Induction of Cellular Senescence by Pesticide Exposure in Human Umbilical Vein Endothelial Cells (HUVECs): Impacts on Telomerase Length, Cellular Morphology, and mtDNA Variation

TL;DR

This study shows that pesticide exposure causes aging-like changes in human blood vessel cells, affecting their structure and function.

Contribution

The study demonstrates that specific pesticides induce cellular senescence in endothelial cells through multiple biomarkers.

Findings

Pesticide exposure reduced cell viability and disrupted tube formation in endothelial cells.

Pesticides caused mitochondrial DNA changes and telomere shortening, signs of cellular aging.

Increased p21 and reduced Ki67 and TERT expression were observed, indicating senescence.

Abstract

Chronic exposure to pesticides represents a substantial risk to human health; however, their role in promoting cellular senescence remains poorly understood. It's well known that endothelial dysfunction is an early hallmark of aging‐related vascular damage. We employed Human Umbilical Vein Endothelial Cells (HUVECs) as an in vitro model for vascular endothelium to investigate whether pesticide exposure accelerates cellular senescence. The pesticides Boscalid (B), Pyraclostrobin (PY), Propamocarb (PR), and Lambda‐cyhalothrin (LC) were tested individually and in combination. Following pesticide exposure, we evaluated cell viability through MTS assay, Endothelial Tube Formation by Scanning Electron Microscopy (SEM), alteration in mitochondria through Mitochondrial DNA Copy Number (mtDNA) variation, and TOM20 evaluation, Telomere Length reduction, expression of p21, reduced Ki67, and TERT through Immunofluorescence. Our findings suggest that pesticides accelerate senescence in endothelial cells.

Figures

Statistical analysis of MTS assay. MTS assay results show cell viability of HUVECs under control conditions and after exposure to pesticides over different time points (A) MTS permorfed at 24 h of pesticides exposure in control HUVECs and treated HUVECs. (B) MTS permorfed at 48 h of pesticides exposure in control HUVECs and treated HUVECs. (C) MTS permorfed at 72 h of pesticides exposure in control HUVECs and treated HUVECs. (D) MTS permorfed at 10 days of pesticides exposure in control HUVECs and treated HUVECs. Results are shown as mean ± standard error (SEM) (n ≥ 3) of the optical percentage (%) of metabolically active cells (*p < 0.5, p < 0.01, *p < 0.001).

Effect of the different single treatments on in vitro HUVEC angiogenesis on GeltrexTM Reduced Growth Factor Basement Membrane Matrix. Scanning electron microscopy (SEM) was used to evaluate the formation of HUVEC in the in vitro tube‐like structure of 2‐D collagen type I after 10 days. (A) Cells are assembled in well‐defined structures in control samples; on the contrary, these structures, as well as cells, appear disorganized in the presence of the different pesticides (C−E). Thin tube‐like structures were present in cells treated with Boscalid (B), whilst HUVEC cultured in the presence of Pyraclostrobin (PY) evidenced more serious damage, with a thinning of the structure as well as an incomplete tubule formation (C). A slight thinning was observed for both single Lambda‐cyhalothrin (LC) (D) and Propamocarb (PR) treatments. (A−D) scale bar: 100 µm. (A1‐2, B1‐2, C1‐2, D1‐2) scale bar: 20 µm. The experiment was conducted in triplicate.

Effect of the different associations of treatments on in vitro HUVEC angiogenesis. The presence of Pyraclostrobin seems to more effectively change the tube‐like structure formation in HUVEC treated with Boscalid (A), with Boscalid and Lambda‐cyhalothrin association (B), or, to a lesser extent, in cells treated with Boscalid associated with Propamocarb (C). The association of Lambda‐cyhalothrin and Propamocarb seems less effective in altering HUVEC capability to form tube‐like structures. The experiment was conducted in triplicate. (A−D) scale bar: 100 µm. (A1‐2, B1‐2, C1‐2, D1‐2) scale bar: 20 µm.

Skeleton‐based quantitative analysis of endothelial tube formation. The figure shows histograms of the quantification of network parameters obtained from skeleton‐based analysis of the tube formation assay, including the number of branches, junctions, endpoints, and average branch length. Data are expressed as mean ± SEM and reflect the structural organization and angiogenic capacity of endothelial cells under the indicated experimental conditions. *p < 0.05, p < 0.01, *p < 0. 001. Control cells were cultured with 0.2% of DMSO.

Bar chart with the significant relative fold changes ± SD indicating the average TL in pesticide‐exposed HUVEC versus the control group after 10 days of treatment. Statistical analysis was performed using the 2–ΔΔCt method (all hypotheses were accepted), considering p values < 0.05 as significant. The experiment was conducted in triplicate.

Bar chart with the significant relative fold changes ± SD evidencing the average mtDNA copy number variation between the HUVEC exposed to pesticides and the control group after 10 days of treatment. Statistical analysis was performed using the 2–ΔΔCt method (all hypotheses were accepted), considering p values < 0.05 as significant. The experiment was conducted in triplicate. Control cells were cultured with 0.2% of DMSO.

(A) Immunofluorescence of TOM20. The figures show the labeling of TOM20 in HUVEC cells cultured alone and with pesticides for 10 days. The green fluorescence signal represents the protein, red fluorescence indicates activity, and blue fluorescence marks the nuclei. Control cells were cultured with 0.2% of DMSO.

Skeleton‐based quantitative analysis of TOM20 expression. The figure shows histograms of the evaluation of mitochondrial network parameters obtained from skeleton‐based analysis of TOM20 expression, including the number of branches, junctions, endpoints, and average branch length. Data are expressed as mean ± SEM and reflect the structural organization and angiogenic capacity of endothelial cells under the indicated experimental conditions. *p < 0.05, p < 0.01, *p < 0.001.

