Duck IFNγ Restricts Duck Tembusu Virus Replication by Disrupting Viral RNA Synthesis/Translation

TL;DR

Duck interferon-gamma protects against duck Tembusu virus by stopping viral replication and activating the duck's immune defenses.

Contribution

This study reveals the dual antiviral mechanism of duck IFNγ against DTMUV, including RNA disruption and immune pathway activation.

Findings

Duck IFNγ prevents DTMUV replication and clears existing virus in infected cells.

Duck IFNγ disrupts viral RNA synthesis and translation.

Duck IFNγ activates host defense pathways like programmed cell death and RIG-I-like receptor signaling.

Abstract

The emergence of Duck Tembusu Virus (DTMUV), an avian pathogenic flavivirus, continues to be a major and persistent threat to the global waterfowl industry, resulting in substantial economic losses. Given that previous studies have shown Type I interferons offer insufficient protection, identifying novel and effective biotherapeutic strategies is critically important for veterinary disease control. A natural substance in the body called interferon-gamma is known to fight a wide range of viruses. However, its specific antiviral efficacy against Tembusu virus and the underlying mechanisms of action have not been reported in prior studies. This study aimed to investigate whether and how duck interferon-gamma can protect against this virus. We first found that the virus triggers duck cells to produce interferon-gamma. More importantly, experiments showed that this interferon-gamma has a strong dual protective effect: it can both prevent healthy duck cells from being infected and help already infected cells clear the virus. We discovered that it works by blocking the virus’s ability to make copies of itself inside cells. By analyzing all the genes turned on in cells treated with interferon-gamma, we identified that it activates the cell’s own defense systems, particularly those related to controlled cell death and early virus detection. In conclusion, this research clearly demonstrates that duck interferon-gamma is a powerful natural weapon against the duck Tembusu virus. These findings are valuable because they provide a solid scientific basis for developing new treatments, such as using interferon-gamma itself or the natural defense molecules it activates, to control this damaging poultry disease, which could help protect farmers’ livelihoods and ensure a stable supply of duck meat or eggs.

Duck Tembusu virus (DTMUV), an emerging Flavivirus, is a major avian pathogen that imposes enormous economic losses on the global duck industry, necessitating urgent development of effective countermeasures. Although Interferon-gamma (IFNγ) is a crucial broad-spectrum antiviral cytokine, its role against DTMUV infection remains mechanistically undefined. In this study, we first demonstrated that DTMUV induced duck IFNγ (duIFNγ) production in immune and non-immune cells. Importantly, duIFNγ exhibited a dual anti-DTMUV function in vitro: it not only prevented viral replication but also displayed the capacity to clear existing virus from infected cells. Mechanistically, cycloheximide (CHX) experiments confirmed that duIFNγ exerts its antiviral effect by disrupting the viral RNA synthesis/translation phase. Furthermore, transcriptomic profiling (RNA-seq) precisely revealed that duIFNγ restricts DTMUV replication by activating multiple host defense pathways, notably Programmed Cell Death (e.g., Caspase signaling) and the RIG-I-like Receptor (RLR) signaling pathways. Collectively, these findings provide critical insights into the function and mechanism of duIFNγ in combating DTMUV in vitro, laying a robust theoretical foundation for exploring duIFNγ or its induced effectors as novel therapeutics for DTMUV infection.

Figures

Full text

1. Introduction

Duck Tembusu Virus (DTMUV), an emerging Flavivirus, represents a severe and significant threat to global waterfowl farming. Since its emergence in 2010, DTMUV has caused widespread outbreaks characterized by high morbidity, severe neurological signs (ataxia), and devastating losses in egg production (up to 90%), resulting in substantial economic damage [1,2]. The virus also poses a zoonotic risk, necessitating urgent development of effective control strategies for both animal health and public safety [3,4,5].

The host’s primary defense relies on the Interferon (IFN) system, categorized into Type I, Type II, and Type III IFNs [6]. While Type I IFNs initiate a rapid antiviral state, many Flaviviruses have evolved mechanisms to antagonize this pathway [7,8]. This challenges the efficacy of Type I IFN-based therapeutics and underscores the need to explore Type II IFN, or IFN-gamma (IFNγ), which operates via the distinct IFNγ receptor (IFNGR) signaling pathway [9].

