The Swedish Thripidae (Thysanoptera) – with additional notes on wetland thrips

Abstract
Genes, proteins, chemicals, diseases, species, mutations and cell lines named across the full text — each resolved to its canonical identifier and authoritative record.
Click any figure to enlarge with its caption.
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
Figure 10
Figure 11
Figure 12
Figure 13
Figure 14
Figure 15| 1 | Metathoracic endoskeletal furca lyre-shaped, extending to mesothoracic furca (Fig. |
|
| – | Metathoracic furca small, U- or Y-shaped, rarely extending to mesothoracic furca and then only as a slender spinula (Fig. |
|
| 2(1) | Head with conspicuous honeycomb-patterned reticulation; always macropterous; antennae with long, whiplike last segment; first vein of forewing more or less fused to costa (Fig. |
|
| – | Head not conspicuously strongly reticulated; doubtful species are apterous or with first vein and costa clearly separate |
|
| 3(2) | Abdominal tergites covered with microtrichia, with at most a small bare patch medially |
|
| – | Abdominal tergites without numerous microtrichia |
|
| 1 | Wing apex acute with a long terminal seta; antennae 7-segmented; minute yellow thrips with conspicuously dark wings (greenhouses/indoors) |
|
| – | Anterior margin of forewings recurved at apex to join posterior margin, terminal setae minute; antennae 8- or 9-segmented (Fig. |
|
| 2(1) | Pronotum with one pair of long posteroangular setae |
|
| – | Pronotum without prominent posteroangular setae |
|
| 3(2) | Forewings uniformly shaded grey-brown (Fig. |
|
| – | Forewings banded (Fig. |
|
| 1 | First vein of forewing with a complete row of stout setae (Fig. |
|
| – | Forewing with only a few setae on first vein (Fig. |
|
| 2(1) | Pronotum with one pair of long postero-angular setae; forewings broad with wing membrane reticulate (Fig. |
|
| – | Pronotum without prominent postero-angular setae; forewings slender without reticulate pattern (Fig. |
|
| 1 | Abdominal tergites medially with a bare patch lacking microtrichia (Fig. |
|
| – | Abdominal tergites completely covered with microtrichia; metanotum with microtrichia near posterior margin at least; micropterous or macropterous |
|
| 2(1) | Microtrichia on metanotum forming a transverse band at posterior third (Fig. |
|
| – | Metanotal microtrichia irregularly arranged, often forming a triangular patch covering posterior half (Fig. |
|
| 1 | Abdominal tergites with microtrichia, at least some microtrichia present laterally along the lines of sculpture or marginally (Fig. |
|
| – | Abdominal tergites without microtrichia; ctenidia present (Fig. |
|
| 2(1) | Sternites with microtrichia |
|
| – | Sternites without microtrichia |
|
| 3(2) | Antennae 8-segmented (greenhouses/indoors) |
|
| – | Antennae 6-segmented |
|
| 4(2) | Forewing with 2 visible longitudinal veins (second vein bearing at least 2 setae) (Fig. |
|
| – | Forewing apparently with only one longitudinal vein (second vein without setae); maxillary palps 2-segmented (Fig. |
|
| 5(4) | Ocellar setae s3 situated medially in front of hind ocelli (Fig. |
|
| – | Ocellar s3 situated between hind ocelli; both meso- and metathoracic furca with spinula (Fig. |
|
| 6(5) | Postocular setae s1 conspicuously longer than s3 (Fig. |
|
| – | Postocular setae s3 and s1 subequal in length (Fig. |
|
| 7(1) | Metathoracic furca with spinula (Fig. |
|
| – | Metathoracic furca without spinula (Fig. |
|
| 8(7) | Ctenidia present, at least on abdominal tergites VII–VIII (Fig. |
|
| – | Abdominal tergites without ctenidia, but sometimes with a group of irregular microtrichia |
|
| 9(8) | Maxillary palps 3-segmented (Fig. |
|
| – | Maxillary palps 2-segmented (Fig. |
|
| 10(9) | Antennal segments III and IV with forked sense cones; mesothoracic spinula present (Fig. |
|
| – | Antennal segments III and IV with simple sense cones; mesothoracic spinula absent (Fig. |
|
| 11(10) | Ctenidia on tergite VIII laterad in front of spiracles (Fig. |
|
| – | Ctenidia on tergite VIII mesad and posterior to spiracles (Fig. |
|
| 12(11) | Fore tarsi at least with a small tooth (Fig. |
|
| – | Fore tarsi unarmed; interocellar setae usually arising in front of hind ocelli |
|
| 13(12) | Fore tarsus apically with a curved apical claw (Fig. |
|
| – | Fore tarsus apically with a triangular tooth (Fig. |
|
| 14(11) | Metanotum without campaniform sensilla (Fig. |
|
| – | Metanotum with campaniform sensilla (Fig. |
|
| 15(14) | Head projecting in front of eyes; cheeks straight and approx. as long as compound eyes (Fig. |
|
| – | Head not projecting; cheeks rounded and shorter than compound eyes (Fig. |
|
| 16(14) | All postocular setae s4 not very long and stout (Fig. |
|
| – | Postocular setae s4 long and stout (Fig. |
|
| 17(11) | Tibiae with 3 long setae (Fig. |
|
| – | Tibiae without distinctive long setae (Fig. |
|
| 18(17) | At least abdominal sternites III–IV with accessory setae in addition to the 6 marginal setae (Fig. |
|
| – | All abdominal sternites without accessory setae |
|
| 19(18) | Pleurotergites III–IV with accessory setae medially (Fig. |
|
| – | Pleurotergites III–IV with setae at posterior margin only |
|
| 20(19) | Antennae 8-segmented (Fig. |
|
| – | Antennae 7-segmented (Fig. |
|
| 21(20) | Forewing pale; first vein with 3 setae on distal half of wing (Fig. |
|
| – | Forewings shaded; first vein with at least 5 setae on distal half of wing (Fig. |
|
| 22(21) | Antennal segment III slender; as dark as IV (Fig. |
|
| – | Antennal segment III swollen; lighter than IV; tergite VIII in females with marginal comb of microtrichia interrupted medially (Fig. |
|
| 23(20) | Forewing with 3 setae on distal half of first vein (Fig. |
|
| – | Forewing with 7–11 setae on distal half of first vein (Fig. |
|
| 24(19) | Antennae 8-segmented (Fig. |
|
| – | Antennae 7-segmented (Fig. |
|
| 25(24) | Fore wing with 3 setae on distal half of first vein (Fig. |
|
| – | Fore wing with more than 5 setae on distal half of first vein; tergite II with 3 setae on lateral margin (Fig. |
|
| 26(24) | Accessory setae arranged in more than 1 transverse row (Fig. |
|
| – | Accessory setae arranged in a single transverse row (Fig. |
|
| 27(26) | Sternite III – VI with 1–5 accessory setae each; pleurotergites with rows of microtrichia (Fig. |
|
| – | Sternal accessory setae more numerous; pleurotergites without ciliate microtrichia; tergite IX with 2 pairs of campaniform sensilla (Fig. |
|
| 28(27) | Fore tarsus with a slender claw at apex (Fig. |
|
| – | Fore tarsus unarmed; metanotum more or less striate medially (Fig. |
|
| 29(28) | Male brown: female x + 2y + z > 430 µm (where x = length of inner pronotal posteroangular setae (Fig. |
|
| – | Male yellow; female with x + 2y + z < 430 µm (see notes above) |
|
| 30(18) | Pleurotergites III – IV with one or more accessory setae medially (Fig. |
|
| – | Pleurotergites III – IV with setae at posterior margin only |
|
| 31(30) | Body colour yellow; setae dark; metanotum very closely striate |
|
| – | Body colour brown; setae dark; legs and antennal segment III yellow; metanotum closely striate |
|
| 32(30) | Abdominal tergite VIII with complete comb of microtrichia on posterior margin (Fig. |
|
| – | Either abdominal tergite VIII without posterior marginal comb, or comb interrupted medially (Fig. |
|
| 33(32) | Abdominal pleurotergites with rows of microtrichia (Fig. |
|
| – | Abdominal pleurotergites without rows of microtrichia; tergite IX in females frequently with 2 pairs of campaniform sensilla (Fig. |
|
| 34(33) | Head and thorax yellow, or if yellow with faint brown markings, then median pairs of tergal setae (s1, s2) half as long as tergites length (Fig. |
|
| – | Head and thorax brown |
|
| 35(34) | Interocellar setae arising posterior to fore ocellus, within ocellar triangle (Fig. |
|
| – | Interocellar setae arising almost laterad of fore ocellus, anterolateral of ocellar triangle (Fig. |
|
| 36(35) | Tergites IV – V with 2 pairs of median setae (s1, s2) half as long as tergites length (Fig. |
|
| – | Median setae on tergites IV – V < 0.3 × as long as length of these tergites; head and thorax yellow, abdominal tergites sometimes with grey markings medially |
|
| 37(36) | Abdominal tergite IX of female with 1 pair of campaniform sensilla (anterior pair absent) (Fig. |
|
| – | Abdominal tergite IX of females with 2 pairs of campaniform sensilla (Fig. |
|
| 38(37) | Setae s2 on tergites II – V light; tergite V with setae s2 clearly shorter and weaker than s3 (Fig. |
|
| – | Setae s2 on tergites II – V dark brown; tergite V with setae s2 and s3 subequal in length and strength (greenhouses/indoors) |
|
| 39(34) | Tergite II with 3 setae on lateral margin (Fig. |
|
| – | Tergite II with 4 setae on lateral margin (Fig. |
|
| 40(32) | Females usually micropterous, rarely macropterous; metanotum medially reticulate; tergite VIII with comb on posterior margin represented by a few weak triangular teeth only (Fig. |
|
| – | Both sexes macropterous; metanotum with longitudinal sculpture medially |
|
| 41(40) | Antennal segments III and IV swollen with constricted vasiform apices (Fig. |
|
| – | Antennal segments III and IV without an elongated apical neck; tergite II with 4 setae on lateral margin (Fig. |
|
| 42(40) | Pronotum with lines of sculpture absent or very faint; males with pore plates on sternite III – VI |
|
| – | Pronotum with many well-developed transverse lines of sculpture (Fig. |
|
| 43(42) | Tergite II with 3 setae on lateral margin (Fig. |
|
| – | Tergite II with 4 setae on lateral margin (Fig. |
|
| 44(43) | Abdominal sternite I with 2 or 3 microsetae on the anterior margin (Fig. |
|
| – | Abdominal sternite I without microsetae on anterior margin; pronotal postero-angular setae long (usually > 54 µm) |
|
| 45(43) | Fore wings shaded, pale only at base (Fig. |
|
| – | Fore wings clear, uniformly pale throughout their length (Fig. |
|
| 46(45) | Median postocular setae (s1) slightly closer together than posterior ocelli; antennal segment III as dark as distal segments (Fig. |
|
| – | Median postocular setae (s1) approximately as far apart as posterior ocelli; antennal segments IV and V darker than III (Fig. |
|
| 47(9) | Mesothoracic furca with spinula (Fig. |
|
| – | Mesothoracic furca without spinula; abdominal sternite II with 6 setae |
|
| 48(10) | Antennae 8-segmented; body brown; sternites without discal setae |
|
| – | Antennae 7-segmented; body yellow with only segment X brown (Fig. |
|
| 49(8) | Pronotum with 2 pairs of postero-angular setae (Fig. |
|
| – | Pronotum with 1 pair or without postero-angular setae |
|
| 50(49) | Head usually with 2 pairs of ante-ocellar setae (Fig. |
|
| – | Head with only 1 pair of ante-ocellar setae or ocellar setae lacking |
|
| 51(50) | External sense cone on antennal segment VI with elongated base (Fig. |
|
| – | External sense cone on antennal segment VI round at base; fore tibia without distal teeth |
|
| 52(51) | Fore tibia with short teeth, not longer than the setae (Fig. |
|
| – | Fore tibia with 1 or 2 large apical claws (Fig. |
|
| 53(52) | Fore tibiae with 1 apical claw (Fig. |
|
| – | Fore tibiae with 2 apical claws (Fig. |
|
| 54(53) | Extruding part of sense cone of antennal segment VI short, at most 6 µm (Fig. |
|
| – | Extruding part of sense cone of antennal segment VI long, at least 10 µm (Fig. |
|
| 55(54) | Margins of antennal segment III basoventrally expanded (Fig. |
|
| – | Margins of antennal segment III evenly symmetrical |
|
| 56(53) | Fore tarsi with 1 or 2 small protuberances (Fig. |
|
| – | Fore tarsi smooth |
|
| 57(51) | Posterior margin of abdominal tergites II–VII with craspeda or at least with rounded or triangular plates (Fig. |
|
| – | Posterior margin of abdominal tergites without craspeda or other projections; sternite VII in females with median setae (s1) arising just anterior to posterior margin; males apterous, with three pore plates on each of sternites III–VIII |
|
| 58(57) | Pronotum rectangular; mesothoracic furca with spinula (Fig. |
|
| – | Pronotum trapezoidal; mesothoracic furca without spinula (Fig. |
|
| 59(58) | Antennal segment II evenly symmetrical |
|
| – | Antennal segment II produced outwards or at least asymmetrical (Fig. |
|
| 60(59) | Tergite VII with campaniform sensilla posterior to subbasal line (Fig. |
|
| – | Tergite VII with campaniform sensilla anterior to subbasal line (Fig. |
|
| 61(50) | Antennae 7-segmented; abdominal tergites with setae s1–s3 strong |
|
| – | Antennae 8-segmented |
|
| 62(61) | Fringes at anterior margin of forewing always longer than costal setae; postocular setae s2 short (Fig. |
|
| – | Costal setae of forewing longer than fringes; postocular setae s2 conspicuously long; “antennal segment III five times longer than wide, antennal segment IV with an additional simple sense cone (greenhouses/indoors) |
|
| 63(62) | Antennal segments VII–VIII together longer than VI; segment VI broadly attached to V (Fig. |
|
| – | Terminal antennal segments shorter; segment VI not broadly attached to V |
|
| 64(63) | Pterothorax and abdomen with polygonal reticulate sculpture (Fig. |
|
| – | Pterothorax and abdomen without polygonal sculpture; postocular setae shorter than interocellar setae |
|
| 65(64) | Body dark; other characters differing from below |
|
| – | Body yellow; forewings pale with brown cross-bands (Fig. |
|
| 66(65) | Hind margin of abdominal tergites without craspeda; tergite VIII with marginal comb present (Fig. |
|
| – | Hind margin of abdominal tergites with short craspeda; tergite VIII without marginal comb; micropterous (macropterous forms not known from Sweden) (Fig. |
|
| 67(66) | Fore tarsi with terminal claw (Fig. |
|
| – | Fore tarsi without terminal claw; first vein with 1 + 2 distal setae |
|
| 68(49) | Hind margin of pronotum with 4 pairs of posteromarginal setae |
|
| – | Hind margin of pronotum with 2 pairs of posteromarginal setae; posteroangular setae stout. long (up to 75 µm) and spatulate |
|
| 69(68) | Pronotum with a pair of long posteroangular setae (Fig. |
|
| – | Pronotum without conspicuous posteroangular setae |
|
| 70(69) | Mesothoracic furca without spinula (Fig. |
|
| – | Mesothoracic furca with spinula (Fig, 2A); maxillary palps 3-segmented (Fig. |
|
| 71(70) | Antennal segment II or III strongly asymmetric (Fig. |
|
| – | Antennal segment II or III not strongly prolonged externally (Fig. |
|
| 72(71) | Antennal segment III prolonged externally (Fig. |
|
| – | Antennal segment II prolonged apically |
|
| 73(71) | Antennal segments III–IV slightly asymmetric (Fig. |
|
| – | Antennal segments III–IV symmetric (Fig. |
|
| 74(70) | Fore tarsi with a curved apical claw (Fig. |
|
| – | Fore tarsi without protrusions |
|
| 75(74) | Abdominal sternites III–VI with discal setae (Fig. |
|
| – | Abdominal sternites III–VI without discal setae |
|
| 76(69) | Antennal style (segments VII–VIII) approx. as long as or slightly longer than segment VI |
|
| – | Antennal style (segments VII–VIII) much shorter than segment VI, or style absent (antennae thus 6-segmented) |
|
| 77(76) | Antennal segment III paler than remaining segments, as pale as fore tibia; abdominal segment X in females tapering posteriorly to a conical apex (Fig. |
|
| – | Antennal segment III brown, darker than fore tibia (Fig. |
|
| 78(76) | Abdominal tergites with craspeda (Fig. |
|
| – | Marginal craspeda on abdominal tergites not developed |
|
| 79(78) | Mesothoracic furca without spinula; body without reticulate sculpture; apterous |
|
| – | Mesothoracic furca with spinula (Fig. |
|
| 80(79) | Body slender, yellow; males (Fig. |
|
| – | Body stout; dark |
|
| 81(78) | Head longer than wide; antennal segments III–IV with simple sense cones (Fig. |
|
| – | Head wider than long; antennal segments III–IV with forked sense cones (Fig. |
|
| 82(81) | Antennae 6-segmented; abdominal sternites usually with discal setae (Fig. |
|
| – | Antennae 8-segmented; abdominal sternites without discal setae |
|
| 83(82) | Outline of antennal segment II oval, widest at mid-length; petiole exposed (Fig. |
|
| – | Outline of antennal segment II dome-shaped, widest at base; petiole concealed; posteromarginal setae on sternites III–IV arising in front of margin; sternites III–VI of males with small circular pore plates |
|
| 84(81) | Median setae (s1) at least on tergites VI–VIII long, longer than their distance apart (Fig. |
|
| – | Median setae (s1) on tergites VI–VIII short and weak, shorter than their distance apart |
|
| 85(84) | Median setae on tergites III–VI close to subbasal line (Fig. |
|
| – | Median setae (s1) on tergites III–VI at least 20 µm posterior of subbasal line (Fig. |
|
| 86(85) | Body yellow; median brown mottling occupying approx. half of the tergites; antennal segment I yellow; posterior margin of head brown |
|
| – | Body, head, and antennal segment I brown |
|
| 87(86) | Metanotum with campaniform sensilla (Fig. |
|
| – | Metanotum without campaniform sensilla; thoracic dorsal setae finely pointed |
|
| 88(84) | Clavus of forewing with 5 venal setae (Fig. |
|
| – | Macropterous; clavus of forewing with 6 venal setae (greenhouses/indoors) |
|
| 89(88) | Body dark brown; antennal segment I as dark as II (Fig. |
|
| – | Body yellow or yellowish brown; antennal segment I lighter than II; macropterous or macropterous |
|
Peer Reviews
No public reviews on file for this paper yet. If you reviewed it on a platform where reviews are public (OpenReview, ICLR, NeurIPS, ICML), you can paste yours below so the community can read it here.