(A) Immunofluorescence of p21. The figure shows the labeling of p21 in HUVEC cells cultured alone and with pesticides for 10 days. The green fluorescence signal represents the protein, red fluorescence indicates activity, and blue fluorescence marks the nuclei. (B) Quantization of expression of p21 between HUVEC control and HUVEC treated with pesticides after 10 days of treatment. Immunofluorescence quantitative analysis expression was calculated as an arbitrary unit of fluorescence per cell surface unit (F/μm2). Data are expressed as mean ± S.E.M. *p < 0.05, p < 0.01, *p < 0.001. (C) Relative gene expression of p21. Histograms of real‐time PCR for p21‐related gene expression in untreated cells (CTRL) compared to treated cells. Statistical analysis was performed using the 2–ΔΔCt method (all hypotheses were accepted), considering p values < 0.05 as significant. The experiment was conducted in triplicate. Control cells were cultured with 0,2% of DMSO.

(A) Immunofluorescence of Ki67. Telomerase (TERT) expression was analyzed by Zeiss Axio Imager M2 optical microscope. The figures show the labeling of TERT in HUVEC cells cultured alone (positive and negative controls) and with pesticides for 10 days. The green fluorescence signal represents the protein, red fluorescence indicates activity, and blue fluorescence marks the nuclei. (B) Quantization of the expression of Ki67 between HUVEC control and HUVEC treated with pesticides after 10 days of treatment. Immunofluorescence quantitative analysis expression was calculated as an arbitrary unit of fluorescence per cell surface unit (F/μm2). Data are expressed as mean ± S.E.M. *p < 0.05, p < 0.01, *p < 0.001. (C) Relative gene expression of Ki67. Histograms of real‐time PCR for Ki67‐related gene expression in untreated cells (CTRL) compared to treated cells. Statistical analysis was performed using the 2−ΔΔCt method (all hypotheses were accepted), considering p values < 0.05 as significant. The experiment was conducted in triplicate. Control cells were cultured with 0.2% of DMSO.

(A) Immunofluorescence of telomerase (TERT). The figure shows the labeling of TERT in HUVEC cells cultured alone (positive and negative controls) and with pesticides for 10 days. The green fluorescence signal represents the protein, red fluorescence indicates activity, and blue fluorescence marks the nuclei. (B) Quantization of expression of TERT between HUVEC control and HUVEC treated with pesticides after 10 days of treatment. Immunofluorescence quantitative analysis expression was calculated as an arbitrary unit of fluorescence per cell surface unit (F/μm2). Data are expressed as mean ± S.E.M. *p < 0.05, p < 0.01, *p < 0.001. Control cells were cultured with 0.2% of DMSO.

Western Blotting Analysis of Telomerase (TERT). The figure shows TERT protein expression evaluated in HUVECs alone and treated with pesticides for 10 days. Densitometric measurements of protein bands expressed. Error bars: standard deviation (±SD) p < 0.01, *p < 0.001. Loading control: β‐actin. Control cells were cultured with 0.2% of DMSO.

Full text

Introduction

1

Endothelial aging plays a central role in the decline of vascular function and the development of age‐related cardiovascular diseases (Herrera et al. 2010). Senescent endothelial cells show reduced proliferation, impaired angiogenesis, mitochondrial dysfunction, and activation of pathways associated with cellular aging (Donato et al. 2015). Previous studies evidenced that the aging process of vascular endothelial cells is promoted by oxidative stress, which causes their telomeres to shorten prematurely (Voghel et al. 2010). Environmental stressors like pesticides have been shown to induce oxidative stress and inflammation, affecting TERT activity and endothelial health (Sule et al. 2022) (Mazzone et al. 2025). However, their specific effects on endothelial senescence are still not fully understood. The sublingual region, characterized by its rich vasculature and capacity for rapid absorption, represents a critical entry point for pollutant traces in foodstuffs and liquids (Shojaei 1998). This emphasizes the importance of studying the outcomes resulting from pesticide exposure on endothelial cells (Zhang et al. 2002).

In our study, four commonly used pesticides—Boscalid, Pyraclostrobin, Propamocarb, and Lambda‐cyhalothrin (LC) (European Food Safety et al. 2023)—were investigated, individually and in combination, on a vascular endothelium in vitro model of Human Umbilical Vein Endothelial Cells (HUVECs).

HUVECs are widely regarded as a standard and reliable in vitro model in laboratory settings. for investigating the physiology and pathophysiology of vascular endothelium (Jaffe et al. 1973).

Mitochondrial health is closely linked to endothelial function, with changes in mtDNA copy number and the expression of mitochondrial proteins, such as TOM20, reflecting mitochondrial stress, impaired biogenesis, and the onset of endothelial dysfunction (Panfilova et al. 2025; Picca et al. 2019). Moreover, mitochondrial dysfunction often coincides with telomere attrition and altered telomerase activity, creating a mitochondrion–telomere axis that accelerates cellular aging (Ahmed et al. 2008; Sahin and DePinho 2012). Senescence markers, including p21, reduced Ki‐67, and TERT, provide insight into the functional decline of endothelial cells, which ultimately impacts vascular repair and homeostasis (Campisi 2013; Picos et al. 2025). In addition, the Ki67 marker is widely used as a proliferation indicator; based on the literature, Ki67 levels reflect progression through the cell cycle (Della Rocca et al. 2024; Miller et al. 2018).

Based on these statements, we investigated the biological role of pesticides in aging acceleration on HUVEC cells, evaluating Metabolic Activity through MTS assay, Endothelial Tube Formation, reduction of Telomere Length Alteration in Mitochondria through Mitochondrial DNA (mtDNA) Copy Number Alteration, and evaluation of TOM20 expression, Immunofluorescence expression of the senescence markers p21, Ki67, and TERT.

Materials and Methods

2

Cell Culture Setup

2.1

HUVECs (C‐003‐5C) were obtained from Invitrogen Life Technologies Corporation (Eugene, Oregon, USA). The cells were unfrozen according to the manufacturer's instructions and grown in Human Large Vessel Endothelial Cell Basal Medium (formerly Medium 200) (M200500, Invitrogen, USA), supplemented with Low Serum Growth Supplement (S00310, Invitrogen, USA) and 10% fetal bovine serum (FBS, Invitrogen, USA). Experiments were conducted using cells at passage 3.

Concentration Calculation and Pesticide Solution Preparation

2.2

The pesticides Boscalid (AST1Y6P006) and Pyraclostrobin (AST1Y6D573) were purchased from Lab Instruments S.R.L. (Castellana Grotte, Italy), while Propamocarb (45638) and LC (31058) were acquired from Sigma Aldrich (St. Louis, MO, USA).