IFNγ is essential for bridging innate and adaptive immunity and is critical for clearing intracellular pathogens [10,11,12]. In veterinary medicine, recombinant duck IFNγ (duIFNγ) has demonstrated protective efficacy against other economically important waterfowl viruses (duck hepatitis B virus, duck plague virus) [13,14,15], highlighting its therapeutic potential. However, the precise antiviral mechanism of duIFNγ against DTMUV, particularly the host defense pathways it engages, remains systematically undefined.

This study addresses this critical gap by first characterizing the anti-DTMUV activity of duIFNγ. Our in vitro results reveal a dual protective function: duIFNγ not only blocks de novo viral replication but also possesses the ability to clear existing virus from infected cells. Mechanistically, we link this effect to the disruption of viral RNA synthesis/translation. Crucially, through transcriptomic profiling (RNA-seq), we rigorously demonstrate that duIFNγ restricts DTMUV replication by activating a multi-pronged host defense response, highlighted by Programmed Cell Death and the RIG-I-like Receptor (RLR) signaling pathways. These findings establish a strong molecular basis for developing duIFNγ-based biotherapeutics to mitigate the substantial economic impact of DTMUV.

2. Materials and Methods

2.1. Cells, Animals, and Viruses

BHK-21 cells were maintained in Dulbecco’s modified Eagle medium (DMEM; Gibco, New York, NY, USA) supplemented with 10% new bovine serum (NBS; Gibco, New York, NY, USA). Nine-day-old duck embryos were obtained from a commercial duck farm in Ya’an, China. DEF were cultured in minimum essential medium (MEM; Gibco, New York, NY, USA) containing 10% NBS. Twenty-day-old healthy Peking ducks were purchased from a duck farm in Chengdu, China. Peripheral blood mononuclear cells (PBMC) were isolated and cultured in RPMI 1640 medium (RPMI 1640, Gibco, New York, NY, USA) supplemented with 10% fetal bovine serum (FBS; Gibco, New York, NY, USA). The DTMUV CQW1 strain (GenBank accession no. KM233707.1) was propagated in DEF as previously described [16].

2.2. Enzyme-Linked Immunosorbnent (ELISA) Assay

The titers of duIFNγ were measured as previously described [17]. Briefly, 96-well ELISA plates were coated overnight at 4 °C with rabbit anti-duIFNγ polyclonal antibody (prepared in this study; 1:80 dilution) in coating buffer (pH 9.6). Plates were then blocked with PBST containing 5% nonfat milk at 37 °C for 1 h. Samples (100 μL/well) were added and incubated at 37 °C for 1.5 h. Subsequently, mouse anti-duIFNγ polyclonal antibody (prepared in this study; 1:160 dilution) was added, followed by incubation at 37 °C for 2 h. Horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG (TransGen, Beijing, China; 1:8000 dilution) was then applied for 1 h at 37 °C. After washing, 3, 3′, 5, 5′-tetramethylbenzidine (TMB; 100 μL/well) was added and incubated for 10 min at room temperature in the dark. The reaction was terminated with 2 M H_2_SO_4_ (50 μL/well), and absorbance at 450 nm (OD_450_) was measured using a spectrophotometer (Bio-Rad, Hercules, CA, USA).

2.3. Plasmid Construction

Codon-optimized duIFNγ for duck protein expression was synthesized by Wuhan Jinkairui Bioengineering Co. (Jinkairui, Wuhan, China). The fragment was cloned into the pcDNA3.1 vector (Invitrogen, New York, NY, USA), incorporating a linker sequence (CGTGGTTCC) and a Flag tag (GATTACAAGGACGACGATGACAAG) at the C-terminus of the target fragment, thereby generating the eukaryotic expression plasmid pcDNA3.1-duIFNγ. Expression of duIFNγ was confirmed by Western blot (WB) analysis.