Videos
No videos yet. Explain this paper in a talk, walkthrough, or lecture? Add one.
Taxonomy
TopicsInsect-Plant Interactions and Control · Lepidoptera: Biology and Taxonomy · Phytoplasmas and Hemiptera pathogens
Introduction
Thrips (Order Thysanoptera) constitute a diverse group of small insects, ranging typically from 0.5 mm to approximately 3 mm in length. The family Thripidae Stephens, 1829, commonly referred to as “common thrips,” is one of the most species-rich groups within the Thysanoptera. Many species within this family have significant agricultural implications, often causing damage to plants by feeding or through the transmission of viruses.
The knowledge of Thripidae in Sweden is based on mainly the larger collections of e.g. Ahlberg (1926) and Qvick (1977). The revision provided by Vasiliu-Oromulu et al. (2001) was based on Ahlberg’s collection revisited. In recent years several papers have proved that thrips offer a lot of new knowledge to discover regarding the Swedish species richness and the distribution of the various species (e.g., Gertsson 2015; Gertsson and Fägerström 2017; Gertsson 2022; Gertsson et al. 2022; Wahlberg 2023b). But the family Thripidae has not previously been comprehensively documented, leaving substantial gaps in our knowledge of species distribution, biology, and ecology. Previous faunistic studies primarily focused on limited geographical areas or specific pest species. Furthermore, there are no up-to-date identification keys to the Swedish Thripidae. Available keys are older and/or cover other regions (Mound et al. 1976, 2018; Qvick 1977; zur Strassen 2003).
Prior to the material produced herein, the Barcode of Life Database (BOLD, Ratnasingham and Hebert 2007) had only 22 species representing Sweden, with a total of 180 specimens, with molecular COI barcodes. All results are from bycatches from previous projects treating Phlaeothripidae and Aeolothripidae (Wahlberg and Gertsson 2022; Wahlberg 2024). Beside molecular species identification, the COI barcoding sequence can be used to test species concepts with molecular species delimitation methods in combination with morphological examination (Ranasinghe et al. 2022; Emerson 2025). Two species treated here have unclear taxonomic status, Chirothrips ambulans Bagnall, 1832 and Thrips menyanthidis Bagnall, 1923. Chirothrips ambulans was synonymised with Chirothrips manicatus by zur Strassen (1959), but later treated as valid species (zur Strassen 2003). However, in e.g. Mound et al. (2018) it is again treated as synonym of C. manicatus. As described by Mound et al. (2018), Thrips menyanthidis has a likewise unsettled history, synonymised with Thrips fuscipennis Haliday, 1836 by Mound et al. (1976) and later validated by zur Strassen (1982). To clarify these taxonomic issues, we have performed species delimitation tests.
This paper aims to consolidate current knowledge and extend the faunistic understanding by compiling an extensive checklist and providing an identification key tailored to Swedish diversity. We also add additional notes on wetland species based on data collected during the research projects on Swedish thrips spanning 2020–2025, involving all families in the region.
Materials and methods
Specimens were collected from various habitats across Sweden, including agricultural fields, gardens, natural grasslands, forests, and urban areas, during 2020–2025. Sampling methods included sweep-netting, beat-tray sampling, malaise traps, and targeted collection from flowers and foliage. Samples have also been donated throughout the project time from both colleagues and the public. A Thysanoptera workshop in August 2024 at the Tovetorp research station also yielded several findings, including new records for Sweden.
Specimen preparation involved maceration and mounting on microscope slides. Specimens collected by E. Wahlberg for DNA extraction were collected and stored in 80% ethanol, prepared according to the non-destructive protocol described in Wahlberg (2023a) and mounted in Euparal. The DNA extraction was carried out with the KingFisher™ Flex (Thermo Scientific) robot and the Mag-Bind® Blood & Tissue DNA HDQ 96 Kit (Omega Bio-tek), according to the manufacturer’s protocol. The primer pair LCO1490 and HCO2198 (Folmer et al. 1994) was used for targeting the COI barcoding region, both flanked with a 15 bp oligo in the 5’ end to enable subsequent indexing PCR. Amplification was performed with Cytiva Hot Start Mix Ready-To-Go beads and 21 µl H2O, 1 µl of respective primer and 2 µl DNA template. The PCR reaction was run with an initial 95 °C denaturation step (5 min) followed by 38 cycles of 95 °C (30 s), 50 °C (30 s), 72 °C (50 s), finishing with 72 °C (8 min). All PCR products were visualised on a 1% agarose gel and purified using Exonuclease I and FastAP Thermosensitive Alkaline Phosphatase. The indexing PCRs were done in 25 µl reactions, with 0.625 U of Accuprime Pfx DNA Polymerase, 1× AccuPrime reaction mix (Life Technologies, Carlsbad, CA, USA), 0.2 µM of each indexing primer (forward: AATGATACGGCGACCACCGAGATCTACACxxxxxxxxxxACACTCTTTCCCTAC, reverse: CAAGCAGAAG ACGGCATACGAGATxxxxxxxxxxGTGACTGGAGTTCAG) and 2 µL of purified PCR product from the first PCR. Cycling conditions were an initial 95 °C (2 min) followed by 8 cycles of 95 °C (15 s), 55 °C (30 s), 38 °C (1 min). The indexing primer design was based on the Adapterama iTru system (Glenn et al. 2019), but with Illumina’s 10 bp long Nextera indexes.
All the indexed samples were pooled based on gel band intensity after the first PCR, 8 µl from weak bands and 2 µl from strong ones. The amplicon pool was purified using Cytiva Sera-Mag Select and prepared for sequencing with the Oxford Nanopore Technologies (ONT) LSK-114 ligation kit, and sequenced on a MinION R.10.4.1 FlowCell using MinKNOW 24.06.16 for Linux. Basecalling was set to Super-accurate using Dorado 7.6.8. Barcode splitting was done in MinKNOW using a custom made demultiplex file prepared according to ONTs instructions. During this process, adapter sequences and barcode sequences were trimmed.
Amplicon sorter (Vierstraete and Braeckman 2022) was used to cluster amplicons based on similarity in sequence and length and for building consensus sequences. This method sorts all reads de-novo and reference free, and clusters them into similarity groups. For a greater chance of detecting rare variants, the random sampling option was used, and the --maxreads option was set to a bit higher than double the number of reads in the dataset. Each consensus sequence identified by amplicon sorter was validated in ONT’s amplicon workflow in Epi2me (https://github.com/epi2me-labs/wf-amplicon), through Nextflow. (versions: python 3.8.19; fastcat 0.18.6; ezcharts 0.11.2; dominate 2.9.1; numpy 1.24.4; pandas 2.0.3; pysam 0.22.0; si-prefix 1.3.3; seqkit 2.8.2; porechop 0.2.4; samtools 1.19.2; minimap2 2.28-r1209; mosdepth 0.3.7; miniasm 0.3-r179; racon 1.5.0; csvtk 0.27.2; medaka 1.12.0) (Ewels et al. 2020). In this process, the barcode sorted fastq reads were given as input data, and the list of amplicon sorter consensus sequences from the corresponding barcode was passed as reference. In order to investigate the entire read set of each barcode, the options --drop_frac_longest_reads and --reads_downsampling_size were set to 0. Consensus sequences that received more than 5% support, and displayed an even coverage, were further processed. Geneious v. 8.1.6 was used to align the consensus sequences to a reference COI sequence, to determine sequence directionality, and to identify and trim target primer sequences. Each validated variant was exported in fasta format, and finally matched at NCBI Blast (Camacho et al. 2009) and screened for contaminations in NCBI GenBank (Benson et al. 2012). All successfully amplified and sequenced barcodes were uploaded to BOLD and added to the publicly available dataset “Swedish Thysanoptera 2025” (https://doi.org/10.5883/DS-SETHY25) as well as the GenBank sequence database. BOLD and GenBank accession numbers are provided in Suppl. material 1.
Other specimens were collected in AGA (alcohol, glycerine, acetic acid) solution, prepared according to the protocol described in Kobro (2011), and mounted in Canada balm. Additional previously collected material was examined from the collections at The Swedish Museum of Natural History (NHRS) and Lund Museum of Zoology (MZLU), and previous distribution data was collected from Kobro (2011), Gertsson (2015), Gertsson and Fägerström (2017), Gertsson (2019), Gertsson (2021), and Wahlberg et al. (2025). Morphological observations were performed using Nikon Eclipse and Swift microscopes equipped with digital imaging systems. Photographs were captured using focus stacking software (Helicon Focus and Swift Imaging), followed by editing in Adobe Photoshop. All material, physical specimens and DNA extract, is deposited at NHRS or Manfred R. Ulitzkas collection with corresponding voucher IDs/collection numbers.
The species concept of Chirothrips ambulans and Thrips menyanthidis was tested using molecular species delimitation based on the COI barcoding gene sequence. Sequences for available specimens for each species were included, as well as sequences from other species in the same genera. We included sequences from both male and female specimens as well as different geographical locations. The sequences were aligned using MAFFT 7.407 (Katoh and Standley 2013) with auto flavour and standard settings with adjustment of direction. The alignment examined for ambiguous/problematic regions with BMGE 1.12 (Criscuolo and Gribaldo 2010) (sliding window: 3, maximum entropy threshold: 0.5, gap cut of: 0.5, minimum block size: 5). The resulting length of the cleaned alignment was 655 bp. We delimited putative distance-based species with ASAP (Puillandre et al. 2021) with default setting, selecting the best-scoring ASAP partition. For a tree-based delimitation a maximum-likelihood (ML) phylogeny was inferred with IQ-TREE v. 3.0.1 (Nguyen et al. 2015), with ModelFinder model selection (Kalyaanamoorthy et al. 2017), UFBoot2 (1,000 replicates) (Hoang et al. 2018), and SH-like aLRT (1,000 replicates), we applied codon partitioning by position (1^st^/2^nd^/3^rd^) with model merging enabled. We applied mPTP 0.2.4 (Kapli et al. 2017) to the phylogeny under the multi-rate model with maximum-likelihood optimisation (--ml --multi). Support was further assessed using MCMC (5,000,000 steps; logging every 10,000; burn-in 100,000).
Remarks on habitats and feeding preferences were collected from Mound et al. (1976, 2018), Schliephake et al. (1979), zur Strassen (2003), original descriptions, and field observations during collection events. Species names follow the current taxonomy as reflected at ThripsWiki (ThripsWiki 2026).
Swedish faunistic provinces and abbreviations
Sweden is traditionally divided into faunistic provinces based on historical cultural regions, which are widely used in entomological literature (Fig. 1). These provinces serve as standardised and stable geographical references and are abbreviated as follows: Sk = Skåne, Bl = Blekinge, Ha = Halland, Sm = Småland, Öl = Öland, Go = Gotland, GS = Gotska Sandön, Ög = Östergötland, Vg = Västergötland, Bo = Bohuslän, Ds = Dalsland, Nä = Närke, Sö = Södermanland, Up = Uppland, Vs = Västmanland, Vr = Värmland, Dr = Dalarna, Gä = Gästrikland, Hs = Hälsingland, Me = Medelpad, Hr = Härjedalen, Jä = Jämtland, Ån = Ångermanland, Vb = Västerbotten, Nb = Norrbotten, Ås = Åsele lappmark, Ly = Lycksele lappmark, Pi = Pite lappmark, Lu = Lule lappmark, To = Torne lappmark.
