analysis of sequences from 92 putative full length EBV ORFs provided by the CCSB revealed that six had between 9 and 312 additional nucleotides at the 5’-end compared to the respective reference sequences. Additionally, four EBV reference ORFs were not present as full-length clones. These ORFs were generated by gene synthesis to supplement the EBV part of the ORFeome (see materials and methods). By further analysis of CCSB-derived clones by PCR evaluation of insert size, as well as Sanger sequencing, the full-length sequences for 11 ORFs could not be confirmed and were therefore removed from the collection.

The reference genome of HHV3 contains 70 unique ORF sequences, of which 63 are represented in the NeuroViOme collection. The genome structure of the four Enteroviruses EV-A71, EV30, EV-D68 and CVB3 are identical, each consisting of 11 ORFs following the same gene nomenclature. Except for the four ORF2As ORFs, which could not be cloned possibly due to toxicity of the encoded protease, all remaining 40 ORFs of the Enteroviruses are included in NeuroViOme. Finally, all six ORFs from the polyomavirus JCPyV, as well as the four coding sequence elements of the human endogenous retrovirus HERV-K113 are included in this collection. The constructs for these seven viruses were generated by gene synthesis and analyzed via NGS or Sanger sequencing (see materials and methods).

In total and including partial coding sequences for six HSV-1 ORFs (UL27, UL28, UL37, UL46, UL56 and UL9), NeuroViOme ORFeome comprises 253 constructs, together covering 88.8% of unique viral ORFs from nine viruses. The supplementary table provides information on all viral ORF constructs within the NeuroViOme ORFeome, including sequences, sequence configuration (open/closed) and vectors. The clones can be obtained from the authors. Clones for HSV-1 can additionally be obtained from the DNASU plasmid repository.

Optimization strategies included codon adaptation for gene synthesis for difficult or repetitive sequences. The ORF sequences of EBV_BWRF1.1, EBV_BVLF1, EBV_LF1, EBV_BALF3, HHV3_gp16 and the respective ORF 3B from the four enteroviruses were codon-optimized for S. cerevisiae to permit their synthesis. Additionally, the four ORF 3B sequences from the reference genomes were each placed in three tandem repeats separated by glycine linkers to obtain sequences permissible to synthesis. Importantly, these strategies faithfully retain the amino acid sequences of the encoded proteins and should therefore not impact the study of protein structure and cellular function, although potential unknown regulatory elements within the coding sequences may not be maintained. A modular cloning workflow compatible with Gateway recombination technology and a large collection of plasmids ensures that the NeuroViOme constructs can be readily deployed in a wide variety of downstream functional assays, including interaction screens, phenotypic assays and to subcellular localization studies to name just a few. The standardized construct design and use of identical vectors in these assays ensures that all results can be integrated in a meaningful way.

Discussion

The breadth of the NeuroViOme resource significantly extends beyond previous ORFeome projects that were limited to single viruses or narrow taxonomic groups(Calderwood et al. 2007; Rozenblatt-Rosen et al. 2012; Weller et al. 2023). By Integrating the coding repertoires of multiple neurotropic viruses into a single, standardized collection, in a flexible recombinational cloning system NeuroViOme enables cross-species and comparative virology approaches that were not previously feasible. For instance, it allows parallel interrogation of host–virus protein–protein interaction (PPI) networks to identify conserved and virus-specific strategies of host manipulation. These comparative studies can illuminate shared pathogenic mechanisms, such as the exploitation of RNA-binding proteins or stress granule components, as well as unique features that distinguish individual viral species.

Moreover, the comprehensive representation of viral coding sequences creates opportunities to explore synergistic or antagonistic effects of co-infection, which is particularly relevant in the context of neurodegeneration, where cumulative viral burden or sequential exposure to distinct pathogens has been proposed as a risk factor (Levine et al. 2023). The modular nature of the collection also facilitates multiplexed functional screens, enabling simultaneous interrogation of large viral protein sets in neuronal or glial models.

It must be noted that, although the NeuroViOme ORFeome provides broad coverage of viral coding sequences, certain aspects of viral gene expression remain outside the scope of this resource. The collection focuses on canonical protein-coding ORFs and therefore does not include alternative splice variants, non-coding regulatory elements, or accessory peptides that aregenerated through proteolytic processing during specific infection stages in addition to canonical cleavage products. In a few cases, synthesis of highly repetitive or GC-rich sequences required codon optimization, which preserves the encoded proteins but may differ from native transcriptional features within the coding sequence. These considerations reflect common constraints in large-scale ORFeome generation and do not diminish the utility of the resource.

Since the generation of this ORFeome was mainly motivated by our high throughput virus-host protein-protein interaction mapping effort (manuscript in preparation) the collection is also ideally suited for functional genomics and cell biology approaches. Beyond this, viral proteins can be expressed individually or in combinations to probe their combined effects on neuronal survival, protein aggregation, and innate immune signaling. In parallel, structural biology efforts can exploit the cloned ORFs for protein expression and structural analysis, accelerating the discovery of small-molecule inhibitors targeting key virus–host interfaces. The ORFeome further enables functional high-throughput screening (Pachano et al. 2025) and rapid hypothesis testing as well as comparative Perturb-seq style studies (Dixit et al. 2016). Naturally, ORF-level functional studies cannot replace studies with whole viruses but are a powerful and safe complement to interrogate the impact of individual or small groups of viral proteins. Collectively, these approaches will enable studies to elucidate how viruses influence neurodegenerative disease processes and support the development of novel antiviral or neuroprotective therapies.

Taken together we present NeuroViOme as a powerful resource for the standardized functional study of neurotrophic viruses. NeuroViOme captures the vast majority of full-length viral ORFs across nine neuro-associated viruses and provides one of the most comprehensive and experimentally ready viral ORFeome collections available to date and provides a powerful platform for understanding viral contribution to neurodegenerative diseases.

Supplementary Information

Below is the link to the electronic supplementary material.

Supplementary File 1(XLSX 218 KB)