PIM1 and PIM3 Kinases Suppress HIV-1 Protein Expression and Particle Production Through Distinct Roles

TL;DR

PIM1 and PIM3 kinases reduce HIV-1 protein expression and virus production through different mechanisms, offering new insights into how host enzymes control viral replication.

Contribution

The study reveals distinct and cooperative roles of PIM1 and PIM3 in suppressing HIV-1 production through transcriptional and post-transcriptional mechanisms.

Findings

PIM1 and PIM3, but not PIM2, suppress HIV-1 virion production without affecting infectivity.

PIM1 reduces HIV-1 transcription, while PIM3 diminishes viral protein expression post-transcriptionally.

Co-expression of PIM1 and PIM3 enhances suppression of HIV-1 production and inhibits non-LTR promoters.

Abstract

PIM kinases (PIM1, PIM2, PIM3) are serine/threonine kinases implicated in infection and reactivation of various viruses, but their roles in HIV-1 gene expression and particle production remain unclear. We examined their impact on HIV-1 and related viruses using co-transfection systems. PIM1 and PIM3, but not PIM2, markedly suppressed HIV-1 virion production without affecting infectivity. This inhibitory effect extended to transmitted/founder HIV-1 clones and SIV, indicating broad activity across lentiviruses. Kinase-dead mutants failed to reduce virion production, confirming the requirement for catalytic activity. Our data suggest that PIM1 and PIM3 act at distinct steps of HIV-1 gene expression: PIM1 reduces transcription, whereas PIM3 acts post-transcriptionally to diminish viral protein expression. Co-expression of PIM1 and PIM3 further enhanced suppression, suggesting complementary functions. Both kinases also inhibited expression from non-LTR promoters, implying involvement of general cellular factors. These findings reveal distinct and cooperative actions of PIM1 and PIM3 in limiting HIV-1 particle production, providing new insights into host kinase-mediated regulation of viral gene expression.

Figures

Full text

1. Introduction

Viruses interact with numerous host factors to replicate and survive in host cells and individuals. Many host factors that positively or negatively regulate HIV-1 replication have been identified through genome-wide knockout approaches using siRNA and CRISPR [1,2,3,4,5,6,7,8]. HIV-1 replication is also influenced by post-translational modifications, such as phosphorylation, acetylation, and ubiquitination of viral and host proteins [9]. Diverse kinases have been reported to be involved in different steps of HIV-1 replication [10,11].

PIM kinases (Proviral integration site for Moloney murine leukemia virus) belong to the serine/threonine kinase family and include PIM1, PIM2, and PIM3. The three PIM kinases are structurally related and exhibit relatively high sequence homology (approximately 60–70%), although they differ in expression patterns and substrate specificity [12,13,14]. Several lines of evidence indicate that PIM kinases affect infection and reactivation of various viruses from the Herpesviridae, Picornaviridae, and Flaviviridae families [15,16,17,18,19,20]. For Epstein–Barr virus, PIM1 and PIM2 enhance activity of the viral transcriptional activator EBNA2. For Kaposi’s sarcoma herpesvirus, PIM1 and PIM3 contribute to viral reactivation through phosphorylation of the latency-associated nuclear antigen LANA [15,16]. Inhibition of PIM1 kinase activity using pharmacological inhibitors leads to reduced viral replication and virion production of human rhinovirus-16 and enterovirus-A71 [17,19]. PIM1 is involved in the entry process of hepatitis C virus and thus influences viral replication. Moreover, PIM1 has been shown to enhance Zika virus replication [18,20].

PIM kinases can also affect the replication of viruses in the Retroviridae family [21,22,23]. PIM1 and PIM3 phosphorylate the Vpx protein encoded by simian immunodeficiency virus/human immunodeficiency virus type 2, resulting in enhanced binding to and degradation of the host restriction factor SAMHD1 [21]. For HIV-1 and HTLV-I, PIM kinases have been reported to regulate viral gene expression and reactivation [22,23]. PIM1 appears to act as a key regulator of HIV-1 latency, and a PIM1 inhibitor is suggested to suppress HIV-1 reactivation in an LTR-dependent manner [22]. In addition, the inhibitor appears not to affect chronically active HIV-1 expression, and mere PIM1 overexpression in HIV-1 latent cells seems insufficient to trigger HIV-1 reactivation [22]. For HTLV-I, a feedback loop appears to exist between the viral trans-activator Tax and PIM kinases. Tax increases PIM1 and PIM3 expression, but not PIM2, which in turn reduces Tax expression, thereby suppressing HTLV-I replication driven by Tax [23]. To sum up the above-described research results on various viruses, the effects of PIM kinases on viral gene expression and replication appear to vary among viruses, PIM isoforms, and experimental systems used in the studies.