Map of Sweden with faunistic provinces. Dashed red line represents the Limes Norrlandicus border.
Characters
The identification of Thripidae species is primarily based on microscopic morphological characters (Fig. 2). Key distinguishing features include the shape, number, and position of antennal segments and associated sense cones; presence or absence of ocellar setae; structure and length of wings, wing fringes, and wing veins and setae; presence and arrangement of setae on the pronotum and on the abdominal segments (Fig. 2A). Morphological variations among species and within species at different life stages or populations require careful examination under high magnification.
Morphological characters. A. Habitus of Thrips fuscipennis, female, dorsal view; B. Terminal segments of Thrips menyanthidis, female, lateral view; C. Habitus of Chirothrips hamatus, male, dorsal view (except for abdominal segments III–VII, which are shown in ventral view). Roman numbers indicate abdominal and antennal segment numbers.
Results
Taxonomy
Thripidae
Taxon classificationAnimaliaThysanopteraThripidae
Family
Stephens, 1829
4B888140-368A-5D03-B327-D74D4A3BFBF8
Diagnosis.
The family Thripidae can generally be identified by a slender body, the presence of fringed wings, a distinct conical antennal segments often bearing sensory cones, and a saw-like and downwardly turned ovipositor in females (Fig. 2B). Males possess more or less sclerotised genitalia (e.g., phallus, endotheca, and aedeagus), and sometimes pheromone-producing glandular areas on abdominal sternites called pore plates (Fig. 2C). Adult Thripidae typically display narrow wings with marginal fringes, distinctive wing veins, and antennae that frequently exceed the body width.
Notes.
Globally, the family Thripidae encompasses more than 2,000 described species (Mound et al. 2018), many known as significant agricultural pests, capable of transmitting plant viruses and causing direct feeding damage. Sweden hosts a subset of this diverse family, with numerous species adapted to the colder, northern climate. Thripidae species in Sweden exhibit diverse ecological niches, ranging from specialists found in floral habitats to more generalised species inhabiting agricultural and forest environments.
Key to the subfamilies and species of Thripidae from Sweden
**: **
Dendrothripinae
**: **
Panchaetothripinae
**: **
Sericothripinae
**: **
Thripinae
**: **
Checklist
This checklist comprehensively lists all known Swedish Thripidae species (including stable and reproducing or more limited and sporadic), with new national and regional records, providing details on their provincial distribution. The examined material is presented for new records, both national and provincial.
Dendrothripinae. A. Dendrothrips degeeri, mesothoracic furca; B. Dendrothrips degeeri, female, habitus; C. Dendrothrips ornatus, female, in vivo.
A–D. Panchaetothripinae; A. Parthenothrips dracaenae, female, head, pronotum and wing; B. Hercinothrips femoralis, wings; C. H. femoralis, antenna; D. Heliothrips haemorrhoidalis, wings; E–G. Sericothripinae; E. Neohydatothrips gracilicornis, abdominal tergites; F. Sericothrips bicornis, meso- and metanotum; G. S. staphylinus, meso- and metanotum.
A–D. Mycterothrips salicis; A. Abdominal tergites with microtrichia on lateral sculpture lines; B. Forewing, head and thorax (ventral side); C. Mouthparts; D–F. Head; D. M. salicis; E. M. latus; F. M. consociatus; G. M. latus, meso- and metathoracic furca; H. Scolothrips uzeli, habitus; I–K. Kakothrips priesnerorum; I. Abdominal tergite VIII; J. Head, s1 anteocellar seta 1; K. Foretarsus; L. K. pisivorus, foretarus; M, N. Frankliniella tenuicornis; M. Metanotum; N. Head; O. F. intonsa, head; P, Q. F. pallida; P. Metanotum; Q. Head. R. F. occidentalis, head, s4 postocular seta 4. Abbreviations: sc = campaniform sensilla.
A–E. Baliothrips kroli; A. Tergite VIII; B. Head; C. Midtibia and -tarsus; D. Abdominal sternites I–II; E. Prosternum; F–K. Thrips vulgatissimus; F. Midtibia- and tarsus; G. Abdominal sternites II and III; H. Prosternum; I. Pleurotergite; J. Antenna; K. Forewing; L–N. T. atratus; L. Antenna; M. Forewing; N. Female abdominal tergite VIII.
A–C. Thrips pillichi; A. Antenna; B. Abdominal tergite II; C. Abdominal sternite VII; D. T. minutissimus, abdominal sternite VII; E. T. linariae, abdominal tergite VIII; F. T. pini, abdominal tergite II; G, H. T. origani; G. Pleurotergite; H. Female abdominal tergites VIII–X; I, J. T. calcaratus; I. Fore tarsus; J. Metanotum; K–M. T. trehernei; K. Metanotum; L. Female abdominal tergites IX–X; M. Pronotum; N, O. T. flavus; N. Male abdominal sternites III–VIII; O. Head; P, Q. T. nigropilosus; P. Head; Q. Abdominal tergite II; R. T. alni, abdominal tergite V; S, T. T. dilatatus; S. Antenna; T. Female abdominal tergites VIII–IX; U. T. major, pronotum; V, W. T. menyanthidis; V. Pleurotergites; W. Forewing; X. T. juniperinus, abdominal sternite I. Abbreviations: cs = campaniform sensilla, ios = interocellar seta, pa = posteroangular seta, s1 = median seta, s2 = setae 2, s3 = setae 3.
A. T. roepkei, forewing; B. T. menyanthidis, head and partial antenna; C. T. fuscipennis, head and partial antenna; D. Bolacothrips jordani, apterous female, habitus; E, F. Odontothrips confusus; E. Head; F. Foretibia and -tarsus; G, H. O. loti; G. Foretibia and -tarsus; H. Apical antennal segments; I. O. phaleratus, antenna; J. O. biuncus, foretibia and -tarsus; K, L. Firmothrips firmus; K. Abdominal tergite VII; L. Micropterous female, habitus; M, N. Chirothrips manicatus; M. Abdominal tergite VII; N. Antenna; O. C. ambulans, abdominal tergite VII; P. Rhaphidothrips longistylosus, head and antennae; Q. Ctenothrips distinctus, meso- and metanotum; R. Chaetanaphothrips orchidii, forewing. Abbreviations: as = anterocellar setae, cs = campaniform sensilla, ps1 = postocular seta 1, sc = sense cone on segment VI.
A. Tmetothrips subapterus, female, habitus; B. Taeniothrips inconsequens, foretarsus; C, D. Limothrips denticornis; C. Mouthparts; D. Antenna; E–G. L. cerealium; E. Antenna; F. Foretarsus; G. Female abdominal tergites VIII–X; H–J. L. consimilis; H. Antenna; I. Foretarsus; J. Female abdominal tergite IX; K. Oxythrips ajugae, foretarsus; L. O. bicolor, sternite V; M. Belothrips morio, female habitus; N. B. acuminatus, antenna; O–Q. Aptinothrips rufus; O. Male habitus; P. Antenna; Q. Abdominal sternite V.
A, B. Belothrips validus. Antennal segment IV; B. Abdominal tergite IV; C. B. ferrugineus, abdominal tergite IV; D. B. validus, metanotum; E, F. A. badius; E. Forewing clavus; F. Female habitus. Abbreviations: cs = campaniform sensilla, s1 = seta 1, sc = sense cone.
Subfamily Dendrothripinae Priesner, 1925
Dendrothrips degeeri Uzel, 1895
Distribution. Palearctic. Nordic distribution: Sweden, Norway, Finland. Swedish distribution: Sk, Öl, Sm, Go, Ds, Sö, Up.
Remarks. Feeding and breeding on leaves of various deciduous trees and herbaceous plants.
Dendrothrips ornatus (Jablonowski, 1894)
Distribution. Palearctic, introduced in Nearctic. Nordic distribution: Sweden, Norway, Finland. Swedish distribution: Sö.
Remarks. First record for Sö, previous records not specified. Living on the leaves of Fraxinus, Ligustrum, Syringa, as well as Alnus, Corylus, and Tilia, here collected on Tilia cordata (Malvaceae).
Material examined. Sweden • 5♀♀; Sö, Nyköpings kommun, Tovetorp research station, 58.94788°N, 17.14470°E, on Tilia cordata; 2024.viii.28; E. Wahlberg leg.; voucher IDs: DA2T, DA8T, DA9T, DB1T, DE7T.
Dendrothrips saltator Uzel, 1895
Distribution. Palearctic. Nordic distribution: Sweden, Norway, Finland. Swedish distribution: Sk, Ds, Vr.
Remarks. First record for Sk. Feeding and breeding on a wide range of herbaceous plants and trees, both coniferous and deciduous.
Material examined. Sweden • 1♀; Sk, Lunds kommun, Botaniska trädgården, 55.705833°N, 13.204167°E, on Origanum vulgare, 2025.viii.21, leg. C.-A. Gertsson.
Leucothrips nigripennis Reuter, 1904
Distribution. Nearctic, but introduced worldwide, in temperate regions indoors and in greenhouses. Nordic distribution: Sweden, Denmark, and Finland. Swedish distribution: sporadically indoors/in greenhouses.
Remarks. Feeding and breeding on different species of ferns.
Subfamily Panchaetothripinae Bagnall, 1912
Heliothrips haemorrhoidalis (Bouché, 1833)
Distribution. Neotropical, but introduced worldwide in tropical areas, in temperate areas in greenhouses and indoors. Nordic distribution: Sweden, Norway, Denmark, Finland. Swedish distribution: Sk, Sm, Sö. Up.
Remarks. Feeding and breeding on both coniferous and deciduous trees and herbaceous plants, often in water-stressed environments.
Hercinothrips femoralis (O. M. Reuter, 1891)
Distribution. Afrotropical, but introduced worldwide in tropical and sub-tropical areas, in temperate areas in greenhouses and indoors. Nordic distribution: Sweden, Norway, Denmark, Finland. Swedish distribution: Sk, Up, Vb.
Remarks. Breeding and feeding on leaves of different herbaceous plants.
Parthenothrips dracaenae (Heeger, 1854)
Distribution. Afrotropical, but introduced worldwide in tropical and sub-tropical regions, in temperate areas mainly in greenhouses, but has been collected outdoors in Norway (Kobro and Ultizka 2021). Nordic distribution: Sweden, Norway, Denmark, Finland, Iceland. Swedish distribution: Sk, Sm, Bo, Up, Vr.
Remarks. Feeding and breeding on, in majority, hard-leaved plants.
Subfamily Sericothripinae Karny, 1921
Neohydatothrips gracilicornis (Williams, 1916)
Distribution. Palearctic. Nordic distribution: Sweden, Norway, Finland. Swedish distribution: Sk, Öl, Go, Ög, Vg, Vr, Sö, Up, Gä, Me, Hr, Vb, To.
Remarks. First records for Up, Gä, and Me. Preferably in warmer places. This species is mainly found on Vicia sp., particularly on Vicia cracca; occasionally also on leaves of deciduous trees.
Material examined. Sweden • 1♂; Up, Uppsala kommun, Lågbol, 60.034883°N, 18.420316°E, on Calamagrostis; 2021.vii.19; E. Wahlberg leg.; voucher ID: AP4T. • 2♀♀; Gä, Gävle kommun, Östra Sikvik, 60.66559°N, 17.29876°E, mixed herbaceous vegetation; 2023.vi.20; E. Wahlberg leg.; voucher IDs: DL1T, DL2T. • 2♀♀; Me, Timrå kommun, Indalsälvens delta, 62.508667°N, 17.448164°E, mixed herbaceous vegetation; 2023.vi.14; E. Wahlberg leg.; voucher IDs: DJ5T, DJ6T.
Sericothrips bicornis (Karny, 1910)
Distribution. Palearctic. Nordic distribution: Sweden, Denmark, Finland. Swedish distribution: Sk, Öl, Sö, Up, Ly.
Remarks. Feeding and breeding on leaves of Fabaceae, mainly on creeping species like Lotus corniculatus and Trifolium repens.
Sericothrips staphylinus Haliday, 1836
Distribution. Palearctic, introduced in other parts of the world as biological control agent. Nordic distribution: Sweden, Denmark. Swedish distribution: Sm, Öl, Ög, Bo, Sö, Up, Hälsningland.
Remarks. Feeding and breeding on leaves of Ulex.
Subfamily Thripinae Stevens, 1829
Anaphothrips badius (Williams, 1913)
Distribution. Palearctic. Nordic distribution: Sweden, Norway, Denmark. Swedish distribution: Sk, Sm, Go, Sö, Up, Vr.
Remarks. First records for Sk, Sm, and Sö. Feeding and breeding on leaves of Poaceae and Cyperaceae, here also collected on Rubus (Rosaceae). Prefers wet meadows and other damp areas.
Material examined. Sweden • 2♀♀; Sk., Kristianstads kommun, Gropahålet, Helge river mouth, 55.859063°N, 14.235729°E, on Carex acuta, 2024.v.05; E. Wahlberg leg.; voucher IDs: FF1T, FF2T • 1♀; Sk., Kristianstads kommun, Gropahålet, Helge river mouth, 55.859063°N, 14.235729°E, on Leymus arenarius, 2024.v.05; E. Wahlberg leg.; voucher ID: FE3T • 1♀; Sk., Kristianstads kommun, Lyngsjö nature reserve, 55.932709°N, 14.067986°E, wetland, 2024.v.21; E. Wahlberg leg.; voucher ID: FG6T • 2♀♀; Sm., Västerviks kommun, Hallmare, 57.870555°N, 16.756545°E, on Phragmites australis, 2024.v.05; E. Wahlberg leg.; voucher IDs: ES7T, ES8T. • 1♀; Sm., Västerviks kommun, Hallmare, beach, 57.863499°N, 16.760644°E, on Bolboschoenus maritimus, 2024.v.05; E. Wahlberg leg.; voucher ID: EA6T. • 1♀; SE, Sm., Västerviks kommun, Risebo nature reserve, pond edge, 58.031361°N, 16.106291°E, 2024.v.28; E. Wahlberg. leg; voucher ID: EZ9T. • 1♂; Sö, Nyköpings kommun, Tovetorp research station, 58.9476°N, 17.1467°E, on Rubus idaeus; 2024.viii.27; E. Nein leg.; voucher ID: DA7T.
Anaphothrips obscurus (O.F. Müller, 1776)
Distribution. Global in temperate regions. Nordic distribution: Sweden, Norway, Denmark, Finland. Swedish distribution: Sk, Bl, Sm, Go, Ög, Vg, Bo, Sö, Up, Vs, Vr, Dr, Me.
Remarks. First records for Bl and Me. Feeding and breeding on leaves of Poaceae.