2.4. Cell Counting Kit-8 (CCK-8) Assay

DEFs were seeded into 96-well plates at a density of 5 × 10^4^ cells/well. PBMCs were isolated from 20-day-old ducks using a peripheral blood mononuclear cell separation kit (Tianjin Hao Yang Biological Products Technology Co., Ltd., Tianjin, China) according to the manufacturer’s instructions and adjusted to a concentration of 5 × 10^5^ cells/well. Both DEFs and PBMCs were then treated with duIFNγ at concentrations of 0, 20, 40, or 80 ng/mL for 12 h. Cell viability was subsequently assessed using a CCK-8 kit (Solarbio, Beijing, China) by measuring OD_450_, following the manufacturer’s protocol.

2.5. Viral Infection and DuIFNγ Treatment

DEFs (5 × 10^6^ cells/well) and PBMCs (2 × 10^7^ cells/well) were seeded into six-well plates. Experimental treatments were as shown in Table 1.

2.6. Western Blot Assay

Protein samples were separated on 12% SDS-PAGE gels and transferred onto PVDF membranes (Bio-Rad, USA) at 220 mA for 80 min. Membranes were blocked with 5% nonfat dry milk at room temperature for 3 h and then incubated with one of the following primary antibodies: mouse anti-Flag monoclonal antibody (TransGen Biotech, Beijing, China), rabbit anti-NS1 polyclonal antibody (prepared in this study), rabbit anti-NS3 polyclonal antibody (prepared in this study), or mouse anti-β-actin monoclonal antibody (Proteintech, Chicago, IL, USA). After washing, membranes were incubated with HRP-conjugated secondary antibodies: goat anti-rabbit IgG (H + L) (Proteintech, USA) or goat anti-mouse IgG (H + L) (Immunoway, San Jose, CA, USA). Protein bands were visualized using Clarity™ Western ECL Substrate (Bio-Rad, USA).

2.7. RNA-Seq

DEFs were treated with duIFNγ at a concentration of 20 ng/mL. Twelve hours post-treatment, total cellular RNA was extracted using TRIzol reagent (Invitrogen, USA) following the manufacturer’s protocol and subsequently treated with DNase I (Invitrogen, USA). RNA purity and concentration were evaluated using a NanoDrop 2000 spectrophotometer (Thermo Scientific, New York, NY, USA), and RNA integrity was assessed with an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). RNA-seq libraries were then prepared using the VAHTS Universal V10 RNA-seq Library Prep Kit (vazyme, Nanjing, China) according to the manufacturer’s instructions. Transcriptome sequencing and subsequent analyses were performed by OE Biotech Co., Ltd. (Shanghai, China).

2.8. RT-qPCR Assay

Total RNA was extracted from treated DEFs or PBMCs using RNAiso (Lablead, Beijing, China) and reverse-transcribed into cDNA with the PrimeScript RT Reagent Kit with gDNA Eraser (TaKaRa, Kyoto, Japan). Relative mRNA expression levels of NS3, E, duIFNγ and β-actin were quantified by RT-qPCR. Primer sequences are listed in Supplementary Table S1. RT-qPCR was performed using Hieff UNICON Universal Blue qPCR SYBR Green Master Mix (Yeasen, Shanghai, China) according to the manufacturer’s instructions, with an initial denaturation at 95 °C for 30 s, followed by 40 cycles of denaturation at 95 °C for 5 s and annealing at 60 °C for 30 s. Relative gene expression levels were calculated using the 2^−ΔΔCt^ method.

2.9. Plague Assay

BHK-21 cells were seeded into 12-well plates at a density of 3 × 10^5^ cells/well. Viral samples were subjected to 10-fold serial dilutions (10^−1^ to 10^−6^) in DMEM, and 200 μL of each dilution was added to the wells. Plates were incubated at 37 °C with 5% CO_2_ for 2 h. Cells were then washed with PBS and overlaid with DMEM containing 2% NBS and 1.5% methylcellulose (Sigma, St. Louis, MI, USA). After 7 d of incubation, the overlay medium was removed, and the cells were washed three times with PBS, fixed with 4% paraformaldehyde for 20 min, and stained with 1% crystal violet for 5 min. Plaques were counted and recorded as previously described [19].