The concentrations of pesticides to use for the study were determined based on the methodologies described in our previous manuscript (Mazzone et al. 2025). The high Daily Nutritional Intake (hNDI) values were derived from Leveque et al. (2019) and establish the true level of contamination of French citizens from infancy to old age by individual pesticide compounds and are based on the method of the European Food Safety Authority (Leveque et al. 2019).

The hNDI calculation followed a process like that of the Theoretical Maximum Daily Intake (TMDI):

$$[eqn]$$

MRLi represents the maximum residue level in a specific food, and Fi denotes food consumption rates.

We included fruits and vegetables in the calculation of the hNDI because they are the main dietary source of pesticide exposure (Pesticide residues in food: latest figures released). In addition, the World Health Organization (WHO) dietary guidelines recommend a minimum daily consumption of 400 g of fruits and vegetables (Increasing fruit and vegetable consumption to reduce the risk of noncommunicable diseases). On the basis of this evidence, MRL data were retrieved from the EFSA database, which reports the maximum residue levels of pesticides (https://food.ec.europa.eu/plants/pesticides/eu-pesticides-database_en?utm_source=chatgpt.com). The hNDI values were first converted to mg/kg bw/day, then to g/L, and subsequently to mol/L for in vitro studies (citazione lavori Hochane e Leveque). To estimate the blood concentrations (mg/L and μmol/L) to which different organs could theoretically be exposed, complete absorption of the residue concentrations and their distribution in 5 L of blood in a 60 kg individual were assumed.

Following those considerations, the hNDI of the tested pesticides are:

• Boscalid: 11.06 μM
• Pyraclostrobim: 1.51 μM
• Propamocarb: 15.64 μM
• Lambda cyhalothrin: 0.19 μM

Pesticide powders were resuspended in 1 mL of DMSO; the final concentration of DMSO was 0.2%. The 0.2% concentration of DMSO was used for control cells.

Experimental Design

2.3

The study investigated the following experimental points:

• HUVEC cultured with 0.2% of DMSO (CTRL)
• HUVEC cultured with Boscalid 11.06 μM (B)
• HUVEC cultured with Pyraclostrobin 1.51 μM (PY)
• HUVEC cultured with Propamocarb 15.64 μM (PR)
• HUVEC cultured with LC 0.19 μM (LC)
• HUVEC cultured with Boscalid 11.06 μM + Pyraclostrobin 1.51 μM (B + PY)
• HUVEC cultured with Propamocarb 15.64 μM + LC 0.19 μM (PR + LC)
• HUVEC cultured with Boscalid 11.06 μM + Pyraclostrobin 1.51 μM + Propamocarb 15.64 μM (B + PY + PR)
• HUVEC cultured with Boscalid 11.06 μM + Pyraclostrobin 1.51 μM + LC 0.19 μM (B + PY + LC).

3‐(4,5‐Dimethyl‐2‐thiazolyl)‐2,5‐diphenyl‐2H‐tetrazolium Bromide (MTS) Assay

2.4

The comparative cytotoxicity trends of HUVEC cultured with and without pesticides was evaluated through the 3‐(4,5‐Dimethyl‐2‐thiazolyl)‐2,5‐diphenyl‐2H‐tetrazolium bromide (MTS) analysis (CellTiter 96 Aqueous One Solution Cell Proliferation Assay, Promega, Madison, WI, USA) (Figure 1) following the methodology below: 3 × 10^3^ cell/well were seeded into 96‐well plates with Human Large Vessel Endothelial Cell Basal Medium (M200500, Termofisher), supplemented with Low Serum Growth Supplement (LSGS) (S00310, Termofisher), and left in culture at 37°C for 24 h, 48 h, 72 h, and 10 days. The medium was changed every 2 days. Subsequent to cell growth for the designed time, MTS reagent was introduced in each well 1:10 dilution, and the plates were kept at 37°C for 3 h. The amount of formazan salts, a direct indicator of metabolic activity, was determined by absorbance at 490 nm using the Synergy HT Multi‐detection microplate reader (Biotech, Winooski, VT, USA) (Marconi et al. 2022). The experiment was performed thrice.

*Statistical analysis of MTS assay. MTS assay results show cell viability of HUVECs under control conditions and after exposure to pesticides over different time points (A) MTS permorfed at 24 h of pesticides exposure in control HUVECs and treated HUVECs. (B) MTS permorfed at 48 h of pesticides exposure in control HUVECs and treated HUVECs. (C) MTS permorfed at 72 h of pesticides exposure in control HUVECs and treated HUVECs. (D) MTS permorfed at 10 days of pesticides exposure in control HUVECs and treated HUVECs. Results are shown as mean ± standard error (SEM) (n ≥ 3) of the optical percentage (%) of metabolically active cells (*p < 0.5, **p < 0.01, **p < 0.001).

Scanning Electron Microscopy (SEM) E Tube Formation Assay

2.5

Human Umbilical Vein Endothelial Cells (HUVECs; Thermo Fisher Scientific) were grown following the guidelines. Pesticide exposure occurred for 10 days, changing the medium every 2 days. Untreated cells served as a reference.

Post‐exposure period, collection and seeding for the tube formation assay followed: Gel trexTM Reduced Growth Factor Basement Membrane Matrix (12760‐021, Thermo Fisher Scientific) was applied for the coating to the growth surface at 50–100 μL/cm² and kept at 37°C for 30 min to solidify. Treated and control cells were seeded on the Geltrex coated wells at a density of ~3.5–4.5 × 10⁴, in a final media of ~200 μL/cm².

3 h post‐seeding, the samples were preserved in 2% glutaraldehyde prepared in 0.1 M cacodylate buffer (pH 7.4; Sigma‐Aldrich), followed by post‐fixation with 1% osmium tetroxide (Sigma, Milan, Italy). The samples were then treated with a series of graded ethanol concentration series (25%, 50%, 70%, 80%, and 100%; Sigma‐Aldrich), critical‐point dried with hexamethyldisilane. (HMDS) and mounted on aluminum stubs. Subsequently, the samples were sputter‐coated with gold using an Edwards Sputter Coater B150S and examined under a Supra 40 Zeiss Scanning Electron Microscope (SEM; Zeiss Italia SRL, Milan, Italy) (Mattioli‐Belmonte et al. 2015).