Material examined. Sweden • 4♀♀; Bl, Karlskrona kommun, Knösö, 56.165360°N, 15.666374°E, on Phragmites; 2023.v.30; E. Wahlberg leg.; voucher IDs: CV2T, CV4T, CV5T, CV6T. • 4♀♀; Bl, Karlskrona kommun, Augerum, 56.217489°N, 15.673053°E, on Poaceae; 2023.v.30; E. Wahlberg leg.; voucher IDs: CX4T, CX5T, CX6T, CX8T. • 3♀♀; Me, Timrå kommun, Indalsälvens delta, 62.508667°N, 17.448164°E, in mixed herbaceous vegetation; 2023.vi.14; E. Wahlberg, leg.; voucher IDs: DJ4T, CC4T, CC5T.
Apterothrips secticornis (Trybom, 1896)
Distribution. Holarctic. Nordic distribution: Sweden, Norway, Finland, Iceland. Swedish distribution: Hr, Jä, Ly.
Remarks. Feeding and breeding on leaves of Poaceae and Cyperaceae.
Aptinothrips elegans Priesner, 1924
Distribution. Palearctic. Nordic distribution: Sweden, Norway, Denmark, Finland. Swedish distribution: Sö.
Remarks. Feeding and breeding on leaves of Poaceae.
Aptinothrips rufus Haliday, 1836
Distribution. Global in temperate regions. Nordic distribution: Sweden, Norway, Denmark, Finland, Iceland. Swedish distribution: Sk, Ha, Sm, Öl, Bo, Sö, Up, Dr, Nb.
Remarks. Feeding and breeding on leaves of Poaceae.
Aptinothrips stylifer Trybom, 1894
Distribution. Global. Nordic distribution: Sweden, Norway, Denmark, Finland, Iceland. Swedish distribution: Sk, Bl, Sm, Sö, Up, Vs, Vr, Hr, Jä, To.
Remarks. First record for Bl. Feeding and breeding on leaves of Poaceae.
Material examined. Sweden • 1♀; Bl, Karlskrona kommun, Knösö, 56.165360°N, 15.666374°E, on Phragmites; 2023.v.30; E. Wahlberg leg.; voucher ID: CV3T.
Aurantothrips orchidaceus (Bagnall, 1909)
Distribution. Neotropical, introduced in greenhouses worldwide on cultivated orchids. Nordic distribution: Sweden, Norway, Denmark (only indoors/in greenhouses). Swedish distribution: sporadically indoors/in greenhouses.
Remarks. Feeding and breeding on leaves of Orchidaceae.
Baliothrips dispar (Haliday, 1836)
Distribution. Holarctic. Nordic distribution: Sweden, Norway, Denmark, Finland. Swedish distribution: Vr, Dr, Jä, Vb, Ly.
Remarks. First records for Dr and Vb. Living in damp areas and feeding and breeding on leaves of Poaceae, Cyperaceae and Typha spp. (Typhaceae).
Material examined. Sweden • 2♀♀; Dr, Orsa kommun, Koppången nature reserve, wet land, 61.362499°N, 14.786772°E, on Prunella vulgaris, 2024.vii.30,; E. Wahlberg, leg.; voucher IDs: EF2T, EF3T. • 3♀♀; Vb, Skellefteå kommun, Nilsliden, 64.944032°N, 20.367689°E, mixed herbaceous vegetation; 2023.vi.18; E. Wahlberg, leg.; voucher IDs: CF5T, CG1T, CE8T.
Baliothrips kroli (Schille, 1911)
Distribution. Palearctic. Nordic distribution: Sweden, Norway, Denmark, Finland. Swedish distribution: Sk, Sm, Sö, Up.
Remarks. First record for Sö. Living in damp areas and feeding and breeding on leaves of Poaceae and Cyperaceae. Here also collected on Sagittaria sagittifolia (Alismataceae).
Material examined. Sweden • 2♀♀; Sö., Flens kommun, Sparreholm, beach, 59.086913°N, 16.829442°E, on Carex acuta, 2024.vii.29; E. Wahlberg, leg.; voucher IDs: EFE5, EFE6. • 1♀♀; Sö., Flens kommun, Sparreholms ekhagar, beach, 59.082452°N, 16.842549°E, on flowering Sagittaria sagittifolia, 2024.vii.25; E. Wahlberg, leg.; voucher IDs: EFJ7.
Belothrips acuminatus Haliday, 1836
Distribution. Palearctic. Nordic distribution: Sweden, Norway, Denmark, Finland. Swedish distribution: Sk, Go, Sm, Öl, Ög, Sö, Up.
Remarks. Feeding and breeding on mainly Galium, but also found on other plants.
Belothrips ferrugineus (Uzel, 1895)
Distribution. Palearctic. Nordic distribution: Sweden, Finland. Swedish distribution: Sö, Vr.
Remarks. First record for Sö. Feeding and breeding on Rubiaceae, here also collected on Juncus (Cyperaceae).
Material examined. Sweden • 1♀; Sö, Flens kommun, Sparreholms ekhagar nature reserve, 59.086217°N, 16.830228°E, at lake side on Juncus; 2023.vi.07; E. Wahlberg leg.; voucher ID: CT4T.
Belothrips morio O. M. Reuter, 1899
Distribution. Palearctic. Nordic distribution: Sweden, Finland. Swedish distribution: Sk, Sö, Up, Vr, Vb.
Remarks. First records for Sk and Vb. In flowers of many different plants, herbaceous and coniferous.
Material examined. Sweden • 1♀ Sk., Kristianstads kommun, Lyngsjö nature reserve, 55.932709°N, 14.067986°E, marsh with Plantago, Carex, Dactylorhiza and Ranunculus, 2024.v.21; E. Wahlberg leg.; voucher ID: FG2T. • 2♀♀; Vb, Umeå kommun, Holmsund, 63.70613°N, 20.35276°E, on Fabaceae; 2023.vi.18; E. Wahlberg leg.; voucher IDs: DI2T, DI4T.
Belothrips silvarum (Priesner, 1920)
Distribution. Palearctic. Nordic distribution: Sweden, Norway, Denmark, Finland. Swedish distribution: Sk.
Remarks. Feeding and breeding on Rubiaceae, particularly Galium verum.
Belothrips sordidus (Uzel, 1895)
Distribution. Palearctic. Nordic distribution: Sweden. Swedish distribution: Sö.
Remarks. First record for Sweden. Living and breeding on bedstraw (Galium, Rubiaceae), particularly on Galium mollugo and G. lucidum.
Material examined. Sweden • 1♀; Sö, Nyköpings kommun, Tovetorp research station, Skrivhuset 1, 58.94753°N, 17.14682°E, from Achnatherum sp. (Poaceae); 2024.viii.30; M. Ulitzka leg.; collection number: MU-S-11/1.
Belothrips validus (Karny, 1910)
Distribution. Palearctic. Nordic distribution: Sweden. Swedish distribution: Sk, Sö, Vr.
Remarks. First record for Sk. Feeding and breeding on Galium spp. (Rubiaceae).
Material examined. Sweden • 4♀♀; Sk., Kristianstads kommun, Åhus, Helge river mouth, 55.925326°N, 14.323345°E, mixed herbaceous vegetation; 2024.v.20; E. Wahlberg leg.; voucher IDs: FB8T, FC1T, FC2T, FC3T.
Bolacothrips jordani (Uzel, 1895)
Distribution. Palearctic. Nordic distribution: Norway, Finland, Denmark, Sweden. Swedish distribution: Sö.
Remarks. First record for Sweden. Found on grasses (Poaceae).
Material examined. Sweden • 7♀♀; Sö, Nyköpings kommun, Tovetorp research station, Skrivhuset 1, 58.94753°N, 17.14682°E, from Achnatherum sp. (Poaceae); 2024.viii.30; M. Ulitzka leg.; collection numbers: MU-S-10/1–7 and 2 females (apterous form) MU-S-11/5 & 6.
Bradinothrips musae (Hood, 1956)
Distribution. Nearctic. Nordic distribution: Sweden. Swedish distribution: only sporadically indoors/in greenhouses
Remarks. Breeding on leaves and feeding on fruit of Musa.
Ceratothrips ericae (Haliday, 1836)
Distribution. Palearctic. Nordic distribution: Sweden, Norway, Denmark, Finland, Iceland. Swedish distribution: Sk, Ha, Sm, Öl, Go, Ds, Vr, Sö, Up, Dr, Me, Vb, Ås, Pi, To.
Remarks. First records for Ås and Pi. Feeding and breeding on flowers of Ericaceae, here also collected on Astragalus (Fabaceae).
Material examined. Sweden • 1♀; Ås, Dorotea kommun, Västra Ormsjö, 64.467878°N, 15.951629°E, on Astragalus alpinus; 2023.vi.16; E. Wahlberg leg.; voucher ID: BU7T. • 4♀♀; Pi, Arjeplogs kommun, Mattureälven-Båldakatj, 66.297221°N, 18.327394°E, on Calluna vulgaris; 2023.vi.17; E. Wahlberg leg.; voucher IDs: CJ2T, CJ3T, CJ7T, CJ8T.
Chaetanaphothrips orchidii (Moulton, 1907)
Distribution. Widespread in tropical regions. Nordic distribution: Sweden, Norway, Denmark, Finland (only indoors/in greenhouses). Swedish distribution: sporadically indoors/in greenhouses.
Remarks. Feeding and breeding on leaves of different plants.
Chirothrips ambulans Bagnall, 1932
Distribution. Palearctic. Nordic distribution: Sweden, Finland. Swedish distribution: Me, Sö.
Remarks. First record for Sweden. Feeding and breeding on Poaceae, here also collected on Juncus (Juncaceae). Species delimitation using distance, ASAP (Fig. 11), support the validity of C. ambulans. Even though the tree-based species delimitation shows some ambiguity for Chirothrips regarding specimens within C. manicatus, it does also support C. ambulans (Fig. 12). It is also morphologically distinct from C. manicatus with tergite VII campaniform sensilla situated anterior to subbasal line as also used in zur Strassen (2003).
Species delimitation using distance, ASAP, of Chirothrips. Partition with best fit is outlined with red (distance: 0.0404, p-value: 1.602413e-01, ASAP score: 1.000000, rank: 1).
Tree-based species delimitation with mPTP of Chirothrips.
Material examined. Sweden • 1♀; Me, Timrå kommun, Indalsälvens delta, 62.508667°N, 17.448164°E, in mixed herbaceous vegetation; 2023.vi.14; E. Wahlberg, leg.; voucher IDs: DI7T. • 2♂♂; Sö, Nyköpings kommun, Tovetorp research station, 58.94773°N, 17.14238°E, on Juncus; 2024.viii.27; E. Wahlberg leg.; voucher IDs: DE5T, DE6T.
Chirothrips hamatus Trybom, 1895
Distribution. Holarctic. Nordic distribution: Sweden, Norway, Denmark, Finland. Swedish distribution: Sk, Sm, Go, Ög, Bo, Sö, Up, Vr, Jä, Ån, Ly.
Remarks. First records for Sm, Sö, Jä, Ån, and Ly. Feeding and breeding on Poaceae, pest on different grasses that affect seed viability. Prefers humid habitats.
Material examined. Sweden • 1♀; Sm, Västerviks kommun, Tindered, 57.9766°N, 16.4839°E, mixed herbaceous vegetation; 2024.vi.30; E. Wahlberg leg.; voucher ID: DX1T. • 1♀; Sö., Flens kommun, Sparreholm, beach, 59.086913°N, 16.829442°E, on Phragmites australis, 2024.vii.29; E. Wahlberg leg.; voucher ID: EY1T. • 7♀♀; Jä, Strömsunds kommun, Sävselet, 63.538795°N, 15.444725°E, mixed herbaceous vegetation; 2023.vi.15; E. Wahlberg leg.; voucher IDs: BY2T, BY5T, BY6T, BY7T, BY8T, BZ1T, BZ3T. • 1♀; Jä, Ragunda kommun, Krångede, 63.146760°N, 16.057726°E, roadside with herbaceous vegetation; 2023.vi.15; E. Wahlberg leg.; voucher ID: CC1T. • 5♀♀; Ån, Nordmalings kommun, Torrböle, 63.700503°N, 19.604039°E, mixed herbaceous vegetation; 2023.vi.19; E. Wahlberg leg.; CY5T, CY6T, CZ1T, CZ4T, CZ9T. • 5♀♀; Ly, Sorsele kommun, Saxnäs, 65.455847°N, 17.572265°E, mixed herbaceous vegetation; 2023.vi.16; E. Wahlberg leg.; voucher IDs: CJ9T, CK1T, CK2T, CK3T, CK4T, CK5T, CK6T.
Chirothrips manicatus Haliday, 1836
Distribution. Holarctic, introduced in Australasia. Nordic distribution: Sweden, Norway, Denmark, Finland. Swedish distribution: Sk, Bl, Ha, Sm, Öl, Go, Ög, Vg, Bo, Sö, Up, Vr, Dr, Hs, Me, Jä, Vb, Ås, Ly, Pi, Lu.
Remarks. First records for Bl, Vg, Up, Me, Jä, Ås, Ly, and Pi. Feeding and breeding on Poaceae, pest on different grasses that affect seed viability. Here also collected on Barbarea vulgaris (Brassicaceae), Anchusa officinalis (Boraginaceae) and Astragalus alpinus (Fabaceae).
Material examined. Sweden • 10♀♀; Bl, Karlskrona kommun, Knösö, 56.167848°N, 15.664502°E, on Poaceae; 2023.v.18; E. Wahlberg leg.; voucher IDs: CV9T, CW1T, CW2T, CW3T, CW4T, CW5T, CW6T, CW7T, CW8T, CW9T. • 4♀♀; Bl, Karlskrona kommun, Sandhamn, 56.090980°N, 15.856533°E, mixed herbaceous vegetation; 2023.v.31 E. Wahlberg leg.; voucher IDs: CQ1T, CQ2T, CQ5T, CQ6T. • 2♀♀; Bl, Karlskrona kommun, Torhamn, 56.092591°N, 15.853811°E; on Barbarea vulgaris; 2023.v.31; E. Wahlberg leg.; voucher IDs: CO7T, CP5T. • 6♀♀; Bl, Olofströms kommun, Kräftemåla, 56.395876°N, 14.664588°E, grazed meadow; 2023.v.31; E. Wahlberg; voucher IDs: CR7T, CR8T, CR9T, CS1T, CS2T, CS5T. • 5♀♀; Bl, Karlskrona kommun, Augerum, 56.217489°N, 15.673053°E, on Poaceae; 2023.v.30; E. Wahlberg leg.; voucher IDs: CX1T, CX2T, CX3T, CY1T, CY2T. • 1♀; Bl, Karlskrona kommun, Augerum, 56.216929°N, 15.676876°E, on Anchusa officinalis; 2023.vi.01; E. Wahlberg leg.; voucher ID: CM8T. • 1♀; Vg, Tjörns kommun, Tolleby, 57.97712°N, 11.60566°E, mixed herbaceous vegetation; 2022.vi.11; E. Wahlberg leg.; voucher ID: DJ8T. • 1♀; Up, Uppsala kommun, Lågbol, 60.034883°N, 18.420316°E, on Calamagrostis; 2021.vii.19;. E. Wahlberg leg.; voucher ID: AP3T. • 1♀; SE, Me., Timrå kommun, Indalsälvens delta, 62.508667°N, 17.448164°E, mixed herbaceous vegetation; 2023.vi.14; E. Wahlberg leg.; voucher ID: DI8T. • 3♀♀; Jä, Ragunda kommun, Boberg, 63.359057°N, 15.717947°E, on Astragalus alpinus; 2023.vi.15; E. Wahlberg leg.; voucher IDs: BX2T, BX3T, BX8T. • 3♀♀; Jä, Ragunda kommun, Krångede, 63.146760°N, 16.057726°E, roadside with herbaceous vegetation; 2023.vi.15; E. Wahlberg leg.; voucher IDs: CB5T, CB8T, CC2T. • 1♀; Ås, Dorotea kommun, Häggås, 64.402187°N, 16.434090°E, mixed herbaceous vegetation; 2023.vi.16; leg. E. Wahlberg leg.; voucher ID: BV9T. • 4♀♀; Ås, Dorotea kommun, Västra Ormsjö, 64.467878°N, 15.951629°E, on Astragalus alpinus; 2023.vi.16; E. Wahlberg leg.; voucher IDs: BV1T, BV2T, BV3T, BV5T. • 4♀♀; Ly, Storuman kommun, Stensele, 65.100466°N, 17.167255°E, mixed herbaceous vegetation; 2023.vi.16; E. Wahlberg leg.; voucher IDs: CK7T, CK8T, CK9T, CL1T. • 4♀♀; Pi, Arjeplogs kommun, Arjeplog, 66.040783°N, 17.868661°E, on Astragalus alpinus; 2023.vi.18; E. Wahlberg leg.; CL3T, CL4T, CL5T, CL6T.