2.10. Transcriptome Data Analysis

The libraries were sequenced on an Illumina NovaSeq 6000 platform, generating 150 bp paired-end reads. Raw FASTQ reads were first processed using fastp [20] to remove low-quality reads, yielding clean reads. The clean reads were then aligned to the mallard (Anas platyrhynchos) genome (GenBank: GCA_047663525.1) using HISAT2 [21]. Differential expression analysis was conducted with DESeq2 [22], with a p-value < 0.05 and a fold change >2 set as the threshold for significantly differentially expressed genes (DEG). Functional annotation and enrichment analyses were performed using the Gene Ontology (GO) [23] and Kyoto Encyclopedia of Genes and Genomes (KEGG) [24] databases based on the hypergeometric distribution. R (v3.2.0) was used to generate column plots, volcano plots, and bubble plots for significantly enriched terms.

2.11. Statistical Analysis

Statistical analyses were performed using GraphPad Prism (version 8.0). For comparisons between two groups, an unpaired Student’s t-test was used. For comparisons among three or more groups, one-way analysis of variance (ANOVA) was applied to assess overall variance significance, followed by Tukey’s post hoc tests for specific pairwise comparisons. Data are presented as mean ± standard deviation (SD). A p-value ≤ 0.05 was considered statistically significant, denoted in the figures as follows: ns (p > 0.05), * p ≤ 0.05, ** p < 0.01, and *** p < 0.001.

3. Results

3.1. DTMUV Induces DuIFNγ Expression in Duck Immune and Non-Immune Cells

To characterize the host’s immune response, we first assessed the induction of duIFNγ in DTMUV-infected cells. In PBMCs, DTMUV actively replicated, with viral copy numbers and titers peaking at 24 hpi (Figure 1A,B). This productive infection strongly stimulated the host response, resulting in a significant upregulation of duIFNγ mRNA at 24 and 36 hpi (Figure 1C). Furthermore, duIFNγ protein secretion into the supernatant showed a robust and continuous increase, reaching its maximal detected level at the final time point of 36 hpi (Figure 1D). These kinetics confirm that DTMUV infection is a potent trigger for the synthesis and copious secretion of duIFNγ by duck immune cells, indicating a systemic anti-viral alarm.

We then examined the response in DEFs, a non-immune cell model. DTMUV replicated in DEFs with similar kinetics (Figure 2A,B). Notably, DTMUV infection also rapidly induced transcriptional upregulation of duIFNγ mRNA in DEFs, positively correlating with the viral replication curve (Figure 2C). However, in sharp contrast to PBMCs, the corresponding secreted duIFNγ protein levels were low and undetectable by ELISA. This cell-type-specific differential expression suggests a tight translational or post-transcriptional control of duIFNγ in non-immune cells. While local transcriptional alarm is initiated in DEFs, the systemic anti-DTMUV defense is primarily reliant on the high-capacity protein secretion by professional immune cells like PBMCs.

3.2. Functional Validation and Non-Cytotoxicity of Recombinant DuIFNγ

Given the observed induction of duIFNγ following DTMUV infection, we proceeded to characterize the antiviral potential of the recombinant protein. The duIFNγ eukaryotic expression plasmid (pcDNA3.1-duIFNγ) was successfully constructed. WB analysis confirmed the successful expression and secretion of the Flag-tagged recombinant duIFNγ protein into the cell culture supernatant (Supplementary Figure S1). The concentration of the functional protein was subsequently quantified by an established ELISA method.

To evaluate its safety and potential as a biotherapeutic agent, we assessed the cytotoxic effects of the recombinant duIFNγ on both immune (PBMCs) and non-immune (DEFs) duck cells using the CCK-8 assay. Both cell types were incubated with duIFNγ at concentrations ranging from 0 to 80 ng/mL for 12 h. As demonstrated in Figure 3A,B, no significant differences in cell viability were observed across all tested concentrations compared to the control group (p > 0.05). This result confirms that recombinant duIFNγ is non-toxic to key duck cell populations at concentrations relevant to antiviral studies, establishing a favorable safety profile for further investigation.