Telomere Length and Mitochondrial DNA Copy Number (mtDNA‐CN) Evaluation in HUVEC Exposed to Pesticides

2.6

Genomic DNA was manually isolated from each HUVEC sample by the NucleoSpin miRNA and NucleoSpin RNA/DNA Buffer Set kit (Macherey‐Nagel, Germany). The purity and concentration of DNA were then evaluated using a UV–vis spectrophotometer NanoPhotometer (Implen, GmbH, Munich, Germany). The mean telomere length (TL) and mtDNA‐CN were measured in treated HUVEC versus untreated HUVEC using quantitative PCR (qPCR) and the Absolute Human TL and mtDNA‐CN Dual Quantification qPCR Assay Kit (ScienCell Research Laboratories, Carlsbad, CA, USA) in accordance with the manufacturer's guidelines. For the qPCR analysis, targeted primers for telomere and mtDNA primers were employed (FW: 5′‐GCCGATTGTGAACATGGACTAGG‐3′; REV: 5′‐ 5′‐GCTCGTAGTTGAGCACGCTGAA‐3′), as well as internal standards, like a single‐copy gene reference (SCR) primer pair, designed to identify and amplify a 100 bp‐long region on human chromosome 17, which acts as a calibrator for normalizing data. In addition, a reference genomic DNA sample already contained in the kit, with known TL and mtDNA copy number, served as a reference for calculating the TL and the mtDNA copy number of the target HUVEC samples. The thermal cycling profile was the following: 95°C for 10 min and 32 cycles of 95°C for 20 s, 52°C for 20 s and 72°C for 45 s. A melting stage was added at the end of amplification, and all samples were tested in triplicate on a QuantStudio 7 Pro Real‐Time PCR detection system (Life Technologies, Carlsbad, CA, USA). Statistical analysis was performed using the 2–ΔΔCt method, considering p values < 0.05 as significant.

Immunofluorescence Evaluation for p21, Ki67, and TERT

2.7

HUVECs (10,000 cells) were cultured on autoclaved glass coverslips (1943‐10012A, Bellco Glass, Vineland, NJ) and treated for 10 days, changing the treatment every 2 days. Fixation occurred in periodate‐lysine‐paraformaldehyde (PLP) buffer for 30 min at 4°C, rinsed using PB three times, and permeabilized with 0.5% Triton X‐100 (9474680 K, LKB‐Produkter AB, Bromma, Sweden). Blocking was performed using 5% skim milk. The primary antibodies (rabbit anti‐telomerase, ZJ4491729A, 1:300, ThermoFisher; mouse anti‐p21, cat#14‐6715‐81, 1:400, ThermoFisher; mouse anti‐Ki67, MA5‐14520, ThermoFisher) were prepared in a blocking buffer and kept for 2 h RT, except for the negative control. Following washes, Alexa Fluor 488‐conjugated goat anti‐rabbit (1:400, 1851447, Life Technologies) and anti‐mouse (1:400, A11029, Termofisher) secondary antibodies and rhodamine‐phalloidin, to stain actin, (1:150, 2892779, Life Technologies) were applied. Coverslips were prepared using a mounting medium containing ProLong Gold Antifade containing DAPI to stain nuclei (2770862, Life Technologies) and observed with a Zeiss Axio Imager M2 optical microscope (Carl Zeiss, Jena, Germany) with a ×63 oil‐immersion objective.

Immunofluorescence for TOM20 Evaluation

2.8

6.4 × 10^4^/well of HUVECs were cultured into an 8‐well culture glass slide (Corning, Glendale, AZ, USA) without and with pesticides; after 10 days, the cells were fixed with 0.4% paraformaldehyde (PFA) (BioOptica, Milan, Italy) for 1 h at RT. After 3 washes in PBS, the permeabilization occurred for 6 min in 0.1% Triton X‐100 (BioOptica). Thus, the cells were blocked for 1 h with 5% of non‐fat milk in PBS and incubated overnight at 4°C with the primary antibodies anti‐TOM20 (sc‐17764, 1:200, Santa Cruz). The day after, the samples were first incubated with the secondary antibodies Goat anti‐Mouse IgG (H + L) Highly Cross‐Adsorbed Secondary Antibody, Alexa Fluor 568 (A11031, Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA concentrated 1:200 and kept 1 h at 37°C. Actin was stained with Alexa Fluor 488 phalloidin green fluorescent conjugate (A12379, Invitrogen), while nuclei were stained with TOPRO (T3605, Invitrogen). A Zeiss LSM800 confocal system (Carl Zeiss, Jena, Germany) took the picture trough a Plan Neofluar oil‐immersion objective (63 × 1.3 NA). Images were collected using an argon laser beam with excitation lines at 488 nm and a helium–neon source (543 and 665 nm) with an image size resolution of 1024 × 1024 pixels.

Western Blot Analysis for TERT

2.9

A total of 40 µg of protein, extracted from HUVECs cultured either alone or in the presence of pesticides, was loaded onto a polyacrylamide gel and separated via electrophoresis. Proteins were then transferred onto a polyvinylidene fluoride (PVDF) membrane using a semi‐dry blotting system (Bio‐Rad Laboratories Srl, Milan, Italy). The membrane was blocked with 5% skimmed milk in PBS containing 0.1% Tween‐20 (Sigma‐Aldrich, Saint Louis, MO, USA) and subsequently incubated overnight at 4°C with primary anti‐TERT antibodies (1:500; sc 393013, Santa Cruz Biotechnology). β‐Actin (1:750; sc‐47778, Santa Cruz Biotechnology) was employed as a loading control. Detection of the primary antibodies was performed by incubating the membrane for 1 h at room temperature with a peroxidase‐conjugated goat anti‐mouse secondary antibody (1:5000; A90‐116P, Bethyl Laboratories Inc., Montgomery, TX, USA) diluted in 2.5% skimmed milk in PBS containing 0.1% Tween‐20. The membrane was subsequently washed three times with PBS/0.1% Tween‐20. Protein expression was visualized using the Chemidoc MP Imaging System (Bio‐Rad, Segrate, Italy), and densitometric values were normalized to β‐actin levels. All experiments were performed in triplicate.