Ctenothrips distinctus (Uzel, 1895)
Distribution. Palearctic. Nordic distribution: Sweden, Norway, Denmak, Finland. Swedish distribution: Sk, Sö, Up.
Remarks. Feeding and breeding on Convallaria majalis.
Dictyothrips betae Uzel, 1895
Distribution. Palearctic. Nordic distribution: Sweden, Norway, Denmark, Finland. Swedish distribution: Sk.
Remarks. Feeding and breeding on different herbaceous plants.
Drepanothrips reuteri Uzel, 1895
Distribution. Palearctic, introduced in the Neotropics. Nordic distribution: Sweden, Norway, Denmark, Finland. Swedish distribution: Vr.
Remarks. Feeding and breeding on leaves of different plants and trees, pest on Vitis vinifera.
Echinothrips americanus Morgan, 1913
Distribution. Nearctic, introduced worldwide. In temperate areas indoors and greenhouses. Nordic distribution: Sweden, Norway, Finland (only indoors/in greenhouses). Swedish distribution: sporadically indoors/in greenhouses.
Remarks. Feeding and breeding on leaves of many different plants.
Firmothrips firmus (Uzel, 1895)
Distribution. Palearctic. Nordic distribution: Sweden, Norway, Finland. Swedish distribution: Sk, Vr, Ån, Vb.
Remarks. First record for Ån and Vb. Feeding and breeding on Fabaceae, here also collected on meadow inflorescence and Achillea millefolium (Asteraceae).
Material examined. Sweden • 1♀; Ån, Kramfors kommun, Västhammar, 63.03017°N, 17.77373°E, mixed herbaceous vegetation; 2023.vi.19; E. Wahlberg leg.; voucher ID: DM1T. • 1♀; Ån., Nordmalings kommun, Torrböle, 63.700503°N, 19.604039°E, mixed herbaceous vegetation; 2023.vi.19; E. Wahlberg leg.; voucher ID: CZ7T. • 9♀♀; Vb, Robertsfors kommun, Rickleå, 64.101214°N, 20.929401°E, meadow with mixed flowering vegetation; 2023.vi.18; E. Wahlberg leg.; voucher IDs: CH8T, CI3T, CI5T, DQ9T, DR1T, DR2T, DR3T, DR5T, DF8T. • 2♀♀; Vb, Robertsfors kommun, Rickleå, 64.101214°N, 20.929401°E, on Achillea millefolium, 2023.vi.18; E. Wahlberg leg.; voucher IDs: CG3T, CG4T.
Frankliniella intonsa (Trybom, 1895)
Distribution. Palearctic but introduced worldwide. Nordic distribution: Sweden, Norway, Finland, Denmark. Swedish distribution: Sk, Bl, Ha, Sm, Öl, Go, Ög, Sö, Up, Vs, Vr, Dr, Gä, Me, Ån, Vb.
Remarks. First records for Bl, Ha, Gä, Me, and Ån. Breeding and feeding on leaves and in flowers of many different plants.
Material examined. Sweden • 8♀♀; Bl, Karlskrona kommun, Augerum, 56.216929°N, 15.676876°E, on Anchusa officinalis; 2023.vi.01; E. Wahlberg leg.; voucher IDs: CM2T, CM7T, CN3T, CN4T, CN5T, CN6T, CO3T, CP1T. • 1♀; Ha, Halmstad kommun, Särdal, beach meadow; 56.73382°N, 12.64278°E; 2021.v.19; E. Wahlberg leg.; voucher ID: AI1T. • 1♀; Gä, Gävle kommun, Östra Sikvik, 60.66559°N, 17.29876°E, mixed herbaceous vegetation; 2023.vi.20; E. Wahlberg leg.; voucher ID: DL5T. • 2♀♀; Me, Timrå kommun, Indalsälvens delta, 62.508667°N, 17.448164°E, mixed herbaceous vegetation; 2023.vi.14; E. Wahlberg leg.; voucher IDs: DJ1T, DJ2T. • 1♀; Ån, Kramfors kommun, Västhammar, 63.03017°N, 17.77373°E, mixed herbaceous vegetation; 2023.vi.19; E. Wahlberg leg.; voucher ID: DM3T. • 1♀; Ån, Nordmalings kommun, Torrböle, 63.700503°N, 19.604039°E, mixed herbaceous vegetation; 2023.vi.19; E. Wahlberg leg., voucher ID: CZ6T.
Frankliniella occidentalis (Pergande, 1895)
Distribution. Nearctic, but introduced worldwide. In temperate areas indoors and greenhouses. Nordic distribution: Sweden, Norway, Denmark, Finland (only indoors/in greenhouses). Swedish distribution: Sk.
Remarks. Breeding and feeding on leaves, flowers, and buds of many different plants.
Frankliniella pallida (Uzel, 1895)
Distribution. Palearctic. Nordic distribution: Sweden, Norway, Denmark, Finland. Swedish distribution: Sk, Sm, Up, Vs, Hs.
Remarks. Feeding and breeding on leaves and flowers of many different plants. This species prefers warmer and drier habitats.
Frankliniella tenuicornis (Uzel, 1895)
Distribution. Holarctic. Nordic distribution: Sweden, Norway, Denmark, Finland. Swedish distribution: Sk, Sm, Öl, Go, Ög, Bo, Ds, Sö, Up, Vr, Hr, Vb, Nb, Ly.
Remarks. Feeding on a variety of plants, breeding on Poaceae.
Iridothrips iridis (Watson, 1924)
Distribution. Palearctic, introduced in the Nearctic. Nordic distribution: Sweden, Norway, Denmark, Finland. Swedish distribution: Sk, Sö.
Remarks. New record for Sö. Feeding and breeding on leaves of Iris pseudacorus. This species prefers humid habitats.
Material examined. Sweden • 2♀♀3♂♂; Sö., Gnesta kommun, Björnlunda, 59.06726°N, 17.15507°E, on Iris pseudacorus; 2024.vi.03; E. Wahlberg leg.; voucher IDs: EFB5, EFB6, EFB2, EFB3, EFB4. • 2♀♀; Sö., Nyköpings kommun, Torpesta kvarn, 58.931712°N, 17.177325°E, on Iris pseudacorus; 2024.viii.07; E. Wahlberg leg.; voucher IDs: EM5T, EM7T.
Kakothrips pisivorus (Westwood, 1880)
Distribution. Palearctic. Nordic distribution: Sweden, Norway, Denmark, Finland. Swedish distribution: Sk, Ög, Bo, Sö, Up, Hs.
Remarks. Feeding and breeding on different species of Fabaceae.
Kakothrips priesnerorum Bournier, 1971
Distribution. Palearctic. Nordic distribution: Sweden. Swedish distribution: Vb.
Remarks. First record for Sweden. Feeding and breeding in flowers of herbaceous plants.
Material examined. Sweden • 1♀; Vb, Robertsfors kommun, Rickleå, 64.101214°N, 20.929401°E, meadow with mixed flowering herbaceous vegetation; 2023.vi.18; E. Wahlberg leg.; voucher ID: CH6T.
Limothrips angulicornis Jablonowski, 1894
Distribution. Palearctic, introduced worldwide. Nordic distribution: Sweden, Finland. Swedish distribution: Up.
Remarks. Feeding and breeding on leaves of Poaceae, but also occurring on other herbaceous plants and deciduous trees.
Limothrips cerealium Haliday, 1836
Distribution. Palearctic, introduced worldwide. Nordic distribution: Sweden, Norway, Denmark, Finland. Swedish distribution: Sk, Bl, Ha, Vg, Sm, Öl, Go, Ög, Bo, Sö, Up, Dr, Vb, Nb, To.
Remarks. First records for Vg and Nb. Feeding and breeding on leaves and flowers of Poaceae.
Material examined. Sweden • 4♀♀; Vg., Vara kommun, 58.256°N, 12.983°E, on patio in urban environment; 2025.vii.07; via Swedish Board of Agriculture in Skara. • 1♀; Nb., Luleå kommun, Gammelstad kyrkby, 65.646111°N, 22.234167°E, on Consolida regalis, 2025.viii.08, leg. C.-A. Gertsson.
Limothrips consimilis Priesner, 1926
Distribution. Palearctic. Nordic distribution: Sweden. Swedish distribution: Sö.
Remarks. First record for Sweden. Feeding and breeding on leaves and flowers of Poaceae in dry and warm habitats.
Material examined. Sweden • 4♀♀; Sö, Gnesta kommun, Önnersta, 59.0519°N, 17.1437°E, on Poaceae; 2023.vii.18; E. Wahlberg leg.; voucher IDs: BT1T, BT3T, DP8T, DP9T.
Limothrips denticornis Haliday, 1836
Distribution. Palearctic, introduced worldwide. Nordic distribution: Sweden, Norway, Denmark, Finland. Swedish distribution: Sk, Bl, Sm, Öl, Go, Ög, Vg, Bo, Nä, Sö, Up, Vs, Vr, Jä.
Remarks. First record for Bl. Feeding and breeding on leaves and flowers of Poaceae.
Material examined. Sweden • 2♀♀; Bl, Karlskrona kommun, Augerum, 56.217489°N, 15.673053°E, on Poaceae; 2023.v.30; E. Wahlberg leg.; voucher IDs: BI8T, CX7T.
Mycterothrips consociatus (Targioni-Tozzetti, 1886)
Distribution. Palearctic. Nordic distribution: Sweden, Finland. Swedish distribution: Sö, Vr, Ds, Up, Dr.
Remarks. First record for Sö. Feeding and breeding on the leaves of different deciduous trees, particularly on Alnus, Betula, Corylus, Quercus and Salix.
Material examined. Sweden • 1♀; Sö., Nyköping kommun, Pumptorp, roadside meadow, 58.667763°N, 16.811182°E; 2021.vi.03; E. Wahlberg leg.; voucher ID: FN9T.
Mycterothrips latus (Bagnall, 1912)
Distribution. Palearctic. Nordic distribution: Sweden, Norway, Denmark, Finland. Swedish distribution: Sk, Öl, Sö, Up, Vr, Jä, Hs, Ån, Vb, Ly, Lu, To.
Remarks. First record for Ån. Feeding and breeding on the leaves of different deciduous trees, mainly Betulaceae. Here collected on ground vegetation.
Material examined. Sweden • 1♀; Ån, Nordmalings kommun, Torrböle, 63.700503°N, 19.604039°E, in mixed herbaceous vegetation; 2023.vi.19; E. Wahlberg leg.; voucher ID: CY4T.
Mycterothrips salicis (O. M. Reuter, 1879)
Distribution. Holarctic. Nordic distribution: Sweden, Norway, Denmark, Finland. Swedish distribution: Sm, Öl, Go, Ög, Ds, Sö, Up, Vr, Dr, Vb, Ly.
Remarks. First record for Dr. Feeding and breeding on the leaves of different deciduous trees, mainly Salicaceae. Here collected on ground vegetation.
Material examined. Sweden • 3♀♀; Dr, Orsa kommun, Koppången nature reserve, 61.362499°N, 14.786772°E, on Angelica sylvestris; 2024.vii.30; E. Wahlberg leg.; voucher IDs: EE3T, EE5T, EE6T. • 1♀; Dr., Mora kommun, Utanmyra, 60.924194°N, 14.585461°E, in mixed herbaceous vegetation; 2024.vii.31; E. Wahlberg leg.; voucher ID: EI5T. • 1♀; Dr., Mora kommun, Utanmyra, 60.927792°N, 14.589847°E, on Carex aquatilis; 2024.vii.31; E. Wahlberg leg.; voucher ID: EH6T.
Odontothrips biuncus John, 1921
Distribution. Holarctic. Nordic distribution: Sweden, Norway, Denmark, Finland. Swedish distribution: Sk, Öl, Go, Vr, Ds, Up, JäÅn, Vb, Ly, Pi, Lu, To
Remarks. First records for Up, Jä, Ån, Vb, Ly, and Pi. Feeding and breeding in flowers of Fabaceae, particularly Vicia cracca and V. villosa.
Material examined. Sweden • 1♀; Up, Vallentuna kommun, private garden, 59.5167°N, 18.0648°E; 2023.vi.27; T. Kronestedt leg.; voucher ID: DE8T. • 1♀; Jä, Ragunda kommun, Krångede, 63.146760°N, 16.057726°E, roadside mixed herbaceous vegetation; 2023.vi.15; E. Wahlberg leg.; voucher ID: CB9T. • 1♀1♂; Ån, Nordmalings kommun, Torrböle, 63.700503°N, 19.604039°E, mixed herbaceous vegetation; 2023.vi.19; E. Wahlberg leg.; voucher IDs: CZ2T, CZ3T. • 3♀♀; SE, Ån., Sollefteå kommun, Junsele, 63.71736°N, 16.82341°E, mixed herbaceous vegetation; 2023.vi.19; E. Wahlberg leg.; voucher IDs: DJ9T, DK1T, DK8T. • 16♀♀2♂♂; Vb, Robertsfors kommun, Rickleå, 64.101214°N, 20.929401°E, meadow with mixed flowering herbaceous vegetation; 2023.vi.18; E. Wahlberg leg.; voucher IDs: BO4T, BO5T, BO6T, CH2T, CH5T, CH7T, CI4T, CI6T, DR4T, DR6T, DF9T, DG2T, DG3T, DG4T, DG5T, DG6T, DG7T, DG8T. • 1♀; SE, Ly., Storuman kommun, Stensele, 65.100466°N, 17.167255°E, mixed herbaceous inflorescence; 2023.vi.16; E. Wahlberg leg.; voucher ID: DQ6T. • 1♀; Pi, Arjeplogs kommun, Arjeplog, 66.040783°N, 17.868661°E, on Astragalus alpinus; 2023.vi.18; E. Wahlberg leg.; voucher ID: BP4T.