3.3. DuIFNγ Blocks De Novo DTMUV Replication

To investigate whether duIFNγ inhibits DTMUV infection in a dose-dependent manner, DEFs were pretreated with different concentrations of duIFNγ (0–20 ng/mL) for 12 h, followed by infection with DTMUV at an MOI of 1 for 24 h. Culture supernatants were collected from each group and subjected to plaque assay. As shown in Supplementary Figure S2, pretreatment with duIFNγ at all tested concentrations significantly reduced DTMUV titers (p < 0.01). The strongest inhibitory effect on DTMUV proliferation was observed at 20 ng/mL of duIFNγ, which also showed significant differences compared with other concentration groups (p ≤ 0.05). As the duIFNγ concentration decreased, its inhibitory effect on DTMUV showed a declining trend, though without statistical significance. These results indicate that duIFNγ exerts potent anti-DTMUV activity within the tested concentration range, and its inhibitory effect is dose-dependent.

Next, duIFNγ at 20 ng/mL was chosen to investigate its protective antiviral role in both PBMCs and DEFs. RT-qPCR analysis showed that DTMUV mRNA levels were significantly and continuously reduced in the duIFNγ-pretreated groups compared to controls across all time points (Figure 4A,C; p < 0.01). Viral titration via the plaque assay confirmed this inhibition (Figure 4B,D). In PBMCs, viral titers were significantly suppressed as early as 12 hpi (p ≤ 0.05). The inhibition became highly pronounced at 24 hpi and 36 hpi, with the duIFNγ-treated group showing titers approximately 100-fold lower than the control group at 24 hpi (p < 0.001; Figure 4B). Similarly, in DEFs, duIFNγ pretreatment consistently reduced viral titers across all time points (p < 0.001), achieving a maximal reduction of approximately 100-fold at 36 hpi (Figure 4D).

Collectively, these results demonstrate that duIFNγ effectively establishes a robust prophylactic antiviral state in both primary immune and non-immune duck cells, significantly suppressing de novo DTMUV replication. The enhanced inhibition observed in duIFNγ-treated PBMCs during late-stage DTMUV infection suggests that duIFNγ plays a critical role in coordinating immune-driven defenses.

3.4. DuIFNγ Reduces Viral Load in Already Infected Cells

To evaluate its therapeutic potential, we next assessed the ability of duIFNγ to suppress viral replication in cells with pre-established DTMUV infection. DEFs and PBMCs were first preinfected with DTMUV for 6 h (to allow viral entry and replication establishment), and subsequently, the two cell types were treated with 20 ng/mL duIFNγ for 12 h and 24 h, respectively. RT-qPCR analysis revealed that DTMUV genome transcription levels were significantly reduced in the duIFNγ-treated groups compared to controls in both PBMCs and DEFs (Figure 5; p < 0.01). Consistent with the mRNA data, viral titers quantified by plaque assay were markedly lower in the duIFNγ-treated groups. Specifically, in PBMCs, the treated group titer (10^5.87^ PFU/mL) was significantly lower than the control (10^6.52^ PFU/mL) (Figure 5B; p < 0.01). A similar, highly significant reduction was observed in DEFs, with the treated group titer (10^4.79^ PFU/mL) being lower than the control (10^5.70^ PFU/mL) (Figure 5D; p < 0.001). These findings are critical for translational veterinary medicine, as they demonstrate that duIFNγ possesses the valuable ability to significantly reduce the infectious viral load in cells already undergoing DTMUV replication, positioning it as a strong candidate for post-exposure therapeutic intervention in infected ducks.

3.5. DuIFNγ Targets Viral RNA Synthesis and Translation

The significant reduction in both viral genomes’ copy numbers and infectious titers led us to hypothesize that duIFNγ acts at the replication phase of the DTMUV life cycle. We utilized DEFs as a cell model for precise mechanistic dissection.

We first assessed the effect of duIFNγ on the early steps of infection (adsorption and entry). The results from the 4 °C cold binding assay and the 37 °C entry assay showed that duIFNγ treatment had no significant impact on the amount of virus bound to the cell surface or internalized into DEFs (Figure 6A,B). This finding confirms that duIFNγ operates via a post-entry mechanism and does not prevent the initial establishment of infection.