Analysis of Tube Test Formation Assay (Cellular Morphology) and TOM20 (Mitochondrial Organization)

2.10

Quantitative analysis of cellular morphology and mitochondrial organization was performed using Fiji/ImageJ (v1.54p, National Institutes of Health, Bethesda, MD, USA). For the tube formation assay, phase‐contrast images were first converted to 8‐bit grayscale and subjected to thresholding to generate binary masks of tubular structures. Skeletonization was then performed (Process → Binary → Skeletonize), and the resulting skeletons were analyzed using the Analyze Skeleton (2D/3D) plugin to quantify the number of branches and endpoints, as well as branch length, following established protocols (3D reconstruction of histological sections: application to mammary gland tissue). For mitochondrial network analysis, TOM20‐labeled mitochondria were similarly pre‐processed (8‐bit conversion, thresholding, and ROI selection for single cells) and skeletonized, followed by skeleton‐based quantification of endpoints, branches, junctions, and branch length. These parameters were used to assess mitochondrial morphology and connectivity, allowing identification of fragmentation or altered network integrity (A simple ImageJ macro tool for analyzing mitochondrial network morphology). All analyses were performed with identical settings across images and in a blinded manner to experimental conditions.

Quantification of Protein Expression in Immunofluorescence

2.11

Quantification of the proteins was performed using ImageJ software (version 8, National Institutes of Health, Bethesda, MD, USA) based on the established protocols (Schneider et al. 2012; Collins 2007). Regions of interest (ROIs) were selected either manually or using threshold‐based automated segmentation, and the mean fluorescence intensity within each ROI was calculated. Background fluorescence was subtracted using a rolling‐ball algorithm to correct for non‐specific signal and ensure accuracy. To minimize bias, measurements were performed blinded to the sample identity, and multiple images per sample were averaged. The resulting values were normalized relative to the control group to account for inter‐experimental variability, allowing quantitative comparison across samples.

Statistical Analysis

2.12

The statistical analysis was carried out using one‐way ANOVA and post hoc Tukey's multiple comparisons test using GraphPad 5 (GraphPad, San Diego, CA, USA) software. All differences were considered statistically significant for values of p < 0.05. The comparative 2−ΔΔCt method was employed.

Results

3

Cell Viability (MTS)

3.1

The MTS assay revealed time‐dependent differences in cell viability between control and pesticide‐treated HUVECs (Figure 1). At shorter treatment durations (24 and 48 h), pesticide‐treated cells showed moderate reductions in viability compared to the control. By 72 h, the decline in viability became more pronounced across all treated groups.

After 10 days, Pyraclostrobin was identified as the most cytotoxic pesticide, causing the highest reduction in cytotoxicity trends compared to the other treatments.

SEM and Tube Formation Assay

3.2

SEM was used to evaluate the formation of HUVEC in the in vitro tube‐like structure of 2‐D collagen type I after 10 days (Figures 2 and 3). Cells are assembled in well‐defined structures in control samples (Figure 2, A‐A2), on the contrary, these structures, as well as cells, appear disorganized in the presence of the different pesticides (Figures 2 and 3). Thin tube‐like structures were present in cells treated with Boscalid (Figure 2, B‐B2), whilst HUVEC cultured in the presence of Pyraclostrobin evidenced higher damage, with a thinning of the structure as well as an incomplete tubule formation (Figure 2, D‐D2). A slight thinning was observed for both single LC (Figure 2, C‐C2) and Propamocarb treatments (Figure 2, E‐E2). The presence of Pyraclostrobin seems to more effectively change the tube‐like structure formation in HUVEC treated with Boscalid (Figure 3, A‐A2), with Boscalid and LC association (Figure 3, C‐C2) or, to a lesser extent, in cells treated with Boscalid associated with Propamocarb (Figure 3, B‐B2). The association of LC and Propamocarb seems less effective in altering HUVEC capability to form tube‐like structures (Figure 3, D‐D2).

Effect of the different single treatments on in vitro HUVEC angiogenesis on GeltrexTM Reduced Growth Factor Basement Membrane Matrix. Scanning electron microscopy (SEM) was used to evaluate the formation of HUVEC in the in vitro tube‐like structure of 2‐D collagen type I after 10 days. (A) Cells are assembled in well‐defined structures in control samples; on the contrary, these structures, as well as cells, appear disorganized in the presence of the different pesticides (C−E). Thin tube‐like structures were present in cells treated with Boscalid (B), whilst HUVEC cultured in the presence of Pyraclostrobin (PY) evidenced more serious damage, with a thinning of the structure as well as an incomplete tubule formation (C). A slight thinning was observed for both single Lambda‐cyhalothrin (LC) (D) and Propamocarb (PR) treatments. (A−D) scale bar: 100 µm. (A1‐2, B1‐2, C1‐2, D1‐2) scale bar: 20 µm. The experiment was conducted in triplicate.

Effect of the different associations of treatments on in vitro HUVEC angiogenesis. The presence of Pyraclostrobin seems to more effectively change the tube‐like structure formation in HUVEC treated with Boscalid (A), with Boscalid and Lambda‐cyhalothrin association (B), or, to a lesser extent, in cells treated with Boscalid associated with Propamocarb (C). The association of Lambda‐cyhalothrin and Propamocarb seems less effective in altering HUVEC capability to form tube‐like structures. The experiment was conducted in triplicate. (A−D) scale bar: 100 µm. (A1‐2, B1‐2, C1‐2, D1‐2) scale bar: 20 µm.

The analysis conducted by the ImageJ software (Figure 4) confirmed the evaluation by SEM; Figure 4 shows the values of the number of branches, number of junctions, number of endpoints, as well as branch length. The values result in an alteration in HUVECs exposed to pesticides when compared to control cells. In fact, the number of branches and of junctions is higher in control cells compared to pesticide‐exposed cells, indicative of preserved angiogenic capacity and proper vascular network organization. On the other hand, control cells display a reduced number of endpoints when compared to treated cells, consistent with the formation of a well‐connected and stable endothelial network. The average of branches is significantly improved in control cells compared to treated cells, indicative of enhanced tubule elongation and the formation of a more mature and interconnected vascular network.