In this study, we aimed to clarify the association between PIM kinases and viral gene expression/virion production of lentiviruses, including HIV-1. In our co-transfection experimental system, PIM1 and PIM3, but not PIM2, suppressed HIV-1 virion production by reducing viral protein expression. This reduction was attributable to distinct inhibitory effects of PIM1 and PIM3 on the HIV-1 gene expression process. Our findings suggest that PIM1 and PIM3 may target distinct substrates to inhibit HIV-1 gene expression and virion production, providing new insights into PIM kinase–virus interactions.

2. Materials and Methods

2.1. Plasmid DNAs

Proviral clones pNL4-3 [24] and MA239N [25] were used in this study. Transmitted/Founder clones TRJO and Z3618M were obtained from the HIV reagent program (https://www.beiresources.org/HIV.aspx (19 August 2020)). PIM expression vectors [21] were kindly provided by Drs. Kei Miyakawa and Akihide Ryo of Japan Institute for Health Security.

2.2. Cells

HEK293T [26], Hep2 (ATCC CCL-23), and HeLa-derived luciferase reporter TZM-bl [27] were cultured and maintained in Eagle’s minimal essential medium containing 10% heat-inactivated fetal bovine serum.

2.3. Virion Production

Cells were co-transfected with proviral clones and PIM expression vectors using Lipofectamine 2000 (Thermo Fisher Scientific Inc., Waltham, MA, USA). The DNA amounts used for transfection were 0.1 μg of proviral clones and 0.3 μg of PIM1 or 0.1 μg of PIM3 expression vectors, unless otherwise indicated. The total amount of DNA used for transfection (0.5 μg) was normalized across samples by adding pcDNA3.1 vector (Thermo Fisher Scientific). On day 2 post-transfection, culture supernatants were collected, and virus production was quantified using the HIV-1 p24 antigen ELISA kit (ZeptoMetrix Corp., Buffalo, NY, USA). For viruses produced from TRJO, Z3618M, and MA239N clones, viral RNA was extracted using QIAamp Viral RNA Mini Kit and QIAcube (QIAGEN N.V., Venlo, Netherlands) and treated with DNase I to remove residual plasmid DNAs. Virus production was then assessed by real-time RT-PCR as described previously [28] using clone-specific primer sets as follows; TRJO 1213-1236 FWD (atagtgcagaacatccaggggcaa) and IDT qPCR set3-R (gggtggctccttctgataat) for TRJO, Z3618M 641-664 FWD p1 (caccaagaaccctgaatgcatggg) and Z3618M REV p0 (ggtgtttaagtcttgtggggtggc) for Z3618M, and MA239N 1679-1702 FWD p0 (caacagcaccatctagcggcagag) and MA239N 1742-1765 REV p0 (ttctcgggcttaatggcaggtgga) for MA239N.

2.4. Infectivity

Virus samples were prepared from HEK293T cells co-transfected with pNL4-3 and PIM expression vectors as described above. TZM-bl cells (4 × 10^4^/well) were seeded on a 96-well plate one day before infection. Equal amounts of virus samples (0.5 ng of Gag-p24) were inoculated into TZM-bl cells. On day 2 post-infection, the cells were lysed and subjected to Luciferase assay (Promega Corp., Madison, WI, USA).

2.5. Luciferase Activity

HEK293T cells were co-transfected with pGL3 control vector (0.1 μg) (Promega) and PIM expression vector (0.3 μg for PIM1 or 0.1 μg for PIM3). The total amount of DNA used for transfection (0.5 μg) was normalized across samples by adding pcDNA3.1 vector. On day 2 post-transfection, the cells were lysed and subjected to luciferase assay (Promega).

2.6. Protein Expression

HEK293T cells were co-transfected with pEF-FVpx (0.2 μg) [29] and PIM expression vector (0.3 μg for PIM1 or 0.1 μg for PIM3). The total amount of DNA used for transfection (0.5 μg) was normalized across samples by adding pcDNA3.1 vector. For Gag expression, HEK293T cells were transfected with pNL4-3 and PIM expression vectors as described above. On day 2 post-transfection, the cells were lysed and subjected to the Western blotting analysis using anti-FLAG M2 (Sigma-Aldrich, St. Louis, MO, USA), anti-HIV-1 Gag-p24 (183-H12-5C; NIH AIDS Reagent Program; catalog no. 3537), and anti-β-actin AC-15 (Sigma-Aldrich) antibodies as described previously [29,30]. The band intensities of Vpx, Gag, and β-actin of each sample were measured by the ImageJ software v1.54p (National Institutes of Health, NIH, Bethesda, MA, USA). Vpx and Gag expression level was normalized by β-actin expression level of each sample.