Flavivirus replication relies heavily on the translation of viral RNA into nonstructural (NS) proteins (such as NS3 and NS5) to form the functional RNA replication complex [3,25,26]. Therefore, we investigated whether duIFNγ interferes with this critical RNA synthesis/translation phase. We compared the inhibitory activity of duIFNγ to cycloheximide (CHX), a known inhibitor of de novo protein synthesis that effectively blocks flavivirus replication [27]. RT-qPCR analysis showed that duIFNγ significantly reduced the mRNA expression levels of both the viral envelope (E) and nonstructural (NS3) genes (Figure 6C,D). Crucially, co-treatment with duIFNγ and CHX did not produce an additive inhibitory effect on viral RNA levels (Figure 6C,D). The observation that combining duIFNγ and CHX did not yield enhanced viral suppression provides compelling evidence that duIFNγ acts on a shared bottleneck with the protein synthesis pathway, directly interfering with the expression or function of key nonstructural proteins required for DTMUV replication. Further validation by Western blot confirmed that duIFNγ treatment effectively resulted in reduced protein levels of the viral nonstructural proteins NS1 and NS3 at 24 hpi (Figure 6E).

Collectively, these mechanistic results demonstrate that duIFNγ primarily inhibits DTMUV replication by interfering with the critical viral RNA synthesis and protein expression phase, thereby blocking the production of progeny virions.

3.6. DuIFNγ Suppresses DTMUV Replication by Activating Multi-Pronged Host Defense Pathways

To systematically uncover the molecular mechanisms underlying duIFNγ’s potent antiviral activity, we performed a high-throughput RNA sequencing (RNA-seq) analysis on DEFs treated with 20 ng/mL duIFNγ for 12 h.

Sequencing generated high-quality clean reads that mapped successfully to the duck reference genome (GenBank: GCA_047663525.1). The raw data have been deposited in GenBank (BioProject: PRJNA1335872). Using the strict criteria (|log2(FoldChange)| > 1 and p < 0.05), we identified a total of 1387 differentially expressed genes (DEG) in the duIFNγ-treated group compared to the control. Of these, 954 genes were upregulated and 433 were downregulated (Figure 7A). GO analysis rapidly confirmed the immunological nature of the response: the upregulated genes were primarily enriched in critical Biological Process (BP) terms, including defense response to virus and innate immune response (Figure 7B,C).

KEGG pathway enrichment analysis revealed the core defense strategy orchestrated by duIFNγ, with significant enrichment observed in pathways related to two distinct cellular defense mechanisms (Figure 7D): (1) Cell-Autonomous Clearance: the analysis demonstrated significant enrichment of pathways associated with Programmed Cell Death, specifically Apoptosis and Necroptosis. These results suggest that duIFNγ induces a cell-autonomous defense strategy by triggering the programmed death of infected cells, thus rapidly restricting DTMUV spread before the completion of the viral replication cycle. (2) Pattern Recognition Receptor (PRR)-mediated Innate Immune Signaling: duIFNγ strongly activated PRR-mediated innate immune pathways. The RIG-I-like receptor (RLR) signaling pathway, which is essential for sensing cytoplasmic viral RNA and initiating classical antiviral effectors, was prominently enriched. Furthermore, Toll-like receptor and NOD-like receptor pathways were also activated. This multi-pronged defense strategy, combining enhanced innate immunity (evidenced by increased Mx and IFIH1 expression) with cell-autonomous programmed cell death (indicated by Caspase 7 and Caspase 8 upregulation), was firmly corroborated by RT-qPCR validation of these key effector genes (Figure 7E). This indicates that duIFNγ systematically mobilizes the cell’s antiviral machinery to directly interfere with viral RNA replication.