Odontothrips confusus Priesner, 1926
Distribution. Palearctic. Nordic distribution: Sweden. Swedish distribution: Öl.
Remarks. Feeding and breeding in flowers of Fabaceae, particularly Medicago.
Odontothrips intermedius (Uzel, 1895)
Distribution. Palearctic. Nordic distribution: Sweden, Norway, Denmark, Finland. Swedish distribution: Sö, Up, Vr, Me, Ly.
Remarks. First records for Me and Ly. Feeding and breeding in flowers of Fabaceae, particularly Lathyrus.
Material examined. Sweden • 2♀♀; Me, Timrå kommun, Indalsälvens delta, 62.508667°N, 17.448164°E, mixed herbaceous vegetation; 2023.vi.14; E. Wahlberg leg.; voucher IDs: DI5T, DI6T. • 2♀♀; Me, Timrå kommun, Svedje, 62.519346°N, 17.288289°E, mixed herbaceous vegetation; 2023.vi.14; E. Wahlberg leg.; voucher IDs: CC6T, CC9T. • 2♀♀; Ly, Storuman kommun, Stensele, 65.100466°N, 17.167255°E, in mixed herbaceous inflorescence; 2023.vi.16; E. Wahlberg leg.; voucher IDs: DQ7T, DQ8T.
Odontothrips loti (Haliday, 1852)
Distribution. Holarctic. Nordic distribution: Sweden, Norway, Denmark, Finland. Swedish distribution: Sk, Öl, Sö, Up, Vr, Jä, Ån, Ås, Ly.
Remarks. First records for Sö, Jä, Ån, Ås and Ly. Feeding and breeding in flowers of Fabaceae.
Material examined. Sweden • 1♀; Sö, Flens kommun, Malmköpings nature reserve, 59.1458°N, 16.7205°E; 2023.vi.07; E. Wahlberg leg.; voucher ID: BZ4T. • 4♀♀3♂♂; Jä, Ragunda kommun, Boberg, 63.359057°N, 15.717947°E, on Astragalus alpinus; 2023.vi.15; E. Wahlberg leg.; voucher IDs: BX1T, BX4T, BX5T, BX6T, BX7T, BX9T, BY1T. 1♀; Jä, Strömsunds kommun, Sävselet, 63.538795°N, 15.444725°E, mixed herbaceous inflorescences; 2023.vi.15; E. Wahlberg leg.; voucher ID: BY4T. • 1♀; Ån, Kramfors kommun, Västhammar, 63.03017°N, 17.77373°E, mixed herbaceous vegetation; 2023.vi.19; E. Wahlberg leg.; voucher ID: DL9T. • 2♀♀; Ån, Sollefteå kommun, Junsele, 63.71736°N, 16.82341°E, mixed herbaceous vegetation; 2023.vi.19; E. Wahlberg leg.; voucher IDs: DK4T, DK7T. • 1♀; Ås, Dorotea kommun, Västra Ormsjö, 64.467878°N, 15.951629°E, on Astragalus alpinus; 2023.vi.16; E. Wahlberg leg.; voucher ID: BG6T. • 1♂; Ly, Storuman kommun, Stensele, 65.100466°N, 17.167255°E, mixed herbaceous inflorescences; 2023.vi.16; E. Wahlberg leg.; voucher ID: DQ5T.
Odontothrips phaleratus (Haliday, 1836)
Distribution. Palearctic. Nordic distribution: Sweden, Norway, Denmark, Finland. Swedish distribution: Sk, Bl, Sö, Up, Vr, Dr, Ån, Me.
Remarks. First record for Ån and Me. Feeding and breeding in flowers of Fabaceae, particularly Lathyrus pratensis and Vicia spp.
Material examined. Sweden • 2♀♀1♂; Ån, Kramfors kommun, Västhammar, 63.03017°N, 17.77373°E, mixed herbaceous vegetation; 2023.vi.19; E. Wahlberg leg.; voucher IDs: DL8T, DM2T, DM4T. • 1♀; Me., Timrå kommun, Indalsälvens delta, 62.508667°N, 17.448164°E, in mixed herbaceous vegetation; 2023.vi.14; E. Wahlberg leg.; voucher ID: DY8T.
Odontothrips ulicis (Haliday, 1828)
Distribution. Palearctic. Nordic distribution: Sweden. Swedish distribution: Sk, Bl, Sm, Go, Ög, Bo, Up, Vs, Sö, Up.
Remarks. Feeding and breeding in flowers of Ulex spp. (Fabaceae).
Oxythrips ajugae Uzel, 1895
Distribution. Palearctic. Nordic distribution: Sweden, Norway, Denmark, Finland. Swedish distribution: Sk, Bl, Sm, Ög, Vg, Sö, Up, Vr, Dr, Jä, Vb, Nb, Pi, Lu, To.
Remarks. First records for Bl, Sm, Nb, and Pi. Breeding in the cones of Pinus, but adults found on various plants around the trees.
Material examined. Sweden • 1♀; Bl, Karlskrona kommun, Torhamn, 56.092591°N, 15.853811°E, on Barbarea vulgaris; 2023.v.31; E. Wahlberg leg.; voucher ID: CP3T. • 2♀♀; Bl, Olofströms kommun, Kräftemåla, 56.395876°N, 14.664588°E, grazed meadow; 2023.v.31; E. Wahlberg leg.; voucher IDs: CR4T, CR5T. • 1♀; Bl, Karlskrona kommun, Augerum, 56.217489°N, 15.673053°E, on Poaceae; 2023.v.30; E. Wahlberg leg.; voucher ID: CX9T. • 1♀; Sm, Nybro kommun, Alsterbo, 56.896544°N, 15.883643°E, deciduous forest with Fraxinus, Quercus and Corylus; 2021.v.11; E. Wahlberg leg.; voucher ID: AF1T. • 1♀; Nb, Åsele kommun, Björnlandet National Park, 63.970150°N, 18.053417°E, Malaise trap; 2011.vi.15–vi.29; K. Norberg & B.O. Johansson leg.; voucher ID: AB2T. • 1♀; Pi, Arjeplogs kommun, Mattureälven-Båldakatj, 66.297221°N, 18.327394°E, on mixed ground vegetation in old pine forest; 2023.vi.17; E. Wahlberg leg.; voucher ID: CJ5T.
Oxythrips bicolor (O. M. Reuter, 1879)
Distribution. Palearctic. Nordic distribution: Sweden, Norway, Denmark, Finland. Swedish distribution: Sk, Bl, Sm, Ög, Vg, Sö, Up, Vr, Dr, Jä, Vb, Lu, To, Pi.
Remarks. First records for Bl, Sm, Vg, and Pi. Breeding on Cupressaceae and Pinaceae, adults found feeding on a large variety of plants.
Material examined. Sweden • 1♀; Bl, Ronneby kommun, Värperyd, 56.295140°N, 15.290304°E, on dead Fraxinus; 2022.v.18; E. Wahlberg leg.; voucher ID: AX1T. • 2♀♀; Bl, Tingsryd kommun, Göljahult, 56.429934°N, 15.220758°E, on Luzula; 2022.v.18; E. Wahlberg leg.; voucher IDs: AX8T, AX9T. • 1♀; Bl, Tingsryd kommun, Göljahult, 56.429934°N, 15.220758°E, on Phragmites; 2022.v.18; E. Wahlberg leg.; voucher ID: AX6T. • 1♀; Sm., Kalmar län, Tyllinge, 58.023443°N, 16.072688°E, on Myrica gale; 2024.v.28; E. Wahlberg leg.; voucher ID: FE6T. • 1♀; Sm., Västerviks kommun, Hallmare, 57.866219°N, 16.754423°E, on Bolboschoenus maritimus; 2024.v.05; E. Wahlberg leg.; voucher ID: EB9T. • 2♀♀; Sm., Västerviks kommun, Risebo nature reserve, 58.031361°N, 16.106291°E; 2024.v.28; E. Wahlberg leg.; voucher ID: EZ7T, EZ8T. • 1♀; Vg, Laxå kommun, Finnerödja, 58.931227°, 14.346057°, window trap at bog; 2021.vi.05–vii.05; E. Wahlberg leg.; voucher ID: AM8T. • 1♀; Pi, Arjeplogs kommun, Mattureälven-Båldakatj, 66.297221°N, 18.327394°E, on mixed ground vegetation in old pine forest; 2023.vi.17; E. Wahlberg leg.; voucher ID: CJ6T.
Oxythrips ulmifoliorum (Haliday, 1836)
Distribution. Palearctic. Nordic distribution: Sweden, Norway, Finland. Swedish distribution: Go, Sö, Up.
Remarks. Feeding and breeding on leaves of Oleaceae and Ulmaceae.
Platythrips tunicatus (Haliday, 1852)
Distribution. Palearctic. Nordic distribution: Sweden, Denmark, Finland. Swedish distribution: Sö, Up.
Remarks. Feeding and breeding in flowers and on leaves of different species of Galium, particularly on Galium mollugo (Rubiaceae), but in Sweden also collected on Poaceae.
Pteridothrips pteridicola (Karny, 1914)
Distribution. Oriental. Nordic distribution: Sweden (only indoors/in greenhouses). Swedish distribution: Sk.
Remarks. Feeding and breeding on water fern (Microsorum).
Rhaphidothrips longistylosus Uzel, 1895
Distribution. Palearctic, introduced in the Nearctic. Nordic distribution: Sweden, Norway, Denmark, Finland. Swedish distribution: Sk.
Remarks. Feeding and breeding on Poaceae, in Sweden collected on Orchis maculata.
Scirtothrips longipennis (Bagnall, 1909)
Distribution. Original distribution unknown, but introduced worldwide indoors and in greenhouses. Nordic distribution: Sweden, Norway, Denmark, Finland (only indoors/in greenhouses). Swedish distribution: Ha.
Remarks. Feeding and breeding on leaves of a variety of plants, a pest on cultivated Begonia.
Scolothrips uzeli (Schille, 1910)
Distribution. Palearctic. Nordic distribution: Sweden, Norway. Swedish distribution: Up.
Remarks. Predator on mites on Juniperus.
Stenothrips graminum Uzel, 1895
Distribution. Palearctic. Nordic distribution: Sweden, Norway, Denmark, Finland. Swedish distribution: Sk, Ög, Sö, Up.
Remarks. Breeding and feeding on Poaceae.
Taeniothrips inconsequens (Uzel, 1895)
Distribution. Holarctic. Nordic distribution: Sweden, Norway, Denmark, Finland, Iceland. Swedish distribution: Sk, Ha, Öl, Go, Sm, Ög, Bo, Vg, Sö, Up, Vb, Lu.
Remarks: First records for Ha, Sm, and Vb. Feeding and breeding on different deciduous plants and trees.
Material examined. Sweden • 2♀♀; Ha, Falkenberg kommun, Ätrafors, 57.03428°N, 12.65945°E, deciduous forest with Fagus, Quercus, Fraxinus, Malus and Corylus; 2021.v.18; E. Wahlberg leg.; voucher IDs: AH1T, AH2T. • 3♀♀; Sm., Västerviks kommun, Risebo nature reserve, 58.031361°N, 16.106291°E, 2024.v.28; E. Wahlberg leg.; Voucher IDs: FA2T, FA4T, FD7T. • 1♀; Vb, Umeå kommun, Holmsund, 63.70613°N, 20.35276°E, on Fabaceae; 2023.vi.18; E. Wahlberg leg.; Voucher ID: DH9T.
Taeniothrips picipes (Zetterstedt, 1828)
Distribution. Palearctic. Nordic distribution: Sweden, Norway, Denmark, Finland, Iceland. Swedish distribution: Sk, Bl, Sm, Öl, Go, Ög, Bo, Sö, Up, Vs, Vr, Dr, Jä, Hs, Ån, Vb, Ås, Ly.
Remarks. First records for Bl, Hs, Ån, Ås, and Ly. Feeding and breeding in flowers of different plants.
Material examined. Sweden • 1♂; Bl, Karlskrona kommun, Sandhamn, 56.090980°N, 15.856533°E, mixed herbaceous vegetation; 2023.v.31; E. Wahlberg leg.; voucher ID: CQ4T. • 1♀; Bl, Olofströms kommun, Kräftemåla, 56.395371°N, 14.654472°E, on Vaccinium myrtillus; 2023.v.31; E. Wahlberg leg.; voucher ID: BL2T. • 1♀; Bl, Tingsryd kommun, Göljahult, 56.429934°N, 15.220758°E, on Luzula; 2022.v.18; E. Wahlberg leg.; voucher ID: AX7T. • 2♀♀; Ån, Hudiksvalls kommun, 61.747222°N, 17.129722°E, on Melampyrum pratense, 2025.viii.04, leg. C.-A. Gertsson • 5♀♀; Ån, Nordmalings kommun, Torrböle, 63.700503°N, 19.604039°E, mixed herbaceous vegetation; 2023.vi.19; E. Wahlberg leg.; voucher IDs: CY7T, CY9T, CZ5T, CZ8T, DA1T. • 3♀♀; Ån, Sollefteå kommun, Junsele, 63.71736°N, 16.82341°E, mixed herbaceous vegetation; 2023.vi.19; E. Wahlberg leg.; voucher IDs: DK2T, DK3T. • 2♀♀; Ås, Dorotea kommun, Båtas, 64.792075°N, 15.301708°E, on Poaceae; 2023.vi.16; E. Wahlberg leg.; voucher IDs: BR6T, BW1T. • 4♀♀; Ås, Dorotea kommun, Västra Ormsjö, 64.467878°N, 15.951629°E, on Astragalus alpinus; 2023.vi.16; E. Wahlberg leg.; voucher IDs: BU6T, BV4T, BV6T, BV7T. • 2♀♀; Ly, Storuman kommun, Stensele, 65.100466°N, 17.167255°E, mixed herbaceous inflorescences; 2023.vi.16; E. Wahlberg leg.; voucher IDs: DQ3T, DQ4T.
Thrips alni Uzel, 1895
Distribution. Palearctic. Nordic distribution: Sweden, Finland. Swedish distribution: Sm, Up, Vr.
Remarks. Feeding and breeding on leaves of Betulaceae and Salicaceae, but adults also found on a variety of herbaceous plants and deciduous trees.
Thrips angusticeps Uzel, 1895
Distribution. Palearctic. Nordic distribution: Sweden, Denmark, Finland. Swedish distribution: Sk, Öl, Ög, Up.
Remarks. Feeding and breeding mainly on a wide range of herbaceous plants.