*Skeleton‐based quantitative analysis of endothelial tube formation. The figure shows histograms of the quantification of network parameters obtained from skeleton‐based analysis of the tube formation assay, including the number of branches, junctions, endpoints, and average branch length. Data are expressed as mean ± SEM and reflect the structural organization and angiogenic capacity of endothelial cells under the indicated experimental conditions. *p < 0.05, **p < 0.01, **p < 0. 001. Control cells were cultured with 0.2% of DMSO.

Decrease of Average TL and Variation of the mtDNA‐CN in HUVEC Exposed to Pesticides Compared to Controls

3.3

Average TL and mtDNA‐CN were evaluated in the HUVEC exposed to Boscalid (B), Lamba‐cyhalothrin (LC), Pyraclostrobin (PY), Propamocarb (PR), as well as the combination of Boscalid + Pyraclostrobin (B + PY), Boscalid + Pyraclostrobin + Propamocarb (B + PY + PR), Boscalid+Pyraclostrobin + LC (B + PY + LC) and Propamocarb + LC (PR + LC) compared to non‐exposed controls. Following statistical analysis, a significantly lower relative TL of the target sample to the reference sample was evidenced in the pesticide‐exposed HUVEC compared to the corresponding controls (Figure 5), indicating a potential correlation between exposure to pesticides and shorter TL. In addition, a variation in the mtDNA‐CN was further highlighted. More specifically, mtDNA‐CN was found to be lower in the HUVEC treated with B, LC, PY, PR, B + PY and PR + LC compared to untreated controls, and higher in the HUVEC treated with B + PY + PR and B + PY + LC versus controls (Figure 6).

Bar chart with the significant relative fold changes ± SD indicating the average TL in pesticide‐exposed HUVEC versus the control group after 10 days of treatment. Statistical analysis was performed using the 2–ΔΔCt method (all hypotheses were accepted), considering p values < 0.05 as significant. The experiment was conducted in triplicate.

Bar chart with the significant relative fold changes ± SD evidencing the average mtDNA copy number variation between the HUVEC exposed to pesticides and the control group after 10 days of treatment. Statistical analysis was performed using the 2–ΔΔCt method (all hypotheses were accepted), considering p values < 0.05 as significant. The experiment was conducted in triplicate. Control cells were cultured with 0.2% of DMSO.

Immunofluorescence Evaluation and Protein Quantification of p21, Ki67, and TERT

3.4

The fluorescence images (Figures 9, 10, 11) show the presence of p21, Ki67, and TERT in HUVEC cultured alone and/or with pesticides for 10 days. The marker p21 resulted in higher expression in HUVECs exposed to pesticides compared to control cells. The upregulation of p21 is followed by the downregulation of Ki67. Combinations of pesticides determine the highest expression of p21 and, of consequence, the highest reduction of Ki67. Among the single pesticides, LC and Propamocarb showed the most pronounced decrease in Ki67 levels relative to the other pesticides showed the most pronounced decrease in Ki67 levels relative to the other pesticides

The immunolabeling of TERT suggests a decrease in labeling in the treated samples compared to the untreated ones. LC exhibited the strongest inhibitory effect among the individual pesticides, showing the lowest TERT expression levels. Compared to the control point, all tested pesticides caused a reduction in TERT expression, with varying degrees of downregulation.

A subsequent quantitative analysis of p21 (Figure 9B), Ki67 (Figure 10B), and TERT (Figure 11B) confirmed the qualitative validation.

Immunofluorescence Evaluation and Analysis of TOM20

3.5

TOM20 expression was evaluated in treated and untreated HUVECs (Figure 7). The skeleton‐based analysis of the marker (Figure 8), conducted with ImageJ, reveals an alteration in the mitochondrial network in treated cells compared to control cells. In fact, while control cells reveal a moderate number of endpoints, treated cells show increased endpoints and reduced branch length, indicative of mitochondrial fragmentation, and decreased endpoints and elongated branches suggest hyperfused or highly interconnected networks.

(A) Immunofluorescence of TOM20. The figures show the labeling of TOM20 in HUVEC cells cultured alone and with pesticides for 10 days. The green fluorescence signal represents the protein, red fluorescence indicates activity, and blue fluorescence marks the nuclei. Control cells were cultured with 0.2% of DMSO.

*Skeleton‐based quantitative analysis of TOM20 expression. The figure shows histograms of the evaluation of mitochondrial network parameters obtained from skeleton‐based analysis of TOM20 expression, including the number of branches, junctions, endpoints, and average branch length. Data are expressed as mean ± SEM and reflect the structural organization and angiogenic capacity of endothelial cells under the indicated experimental conditions. *p < 0.05, **p < 0.01, **p < 0.001.

Discussion

4

The present study investigated the biological effects of the pesticides Boscalid (B), Pyraclostrobin (PY), Propamocarb (PR), and LC on HUVEC, with a focus on their potential to accelerate cellular aging. Cell viability was assessed using the MTS assay, while alterations in vascular formation were evaluated through a tube formation assay. Structural changes were analyzed by SEM. Cellular aging was further examined by assessing TL reduction, mitochondrial alterations through mtDNA copy number variation and TOM20 expression, and the immunofluorescent expression of the markers p21, Ki67, and TERT. The null hypotheses tested had to be rejected.

Pesticides are well known to cause genetic mutations, telomere shortening (linked to aging and oxidative stress), and various health issues, including endothelial dysfunction. Endothelial tissue lines the blood vessels and is a key regulator of vascular homeostasis, including nitric oxide production, vascular permeability, and blood flow control (Rubanyi 1993). These functions can be lost in the presence of aging processes, which contribute directly to vascular dysfunction seen in aging and cardiovascular diseases (Hwang et al. 2022).

HUVECs derive from the human umbilical vein and represent an optimum in vitro model for endothelial tissue since they closely mimic its functional properties in adult vasculature, including the expression of specific markers such as von Willebrand factor, PECAM‐1, and vascular endothelial cadherin (Medina‐Leyte et al. 2020). Furthermore, their ability to respond to oxidative stress, inflammatory stimuli, and changes in vascular permeability make them particularly suitable for studying the cellular responses to pesticide exposure (Cao et al. 2017). Mitochondria, vital for energy production and cellular homeostasis, are also major pesticide targets (Das et al. 2025). Exposure to pesticides can damage mitochondrial DNA, alter its copy number, disrupt energy production, and induce oxidative stress, apoptosis, and cell death (Reddam et al. 2022).