4. Discussion

IFNs are pivotal in coordinating host antiviral defense. Previous reports indicating that Type I IFNs (IFN-α/β) offer limited protection against DTMUV infection underscore the necessity of investigating alternative defense mechanisms. Our study addresses this gap by confirming the essential and robust role of duIFNγ (Type II IFN) in anti-DTMUV immunity. We demonstrate that duIFNγ exerts potent antiviral activity in both duck immune cells (PBMCs) and non-immune cells (DEFs), yielding crucial findings for veterinary applications: duIFNγ not only establishes a powerful prophylactic state (blocking de novo replication) but also exhibits a significant therapeutic effect (reducing viral load in already infected cells). This dual functionality is critical, positioning duIFNγ as a promising candidate for immediate post-exposure intervention in DTMUV outbreaks.

IFNγ is typically a hallmark of Th1 polarization and is produced predominantly by immune cells [9,28,29]. Consistent with this, DTMUV infection induced a robust transcriptional and translational response in PBMCs, confirming the activation of a systemic immune alarm. In sharp contrast, while duIFNγ mRNA was induced in DEFs, secreted protein was negligible. This cell-type-specific differential expression highlights that PBMCs are the primary source of duIFNγ to mount a systemic anti-DTMUV response.

Importantly, a more pronounced antiviral efficacy of duIFNγ was observed in PBMCs compared to DEF cells at later stages of DTMUV infection. This cell-type dependence aligns with findings in other viral systems and is biologically relevant in vivo [30,31,32,33]. This enhanced effect is likely due to the inherent function of duIFNγ as a macrophage-activating factor [34]. Since monocytes/macrophages are key cellular targets for DTMUV infection [35], the potentiation of their phagocytic and anti-viral activities within the PBMC population is crucial for effective viral clearance, providing a mechanistic basis for the observed superiority in immune cells.

The protective role of IFNγ in viral infections involves multiple and complex mechanisms. IFNγ reduces avian influenza virus (AIV) binding, thereby limiting AIV infection [36]. For viruses such as Marburg virus (MARV) and vesicular stomatitis virus (VSV), IFNγ-mediated antiviral activity occurs at the entry stage [37,38]. In the case of the Ebola virus (EBOV), IFNγ interferes with viral RNA synthesis [39]. To define the antiviral mechanism, we first confirmed that duIFNγ did not interfere with the initial stages of infection, showing no significant impact on viral binding or entry. The inhibitory effect was precisely mapped to the post-entry phase. Mechanistically, duIFNγ strongly suppressed the expression of both viral envelope (E) and nonstructural (NS3) genes. Crucially, the lack of an additive inhibitory effect when duIFNγ was combined with the protein synthesis inhibitor CHX suggested that duIFNγ’s antiviral activity converges by targeting the de novo synthesis or function of viral nonstructural proteins required for forming the RNA replication complex. This evidence firmly places duIFNγ’s action within the RNA replication/translation stage, a critical bottleneck in the flavivirus life cycle.

Transcriptomic (RNA-seq) analysis provided the molecular framework for duIFNγ’s broad efficacy by revealing a highly sophisticated host defense network. KEGG pathway analysis highlighted the significant activation of two distinct, yet synergistic, defense strategies: (1) Innate Immune Mobilization: duIFNγ robustly activated crucial antiviral sensing pathways, most notably the RIG-I-like receptor (RLR) signaling pathway, alongside Toll-like receptor and NOD-like receptor pathways. This ensures the rapid mobilization of Interferon-Stimulated Genes (ISGs) to directly restrict viral RNA replication [40,41,42,43]; (2) Cell-Autonomous Clearance: Pathways related to Programmed Cell Death (apoptosis and necroptosis) were highly enriched. This suggests that duIFNγ induces a cell-autonomous clearance mechanism, triggering the programmed death of infected cells to swiftly limit DTMUV spread before the virus can fully mature and exit [44,45].

5. Conclusions

In conclusion, our study establishes duIFNγ as a potent regulator of anti-DTMUV immunity. Moreover, duIFNγ exerts significant prophylactic and therapeutic effects against DTMUV infection through disrupting the viral RNA synthesis/translation phase. These findings underscore the critical role of Type II IFN in avian antiviral defense and provide novel, evidence-based insights for the urgent development of duIFNγ-based biotherapeutics to combat DTMUV and safeguard the waterfowl industry.