Thrips atratus Haliday, 1836
Distribution. Holarctic. Nordic distribution: Sweden, Norway, Denmark, Finland, Iceland. Swedish distribution: Sk, Bl, Ha, Sm, Öl, Go, Ög, Vg, Up, Vs, Bo, Sö, Vr, Dr, Hs, Me, Hr, Ån, Vb, Nb, Ly, Lu.
Remarks. First records for Bl and Me. Feeding and breeding in variety of flowering plants, often Caryophyllaceae.
Material examined. Sweden • 1♀3♂♂; Bl, Karlskrona kommun, Augerum, 56.216929°N, 15.676876°E, on Anchusa officinalis; 2023.vi.01; E. Wahlberg leg.; voucher IDs: CL8T, CN2T, CN7T, CO2T. • 2♀♀; Me, Timrå kommun, Svedje, 62.519346°N, 17.288289°E, mixed herbaceous vegetation; 2023.vi.14; E. Wahlberg leg.; voucher IDs: CC8T, CD2T.
Thrips brevicornis Priesner, 1920
Distribution. Palearctic. Nordic distribution: Sweden, Norway, Finland. Swedish distribution: Öl.
Remarks. Feeding and breeding on a large variety of different flowering plants.
Thrips calcaratus Uzel, 1895
Distribution. Palearctic, introduced in the Nearctic. Nordic distribution: Sweden, Norway, Denmark, Finland. Swedish distribution: Sm, Ån.
Remarks. First record for Sweden. Feeding and breeding on leaves of deciduous trees, pest on Tilia.
Material examined. Sweden • 1♀; Sm., Västerviks kommun, Risebo nature reserve, 58.031361°N, 16.106291°E; 2024.v.28; E. Wahlberg leg.; voucher ID: FA5T. • 4♀♀; Ån, Kramfors kommun, Västhammar, 63.03017°N, 17.77373°E, on Tilia cordata; 2023.vi.19; E. Wahlberg leg.; voucher IDs: DG9T, DH1T, DH2T, DH3T.
Thrips dilatatus Uzel, 1895
Distribution. Palearctic. Nordic distribution: Sweden, Norway, Denmark, Finland. Swedish distribution: Sk, Öl, Sö, Up, Vr, Ly.
Remarks. New record for Sö. Feeding and breeding in flowers of Orobanchaceae.
Material examined. Sweden • 1♀; Sö., Flens kommun, Sparreholm, 59.086913°N, 16.829442°E, mixed herbaceous vegetation; 2024.vii.29; E. Wahlberg leg.; voucher ID: EFH7
Thrips discolor Haliday, 1836
Distribution. Holarctic. Nordic distribution: Sweden, Norway, Denmark, Finland. Swedish distribution: Sk, Up, Sö.
Remarks. Feeding and breeding on plants of Ranunculaceae, mainly on Ranunculus repens.
Thrips flavus Schrank, 1776
Distribution. Palearctic, Oriental. Nordic distribution: Sweden, Norway, Denmark, Finland. Swedish distribution: Sk, Sm, Go, Ög, Sö, Up, Vr, Dr, Hs, Ån.
Remarks. First records for Hs and Ån. Feeding and breeding in a variety of flowering plants.
Material examined. Sweden • 1♀; Ån, Nordmalings kommun, Torrböle, 63.700503°N, 19.604039°E, mixed herbaceous vegetation; 2023.vi.19; E. Wahlberg leg.; voucher ID: CY8T. • 1♀; Ån, Hudiksvalls kommun, 61.747222°N, 17.129722°E, on Melampyrum pratense, 2025.viii.04, leg. C.-A. Gertsson.
Thrips fulvipes Bagnall, 1923
Distribution. Palearctic. Nordic distribution: Sweden, Norway, Denmark. Swedish distribution: Sk.
Remarks. Feeding and breeding on Mercurialis perennis, adults sometimes found in flowers of other plants.
Thrips fuscipennis Haliday, 1836
Distribution. Holarctic. Nordic distribution: Sweden, Norway, Denmark, Finland. Swedish distribution: Sk, Bl, Ha, Sm, Öl, Go, Ög, Bo, Ds, Sö, Up, Vr, Dr.
Remarks. First record for Bl and Dr. Feeding and breeding in a large variety of different flowering plants.
Material examined. Sweden • 1♀; Bl, Karlskrona kommun, Sandhamn, 56.090980°N, 15.856533°E, mixed herbaceous vegetation; 2023.v.31; E. Wahlberg leg.; voucher ID: CQ8T. • 5♀♀; Bl, Karlskrona kommun, Torhamn, 56.092591°N, 15.853811°E, on Barbarea vulgaris; 2023.v.31; E. Wahlberg leg.; voucher IDs: CO8T, CO9T, CP2T, CP4T, CP6T. • 1♀; Dr., Mora kommun, Utanmyra, 60.923053°N, 14.617137°E, on Poaceae; 2024.vii.31; E. Wahlberg leg.; voucher ID: EL4T. • 2♀♀; Dr., Mora kommun, Utanmyra, 60.924194°N, 14.585461°E, in mixed herbaceous vegetation; 2024.vii.31; E. Wahlberg leg.; voucher IDs: EI3T, EI4T. • 1♀; Dr., Mora kommun, Utanmyra, 60.927792°N, 14.589847°E, on Carex aquatilis, 2024.vii.31; E. Wahlberg leg.; voucher ID: EI1T. • 1♀; Dr., Orsa kommun, Enåns dalgång, 61.110185°N, 14.636168°E, mixed herbaceous vegetation; 2024.vii.31; E. Wahlberg leg.; voucher ID: EJ6T.
Thrips juniperinus Linnaeus, 1758
Distribution. Palearctic. Nordic distribution: Sweden, Norway. Swedish distribution: Sö, Lu.
Remarks. Feeding and breeding on Juniperus.
Material examined. Sweden • 1♀; Sö, Nyköpings kommun, Tovetorp research station, Skrivhuset 1, 58.94753°N, 17.14682°E, from Juniperus communis (Cupressaceae); 2024.viii.30; M. Ulitzka leg.; collection number: MU-S-08/1.
Thrips linariae Priesner, 1927
Distribution. Palearctic. Nordic distribution: Sweden, Norway. Swedish distribution: Unknown.
Remarks. Feeding and breeding in different flowering plants. It was noted for Sweden by Kobro (2011), but regional records and physical specimens are unknown.
Thrips major Uzel, 1895
Distribution. Palearctic. Nordic distribution: Sweden, Norway, Denmark, Finland. Swedish distribution: Sk, Bl, Ha, Sm, Öl, Ög, Bo, Ds, Sö, Up, Vs, Vr, Dr, Hs, Me, Hr, Jä, Ån, Vb, Nb, Ås, Ly, Pi, Lu, To.
Remarks. First records for Me, Jä, Ås, and Pi. Feeding and breeding mainly in Rosaceae, but also found in other herbaceous plants and deciduous trees.
Material examined. Sweden • 1♀; Me., Timrå kommun, Indalsälvens delta, 62.508667°N, 17.448164°E, mixed herbaceous vegetation; 2023.vi.14; E. Wahlberg leg.; voucher ID: DJ3T. • 2♀♀; Me, Timrå kommun, Svedje, 62.519346°N, 17.288289°E, mixed herbaceous vegetation; 2023.vi.14; E. Wahlberg leg.; voucher IDs: CD1T, CD3T. • 1♀; Jä, Strömsunds kommun, Sävselet, 63.538795°N, 15.444725°E, mixed herbaceous inflorescences; 2023.vi.15; E. Wahlberg leg.; voucher ID: BY3T. • 1♀; Ås, Dorotea kommun, Båtas, 64.792075°N, 15.301708°E, on Poaceae; 2023.vi.16; E. Wahlberg leg.; voucher ID: BW3T. • 1♀; Ås, Dorotea kommun, Häggås, 64.402187°N, 16.434090°E, mixed herbaceous inflorescences; 2023.vi.16; E. Wahlberg leg.; voucher ID: BV8T. • 1♀; Ås, Dorotea kommun, Västra Ormsjö, 64.467878°N, 15.951629°E, on Astragalus alpinus; 2023.vi.16; E. Wahlberg leg.; voucher ID: BU9T. • 1♀; Pi, Arjeplogs kommun, Arjeplog, 66.040783°N, 17.868661°E, on Astragalus alpinus; 2023.vi.18; E. Wahlberg leg.; voucher ID: CL2T. • 4♀♀; Pi, Arjeplogs kommun, Mattureälven-Båldakatj, 66.297221°N, 18.327394°E, on mixed ground vegetation in old pine forest; 2023.vi.17; E. Wahlberg leg.; voucher IDs: CI8T, CI9T, CJ1T, CJ4T.
Thrips menyanthidis Bagnall, 1923
Distribution. Palearctic. Nordic distribution: Sweden, Norway, Finland. Swedish distribution: Vg, Go, Sö, Vr, Dr.
Remarks. First records for Vg and Sö. Feeding and breeding on Menyanthes trifoliata. Neither the results from the distance-based (Fig. 13) or tree-based (Fig. 14) species delimitation support this species as a synonym of T. fuscipennis as suggested by Pitkin (1976) and Mound et al. (1976), hence the T. menyanthidis is here confirmed as a valid species. Even though the campaniform sensilla on the metanotum is used as a character in e.g. Mound et al. (2018) it can be variable and dubious. The two species can be separated by postocular setae and coloration as described in the key herein.
Species delimitation using distance, ASAP, of Thrips. T. menyanthidis shadowed. Partition with best fit is outlined with red (distance: 0.0100, p-value: 1.817597e-01, ASAP score: 1.000000, rank: 1).
Tree-based species delimitation with mPTP of Thrips. T. menyanthidis shadowed.
Material examined. Sweden • 5♀♀; Vg, Laxå kommun, Finnerödja, 58.93127°N, 14.34668°E, bog; 2024.viii.13; E. Wahlberg leg.; voucher IDs: DU2T, DU4T. • 1♀; Sö, Nyköpings kommun, Skåraviken nature reserve, 58.81361°N, 16.73475°E, wet meadow; 2024.viii.07; E. Wahlberg leg.; voucher ID: DU7T. • 1♀; Dr., Mora kommun, Utanmyra, 60.924194°N, 14.585461°E, 2024.vii.31; E. Wahlberg leg.; voucher ID: EI8T.
Thrips minutissimus Linnaeus, 1758
Distribution. Palearctic. Nordic distribution: Sweden, Norway, Denmark, Finland. Swedish distribution Sk, Ha, Sm, Öl, Ög, Bo, Sö, Up.
Remarks. Feeding and breeding in a variety of different flowering plants and deciduous trees.
Thrips nigropilosus Uzel, 1895
Distribution. Palearctic, introduced worldwide. Nordic distribution: Sweden, Norway, Denmark, Finland. Swedish distribution: Sk, Öl, Vg, Sö, Up.
Remarks. Feeding and breeding on leaves and in flowers of different plants, pest on cultivated plants in both greenhouses and outdoors.
Thrips origani Priesner, 1926
Distribution. Palearctic, but probably introduced in many regions in the world. Nordic distribution: Sweden, Norway. Swedish distribution: Sk, Sö.
Remarks. First records for Sweden. Feeding and breeding on Origanum, preferably in warm and dry habitats
Material examined. Sweden • 2♀♀; Sk, Lunds kommun, Botaniska trädgården, 55.705833°N, 13.204167°E, on Origanum vulgare, 2025.viii.21, leg. C.-A. Gertsson. • 5♀♀; Sö, Nyköpings kommun, Tovetorp, 58.94782°N, 17.15014°E, on Origanum vulgare; 2024.ix.05; E. Wahlberg leg.; voucher IDs: DT6T, DT7T, DT8T, DT9T, DU1T.
Thrips palmi Karny, 1925
Distribution. Oriental, introduced worldwide. Nordic distribution: Sweden, Norway, Denmark, Finland (only indoors/in greenhouses). Swedish distribution: sporadically indoors/in greenhouses.
Remarks. Feeding and breeding on leaves and in flowers of large variety of different plants, pest on cultivated crops and ornamental plants.
Thrips physapus Linnaeus, 1758
Distribution. Palearctic. Nordic distribution: Sweden, Norway, Denmark, Finland. Swedish distribution: Sk, Bleking, Sm, Öl, Ög, Vg, Bo, Sö, Up, Vs, Vr, Me, Hr, Vb, Nb, Lu.
Remarks. Feeding and breeding in Asteraceae, but adults found in flowers of a variety of plants.
Thrips pillichi Priesner, 1924
Distribution. Palearctic. Nordic distribution: Sweden. Swedish distribution: Bl, Jä.
Remarks. First record for Sweden. Feeding and breeding on Asteraceae.
Material examined. Sweden • 1♀; Bl, Olofströms kommun, Kräftemåla, 56.395876°N, 14.664588°E, grazed meadow; 2023.v.31; E. Wahlberg leg.; voucher ID: CS4T. • 1♀; Jä, Ragunda kommun, Krångede, 63.146760°N, 16.057726°E, roadside herbaceous vegetation; 2023.vi.15; E. Wahlberg leg.; voucher ID: CB7T.
Thrips pini (Uzel, 1895)
Distribution. Palearctic. Nordic distribution: Sweden, Norway, Denmark, Finland, Iceland. Swedish distribution: Sk, Ha, Sm, Bo, Sö, Up, Vr, Dr, Jä, Vb, Nb, Lu.
Remarks. First record for Jä. Feeding and breeding on Pinaceae.
Material examined. Sweden • 4♀♀; SE, Jä, Undersåker kommun, Trillevallen, 63.262266°N, 13.210813°E, old growth spruce forest surrounded by wires, sweep netting twigs of spruce (Picea); 2023.vii.25; R. Vicente leg.; voucher IDs: BU1T, BU2T, BU3T, BU4T.
Thrips roepkei Doeksen, 1953
Distribution. Palearctic. Nordic distribution: Sweden, Norway. Swedish distribution: Sö
Remarks. First record for Sweden. Feeding and breeding on Solanum in humid and wet habitats
Material examined. Sweden • 1♀; Sö., Nyköpings kommun, Tovetorp research station, 58.9476°N, 17.1467°E; 2024.viii.27; S. Larsson leg.; voucher ID: DB2T.
Thrips simplex (Morison, 1930)
Distribution. Afrotropical, introduced worldwide. In temperate areas indoors and in greenhouses. Nordic distribution: Sweden, Norway (only indoors/in greenhouses). Swedish distribution: only sporadically indoors/in greenhouses.
Remarks. Feeding and breeding on Iridaceae, occurs as pest on Gladiolus. Currently only found indoors but can potentially establish in warmer climate conditions in cultivated Gladiolus.
Thrips tabaci Lindeman, 1889
Distribution. Palearctic, introduced worldwide. Nordic distribution: Sweden, Norway, Denmark, Finland, Iceland. Swedish distribution: Sk, Bl, Sm, Öl, Go, Ög, Vg, Bo, Sö, Up, Vs, Dr, Vr, Hr, Vb, Nb.
Remarks. First record for Bl. Feeding and breeding on a large variety of plants, sometimes also reported as a predator on mites; pest on crops of Allium, Apiaceae, and Brassicaceae.