The results of the MTS assay underscore the significant impact of pesticide exposure on HUVEC viability in a time‐dependent manner. At earlier time points (24 h and 48 h), the observed reductions in cell viability among pesticide‐treated groups were moderate, suggesting an initial adaptive response or partial resistance to the cytotoxic effects. However, the prolonged exposure over 72 h led to a substantial decline in cell viability, highlighting the cumulative toxic effects of these chemicals (Hu et al. 2015). Notably, Pyraclostrobin emerged as the most cytotoxic pesticide following 10 days of treatment, exhibiting the greatest reduction in cell viability compared to the other pesticides. These findings align with previous studies indicating the potential for strobilurin‐class fungicides, such as Pyraclostrobin, to induce oxidative stress and disrupt cellular homeostasis (Luz et al. 2018; Wang et al. 2021).

The SEM results, shown in Figures 2 and 3, indicate that exposure to different pesticides significantly affects the angiogenic potential of HUVECs. In fact, in control conditions, HUVECs formed well‐defined and organized tube‐like structures, indicative of normal angiogenesis. In contrast, treatment with pesticides led to varying levels of structural disruption. Through the single treatment, thin tube‐like structures were observed in samples treated with B, suggesting a partial impairment in angiogenesis, while PY treatment resulted in more severe effects, characterized by pronounced thinning and incomplete tubule formation; less pronounced effects were observed with the LC and PR pesticides that caused slight thinning of the structures. In combined treatments, the disorganization of tube‐like structures observed in the presence of PY was most evident in the association with B, followed by the combination of B and LC, and to a lesser extent in samples treated with B and PR. Conversely, the combination of LC and PR had a comparatively minimal effect on the ability of HUVECs to form tube‐like structures. The skeleton‐based metrics are used to assess the morphology and complexity of capillary‐like networks formed by endothelial cells in vitro (Carpentier et al. 2020). Branches reflect the number of linear connections in the network, while junctions represent branching points that contribute to network complexity and stability. Endpoints are terminal points and increase when tubules are fragmented or poorly connected. Branch length measures the extension of individual tubes and indicates how continuous the network is (DeCicco‐Skinner et al. 2014). HUVECs untreated showed higher numbers of branches and junctions, fewer endpoints, and longer branch lengths, consistent with robust, interconnected networks, whereas pesticide‐exposed cells showed fewer branches and junctions, more endpoints, and shorter branch lengths, indicating simpler and fragmented structures. Among the treatments, B and LC resulted in the most significant alteration of the angiogenic process compared to the other experimental points and to the control cells.

Additionally, results of TL (Figure 5) revealed that all pesticide treatments resulted in significantly shorter telomeres compared to control cells, suggesting pesticide exposure accelerates telomere attrition in endothelial cells. TL is a crucial marker of cellular aging and replicative potential; thus, shorter telomeres indicate an increase in cellular senescence and dysfunction. (Sanders and Newman 2013).

Dysfunction of the mitochondrial network was evaluated through analysis of mtDNA copy number and TOM20 expression. Figure 6 revealed that the combinations B + PY + PR and B + PY + LC led to a significant increase in mtDNA levels compared to CTRL, while the other pesticides caused a significant decrease when compared to untreated cells. Decrease of mtDNA‐CN can affect mitochondrial function, as in the case of extensive oxidative stress, which exceeds the mitochondrial capacity to make up for oxidative damage and reduce mtDNA content. An increase, on the other hand, may aim to compensate for mtDNA damage and mitochondrial dysfunction (Liu et al. 2003; Wang et al. 2011).

Changes in TOM20 signal patterns correlate with alterations in mitochondrial network morphology under different cellular conditions (Wurm et al. 2011). Quantitative skeleton‐based analysis (Figure 8) of TOM20‐labeled mitochondria (Figure 7) (Arganda‐Carreras et al. 2010; Valente et al. 2017) revealed significant alterations in mitochondrial network architecture in treated cells compared to control cells. Indeed, all the cells exposed to pesticides showed a significant increase in the number of endpoints as well as a significant reduction in the number of branches, number of junctions, and average branch length. An increase in the number of endpoints, together with a reduction in mean branch length, is indicative of mitochondrial fragmentation, a hallmark of enhanced fission or mitochondrial stress (Bakare et al. 2021). Endpoints represent free mitochondrial termini, and their increase reflects the presence of short, disconnected mitochondrial elements rather than an interconnected tubular network (Harwig et al. 2018). Consistently, reduced branch length suggests shortening of mitochondrial tubes, further supporting a fragmented phenotype (Bakare et al. 2021). The increase in the number of branches in combination with elevated endpoints and decreased branch length is characteristic of a shift toward fission‐dominated mitochondrial dynamics (Chen and Chan 2004). This pattern has been widely associated with mitochondrial dysfunction, cellular stress responses, and impaired bioenergetic capacity (Westermann 2010; Youle and van der Bliek 2012). The

Additionally, the immunofluorescence of the markers p21 (Figure 9), Ki‐67 (Figure 10), and TERT (Figure 11) were evaluated. p21 is a cell cycle inhibitor at the G1/S checkpoint. When localized in the nucleus, p21 inhibits the activity of CDK2 and CDK4, leading to cell cycle arrest, reduced cellular proliferation, and decreased Ki‐67 expression. Moreover, p21 integrates signals related to DNA damage, oncogenic stress, cellular senescence, and differentiationKi‐67 is widely used as a marker of cellular proliferation, as it is expressed in all active phases of the cell cycle (G1, S, G2, and M) but absent in quiescent (G0) cells (Sun and Kaufman 2018). Based on the literature, an increase in expression of p21 can be related to a decrease in Ki67 (Itahana et al. 2002). Figure 9 showed that all the treated cells exhibited a significant increase in expression of p21 when compared to control cells (Figure 9); in parallel, the pesticide‐exposed cells revealed a significant decrease in Ki67 when compared to untreated HUVECs (Figure 10). Among the treatments, the pesticide combination B + PY + PR determined the highest expression of p21 and, consequently, the lowest expression of Ki67 when compared to other experimental points and to CTRL. The decrease of the marker Ki67 suggest that exposure to pesticides not only determines cytotoxicity, as shown by the MTS evaluation (Figure 1), but also the reduction of cell proliferation. The Western Blot analysis, shown in Figure 12, confirmed the Immunofluorescence evaluation of the marker TERT.