Material examined. Sweden • 9♀♀; Bl, Karlskrona kommun, Augerum, 56.216929°N, 15.676876°E, on Anchusa officinalis; 2023.vi.01; E. Wahlberg leg.; voucher IDs: CL9T, CM1T, CM3T, CM4T, CM5T, CM9T, CN1T, CN9T, CO1T. • 1♀; Bl, Karlskrona kommun, Sandhamn, 56.090980°N, 15.856533°E, mixed herbaceous vegetation; 2023.v.31; E. Wahlberg leg.; voucher ID: CQ3T. • 1♀; Bl, Karlskrona kommun, Torhamn, 56.092591°N, 15.853811°E, on Barbarea vulgaris; 2023.v.31; E. Wahlberg leg.; voucher ID: CO6T.
Thrips trehernei Priesner, 1927
Distribution. Holarctic. Nordic distribution: Sweden, Norway, Denmark, Finland, Iceland. Swedish distribution: Sk, Bl, Sm, Öl, Ög, Sö, Up, Vr, Ly.
Remarks. First records for Bl and Ly. Feeding and breeding mainly in flowers of Asteraceae, but adults also found in flowers of a variety of different plants.
Material examined. Sweden • 1♀; Bl, Olofströms kommun, Kräftemåla, 56.395876°N, 14.664588°E, grazed meadow; 2023.v.31; E. Wahlberg leg.; voucher ID: CR6T. • 1♀; Ly, Storuman kommun, Stensele, 65.100466°N, 17.167255°E, mixed herbaceous inflorescences; 2023.vi.16; E. Wahlberg leg.; voucher ID: DQ2T.
Thrips urticae Fabricius, 1781
Distribution. Palearctic. Nordic distribution: Sweden. Swedish distribution: Sö.
Remarks. First record for Sweden. Feeding and breeding on Urtica dioica.
Material examined. Sweden • 5♀♀; Sö., Nyköpings kommun, Tovetorp research station, 58.94756°N, 17.14519°E, on Urtica dioica, 2024.ix.05, E. Wahlberg leg.; DS1T, DS2T, DS3T, DS4T, DS5T.
Thrips validus Uzel, 1895
Distribution. Holarctic. Nordic distribution: Sweden, Norway, Denmark, Finland. Swedish distribution: Sk, Bo, Öl, Ög, Sö, Up, Vs, Vr, Dr, Gä, Jä.
Remarks. First records for Gä and Jä. Feeding and breeding mainly in flowers of Asteraceae, but adults also found in flowers of a variety of different plants.
Material examined. Sweden • 2♀♀; Gä, Gävle kommun, Östra Sikvik, 60.66559°N, 17.29876°E, mixed herbaceous vegetation; 2023.vi.20; E. Wahlberg leg.; voucher IDs: DL4T, DL6T. • 1♀; Jä., Ragunda kommun, Krångede, 63.146760°N, 16.057726°E, roadside herbaceous vegetation; 2023.vi.15; E. Wahlberg leg.; voucher ID: CB6T.
Thrips viminalis Uzel, 1895
Distribution. Palearctic. Nordic distribution: Sweden, Norway, Finland. Swedish distribution: Bo, Up, Vr, Dr.
Remarks. Feeding and breeding on leaves of Salicaceae and Betulaceae.
Thrips vulgatissimus Haliday, 1836
Distribution. Holarctic, introduced in Australasia. Nordic distribution: Sweden, Norway, Denmark, Finland, Iceland. Swedish distribution: Sk, Öl, Ha, Sm, Ög, Vg, Bo, Sö, Up, Vs, Vr, Dr, Hs, Hr, Jä, Vb, Nb, Ås, Ly, Lu, To.
Remarks. First records for Jä, Vb, and Ås. Feeding and breeding in flowers, mainly white, of a large variety of plants.
Material examined. Sweden • 1♀; Jä, Strömsunds kommun, Sävselet, 63.538795°N, 15.444725°E, mixed herbaceous inflorescences; 2023.vi.15; E. Wahlberg leg.; voucher ID: BZ2T. • 1♀; Vb, Skellefteå kommun, Nilsliden, 64.944032°N, 20.367689°E, mixed herbaceous vegetation; 2023.vi.18; E. Wahlberg leg.; voucher ID: CG2T. • 1♀; Ås, Dorotea kommun, Båtas, 64.792075°N, 15.301708°E, on Poaceae; 2023.vi.16; E. Wahlberg leg.; voucher ID: BW2T.
Tmetothrips subapterus (Haliday, 1836)
Distribution. Palearctic, introduced in the Nearctic. Nordic distribution: Norway, Finland. Swedish distribution: Öl, Sö.
Remarks. First record for Sö. Feeding and breeding in flowers of Caryophyllaceae and Rubiaceae.
Material examined. Sweden • 1♀; Sö., Gnesta kommun, Önnersta, 59.040980°N, 17.143706°E, coniferous forest; 2021.vii.16, E. Wahlberg leg.; voucher ID: AS2T. • 1♀; Sö, Gnesta kommun, Önnersta, 59.0470°N, 17.1450°E, mixed herbaceous vegetation; 2023.vii.18; E. Wahlberg leg.; voucher ID: BS7T.
Thrips in wetland habitats
The thrips of wetlands in Sweden has not been targeted before, and knowledge of the specific diversity in the country practically non-existent. Bhatti (1998) showed that several species are hydrophilous, in contrast to the general assumption of all Thysanoptera being terrestrial, and dependent on wet biotopes including specific botanical compositions. Some species are probably understudied, with wider distribution than known due to under sampling in wet environments (Jenser 2013; Wahlberg 2023b). In Poland many of the red listed species are tied to wetland habitats (Kucharczyk and Kucharczyk 2008), four vulnerable taxa (VU) and four being near threatened (NT). As wetlands being threated environments due to e.g. exploitation and climate change (Brinson and Malvárez 2002; Kingsford et al. 2016; Graversgaard et al. 2021) it is urgent to investigate the current biodiversity. This applies in particular to species whose perhaps only habitat consists of bogs, fens, marshes and swamps with established flora and biological networks. The following thrips species, with representatives from families occurring in Sweden, are connected to wetland habitats to varying extent. The list does not include species only found indoors or in greenhouses.
Family Aeolothripidae Uzel, 1895
Rhipidothrips brunneus Williams, 1913
Found in beach and bank grasses such as Bromus and Phragmites, in Sweden only collected on grasses on sandy soil on the southern east coast (Wahlberg 2023b, 2024).
Family Phlaeothripidae Uzel, 1895
Bolothrips dentipes (Reuter, 1880)
Species in this genus are often found in grasses and sedges, and B. dentipes is associated with wet habitats such as beach meadows and bogs. The other Swedish species in the genus, B. bicolor Heeger, 1852 and B. icarus (Uzel, 1895), are more tied to drier habitats even though B. bicolor has been collected in coastal areas (Wahlberg and Gertsson 2022; Wahlberg et al. 2025).
Cephalothrips monilicornis (Reuter, 1880)
A very common species in many different types of grasslands, where it feeds on the tissue of various grasses and sedges. Not exclusively a wet land species, but often found together with Bolothrips dentipes in wetter environments (Wahlberg et al. 2025).
Haplothrips hukkineni Priesner, 1939
On grasses and sedges in damp environments.
Haplothrips statices (Haliday, 1836)
Feeding and breeding on Armeria maritima in coastal areas, but also occurring where A. maritima has been introduced (e.g., road banks and urban areas).
Family Thripidae
** * Anaphothrips badius * **
Tied to wet environment, often coastal where it is found on grasses and sedges, but one record here also from Rubus in wet area.
** * Baliothrips dispar * **
On grasses and sedges in damp environments.
** * Baliothrips kroli * **
Similar ecology as B. dispar, but more restricted to southern half of Sweden (Wahlberg et al. 2025).
** * Chirothrips hamatus * **
Species in this genus are common on grasses, C. hamatus seems particularly associated with Alopecurus and other grasses on shores and wetlands.
** * Iridothrips iridis * **
One of the most strikingly obligate wet land species, entirely bound to its host plant Iris pseudacorus. It lives within the leaf sheets protected by the plants thick fluid, only migrating to flower heads during swarming and mating (Jenser 2013). For long only known from Skåne in southern Sweden (Gertsson 2015), but recent record here also from Södermanland.
** * Thrips menyanthidis * **
As I. iridis an obligate wet land species, found only on Menyanthes trifoliata. Only recently discovered in Sweden but records show that it might be more common than previously known, at least in the southern half of the country (Wahlberg et al. 2025).
Discussion
In total, we report 98 new provincial records and ten species new to Sweden. Most provinces with the highest numbers of new records (Fig. 15) are in the north, with the exceptions of Blekinge and Södermanland. This pattern likely reflects the historical undersampling of northern Sweden; the results presented here therefore provide much-needed data for this region. Blekinge has likewise been relatively understudied. The high number of records from Södermanland largely reflects the thrips workshop held at the Tovetorp Research Station in Södermanland.
Total number of known species and number of new records for each province in Sweden in the present study.
The number of recorded species in each province (Fig. 15) is in some parts a reflection of historical sampling effort, such as a high number of records in provinces around Stockholm (Södermanland and Uppland). Also, size of province is a factor. But another trend is associated with latitude. Provincial totals in our dataset are strongly structured by Sweden’s main biogeographical break around the Limes Norrlandicus, which approximates the transition from boreo-nemoral/deciduous–mixed forests in the south to boreal taiga in the north (Fig. 1) and reflecting step-changes in climate, vegetation, and species ranges. It broadly follows the Lower Dalälven river corridor and, in the west, lies north of Lake Vänern; many maps place it near ~60° N, though its exact position varies locally.
Provinces south of this boundary host substantially higher numbers of known thrips than those in northern Sweden, consistent with warmer climate, longer growing seasons, and higher host-plant availability to the south. This has been demonstrated for other organism groups such as caddisflies (Gullefors 2008), beetles (Wikars 2008), and fresh water snails (von Proschwitz 2025) before.
Land use and host-resource patterns likely reinforce this gradient. Roughly ~60% of Sweden’s arable land occurs on the fertile southern plains with a diverse crop structure; toward the north, crop diversity decreases and arable land contracts and leys dominate the smaller cropped area (Sjulgård et al. 2022). These south–north differences in cropping systems and open habitats (field margins, flowering weeds/forbs) plausibly support more host associations for phytophagous insects in southern provinces (Haddad et al. 2001). The ecology of thrips themselves fits these patterns: most species are plant-associated, many with broad tolerance for warm, disturbed, or open habitats typical of southern agricultural landscapes (Mound 2005); thus higher plant and crop diversity should scale up to higher thrips diversity.
The wetland fauna as noted herein likely reflects a combination of host-plant availability (reed/grass dominance), brackishness/hydrology, management history, and sampling method/effort. Across Sweden, many of the thrips contributing to the “wetland fauna” are grass-associated species that breed on emergent or periodically inundated graminoids in fens, marshes, and coastal reed belts. Classic grass specialists such as Chirothrips spp. develop and pupate inside individual grass florets, often on stands of Phragmites australis and other Poaceae, a life history that concentrates populations in flowering reedbeds and sedge/grass swards when inflorescences are available. Likewise, widespread “grass thrips” such as Anaphothrips obscurus exploit Poaceae broadly and can occur in wet meadow/reed habitats where grasses dominate. This ecology makes reedbeds and wet grasslands disproportionately important host reservoirs for wetland thrips.
Coastal wetlands along the Baltic add further structure via brackish salinity and water-level gradients, producing mosaics of brackish reed beds and coastal/salt-influenced grasslands (Dijkema 1990); these gradients are well known to shape plant communities (Čížková et al. 2023) and therefore the host template for wetland insects. In the Nordic context, these habitats are dynamic and historically managed (grazing, mowing, reed harvesting), with management choices affecting stand age structure, patchiness, and thus invertebrate biomass versus diversity, younger reeds often supporting higher biomass, older stands higher richness, arguing for mosaic management where conservation is a goal (Andersen et al. 2021).
The knowledge of the Thripidae fauna of Sweden has improved considerably but there are still missing pieces. This can be highlighted by the fact that a total of 127 species has been found in the Nordic countries. Seven of the species in Sweden are not found in any other Nordic country. The majority of species are native, but nearly 20% have probably been transported to Sweden with imported plant material.
Together, this study and earlier work on Phlaeothripidae, Aeolothripidae, and Melanthripidae have yielded numerous new provincial records and additional species new to Sweden, highlighting substantial previous gaps in both the taxonomic composition and geographic distribution of the Swedish thrips fauna. Collectively, these data refine current knowledge of thrips diversity in Sweden and, more broadly, contribute a substantial set of molecular barcodes and associated biological information.
Supplementary Material
XML Treatment for Thripidae
The reference list from the paper itself. Each links out to its DOI / PubMed record.
- 1Andersen LH, Nummi P, Rafn J, Frederiksen CMS, Kristjansen MP, Lauridsen TL, Trøjelsgaard K, Pertoldi C, Bruhn D, Bahrndorff S (2021) Can reed harvest be used as a management strategy for improving invertebrate biomass and diversity? Journal of Environmental Management 300: 113637. 10.1016/j.jenvman.2021.11363734521006 · doi ↗ · pubmed ↗
- 2Benson DA, Cavanaugh M, Clark K, Karsch-Mizrachi I, Lipman DJ, Ostell J, Sayers EW (2012) Gen Bank. Nucleic Acids Research 41: D 36–D 42. 10.1093/nar/gks 1195 PMC 353119023193287 · doi ↗ · pubmed ↗
- 3Bhatti JS (1998) Thrips in wetland habitats. Oriental Insects 32: 363–380. 10.1080/00305316.1998.10433782 · doi ↗
- 4Brinson MM, Malvárez AI (2002) Temperate freshwater wetlands: Types, status, and threats. Environmental Conservation 29: 115–133. 10.1017/S 0376892902000085 · doi ↗
- 5Camacho C, Coulouris G, Avagyan V, Ma N, Papadopoulos J, Bealer K, Madden TL (2009) BLAST+: Architecture and applications. BMC Bioinformatics 10: 421. 10.1186/1471-2105-10-421PMC 280385720003500 · doi ↗ · pubmed ↗
- 6Čížková H, Kučera T, Poulin B, Květ J (2023) Ecological basis of ecosystem services and management of wetlands dominated by common reed (Phragmites australis): European perspective. Diversity 15(5): 629. 10.3390/d 15050629 · doi ↗
- 7Criscuolo A, Gribaldo S (2010) BMGE (Block Mapping and Gathering with Entropy): A new software for selection of phylogenetic informative regions from multiple sequence alignments. BMC Evolutionary Biology 10: 210. 10.1186/1471-2148-10-210PMC 301775820626897 · doi ↗ · pubmed ↗
- 8Dijkema KS (1990) Salt and brackish marshes around the Baltic Sea and adjacent parts of the North Sea: Their vegetation and management. Biological Conservation 51: 191–209. 10.1016/0006-3207(90)90151-E · doi ↗