*(A) Immunofluorescence of p21. The figure shows the labeling of p21 in HUVEC cells cultured alone and with pesticides for 10 days. The green fluorescence signal represents the protein, red fluorescence indicates activity, and blue fluorescence marks the nuclei. (B) Quantization of expression of p21 between HUVEC control and HUVEC treated with pesticides after 10 days of treatment. Immunofluorescence quantitative analysis expression was calculated as an arbitrary unit of fluorescence per cell surface unit (F/μm2). Data are expressed as mean ± S.E.M. *p < 0.05, **p < 0.01, **p < 0.001. (C) Relative gene expression of p21. Histograms of real‐time PCR for p21‐related gene expression in untreated cells (CTRL) compared to treated cells. Statistical analysis was performed using the 2–ΔΔCt method (all hypotheses were accepted), considering p values < 0.05 as significant. The experiment was conducted in triplicate. Control cells were cultured with 0,2% of DMSO.

*(A) Immunofluorescence of Ki67. Telomerase (TERT) expression was analyzed by Zeiss Axio Imager M2 optical microscope. The figures show the labeling of TERT in HUVEC cells cultured alone (positive and negative controls) and with pesticides for 10 days. The green fluorescence signal represents the protein, red fluorescence indicates activity, and blue fluorescence marks the nuclei. (B) Quantization of the expression of Ki67 between HUVEC control and HUVEC treated with pesticides after 10 days of treatment. Immunofluorescence quantitative analysis expression was calculated as an arbitrary unit of fluorescence per cell surface unit (F/μm2). Data are expressed as mean ± S.E.M. *p < 0.05, **p < 0.01, **p < 0.001. (C) Relative gene expression of Ki67. Histograms of real‐time PCR for Ki67‐related gene expression in untreated cells (CTRL) compared to treated cells. Statistical analysis was performed using the 2−ΔΔCt method (all hypotheses were accepted), considering p values < 0.05 as significant. The experiment was conducted in triplicate. Control cells were cultured with 0.2% of DMSO.

*(A) Immunofluorescence of telomerase (TERT). The figure shows the labeling of TERT in HUVEC cells cultured alone (positive and negative controls) and with pesticides for 10 days. The green fluorescence signal represents the protein, red fluorescence indicates activity, and blue fluorescence marks the nuclei. (B) Quantization of expression of TERT between HUVEC control and HUVEC treated with pesticides after 10 days of treatment. Immunofluorescence quantitative analysis expression was calculated as an arbitrary unit of fluorescence per cell surface unit (F/μm2). Data are expressed as mean ± S.E.M. *p < 0.05, **p < 0.01, **p < 0.001. Control cells were cultured with 0.2% of DMSO.

*Western Blotting Analysis of Telomerase (TERT). The figure shows TERT protein expression evaluated in HUVECs alone and treated with pesticides for 10 days. Densitometric measurements of protein bands expressed. Error bars: standard deviation (±SD) **p < 0.01, **p < 0.001. Loading control: β‐actin. Control cells were cultured with 0.2% of DMSO.

TERT, as the catalytic subunit of telomerase, is essential for the elongation and stabilization of telomeres. A decrease in TERT expression leads to an inability to fully maintain TL, accelerating cellular aging and increasing the risk of senescence and apoptosis (Rossiello et al. 2022). The perinuclear localization of immunolabeling, displayed in Figure 11, suggests that the perinuclear localization of TERT may facilitate its transfer to mitochondria, where it plays a critical role in maintaining mitochondrial integrity and cellular protection. (Sharma et al. 2012). Therefore, further investigations are needed to elucidate the mechanisms governing TERT's subcellular distribution and its specific role in mitochondrial function, particularly under conditions of pesticide exposure, which may impair endothelial functionality.

Conclusions

5

Despite the in vitro limitations of the current work, this study suggests that exposure to Boscalid, Pyraclostrobin, Propamocarb, and LC led to a synergistic relationship between telomere attrition and mitochondrial dysfunction, accelerating endothelial aging and senescence. These findings underscore the potential role of pesticide exposure in vascular dysfunction and aging‐related diseases, emphasizing the need for further research and regulatory measures to mitigate their impact on human health.

Future research will focus on in vivo studies to further underline pesticides’ role in accelerating the senescence process, providing a more comprehensive understanding of the investigated phenomenon.

Author Contributions

Valentina Gatta: conceptualization, validation, resources, data curation, writing – review and editing, visualization, supervision. Antonio Nanci: conceptualization, validation, formal analysis, writing – review and editing, visualization, supervision. Oriana Trubiani: conceptualization, validation, formal analysis, resources, data curation, writing – original draft preparation, visualization, supervision, project administration, funding acquisition. Francesca Diomede: conceptualization, validation, resources, data curation, writing – review and editing, visualization, supervision, project administration, funding acquisition. Jacopo Pizzicannella: conceptualization, validation, resources, data curation, writing – original draft preparation, visualization, supervision, project administration, funding acquisition. Antonella Mazzone: methodology, software, formal analysis, investigation, writing – original draft preparation. Fani Konstantinidou: methodology, software, formal analysis, investigation, writing – original draft preparation. Daniela Lamanna: methodology, software, investigation, writing – review and editing. Ylenia Della Rocca: methodology, writing – review and editing, visualization. Dainelys Guadarrama Bello: methodology, software, investigation, writing – review and editing. Guya Diletta Marconi: methodology, software, formal analysis, investigation, resources, writing – review and editing, visualization. Rossana Falcone: software, formal analysis, writing – review and editing, visualization. Monica Mattioli‐Belmonte: validation, formal analysis, data curation, writing – original draft preparation, visualization, supervision.

Disclosure

The statements, opinions, and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of Wiley and/or the editor(s). Wiley and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions, or products referred to in the content. Charter count (including blanks): 34.105.

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

greyscale SPLIT CHANNELS TOM20.

SPLIT CHANNELS TOM20.