2.7. Hiv-1 Transcripts

Quantitative RT-PCR analysis (qRT-PCR) of HIV-1 transcripts was similarly performed as described previously [30]. Briefly, on day 2 post-transfection, total RNA was prepared from HEK293T cells transfected with pNL4-3 and PIM expression vectors as described above and treated with DNase I. The RNA samples were subjected to qRT-PCR using QuantiFast SYBR Green RT-PCR (QIAGEN) and primer sets specific for all HIV-1 transcripts and GAPDH [30]. Expression level of all HIV-1 transcripts was normalized by GAPDH expression level of each sample.

3. Results

3.1. Expression of Pim1 or Pim3, but Not Pim2, Suppresses Hiv-1 Virion Production Without Affecting Infectivity

To examine whether PIM kinase expression influences HIV-1 virion production, co-transfection experiments were performed using the HIV-1 proviral clone pNL4-3 together with PIM expression vectors in HEK293T cells. As shown in Figure 1a, virion production in the presence of exogenous PIM2 was comparable to that observed without PIM expression, indicating that PIM2 does not affect HIV-1 virion production. In contrast, the expression of PIM1 or PIM3 significantly reduced virion production in a dose-dependent manner (approximately 50%). To determine whether the reduction in virion production by PIM1 and PIM3 is cell-dependent, similar co-transfection experiments were conducted in Hep2 cells. HIV-1 virion production was also reduced by PIM1 or PIM3 expression (approximately 60% and 70% reduction for PIM1 and PIM3, respectively) (Figure 1b). The inhibitory effect of PIM1 and PIM3 on virion production appeared stronger in Hep2 cells compared to HEK293T cells, which may reflect differences in transfection efficiency and/or cellular environment between the two cell lines. To assess whether PIM1 or PIM3 affects viral infectivity, equal amounts of virions produced with PIM1 or PIM3 expression were inoculated into TZM-bl cells. Viral infectivity was similar among virions produced in the presence or absence of PIM1/3 (Figure 1c). Collectively, these results indicate that PIM1 and PIM3, but not PIM2, suppress HIV-1 virion production without altering infectivity.

3.2. Expression of Pim1 or Pim3 Reduces Virion Production of Lentiviruses

Since a PIM1 inhibitor has been reported to influence HIV-1 reactivation depending on the HIV-1 LTR sequence [22], we examined whether the reduction in virion production by PIM1 and PIM3 is specific to the HIV-1 laboratory strain NL4-3. Co-transfection experiments were performed using two transmitted/founder HIV-1 clones (subtype B TRJO and subtype C Z3618M) and an SIVmac239 clone (MA239N) in HEK293T cells. As shown in Figure 2, virion production from all tested clones was diminished by the expression of PIM1 or PIM3. These results indicate that PIM1 and PIM3 can suppress virion production across a broad range of lentiviruses.

3.3. Kinase Activity of Pim1 and Pim3 Is Required to Suppress Hiv-1 Virion Production

The kinase activities of PIM proteins are necessary for viral infection and reactivation [15,16,17,18,19,20,21,22,23]. To determine whether the kinase activity of PIM1 and PIM3 is required for suppression of HIV-1 virion production, co-transfection experiments were conducted using kinase-dead mutants (PIM1 K67M and PIM3 K69M) along with wild-type PIM1 and PIM3 expression vectors. Consistent with the result in Figure 1a, the expression of wild-type PIM1 and PIM3 significantly decreased virion production (Figure 3). In contrast, virion production under the expression of kinase-dead PIM1 and PIM3 mutants was similar or not decreased to that observed without PIM expression, as expected (Figure 3). In sum, the result indicates that the kinase activity of PIM1 and PIM3 is critical for the reduction in HIV-1 virion production.

3.4. Pim1 and Pim3 Expression Suppresses Exogenous Gene Expression Driven by Different Promoters

To investigate whether the suppression of virion production by PIM1 and PIM3 occurs specifically through the LTR promoter, expression vectors under the control of distinct promoters were used for co-transfection experiments. We examined the luciferase activity and Vpx expression from the pGL3 control vector containing an SV40 promoter and the pEF-FVpx vector containing an EF-1α promoter, respectively. Upon co-transfection of the pGL3 control vector with PIM1 or PIM3 expression vectors, the luciferase activity was reduced by approximately 50% compared to that observed without PIM expression (Figure 4a). The effect of PIM1 and PIM3 on the Vpx expression from the EF-1α promoter was assessed by Western blotting using an anti-FLAG antibody (Figure 4b). A significant decrease in Vpx expression was observed in cells expressing PIM1 or PIM3 (approximately 30% and 50% reduction for PIM1 and PIM3, respectively). These results indicate that PIM1 and PIM3 influence the exogenous gene and protein expression in a promoter-independent manner.

3.5. Pim1 and Pim3 Additively Inhibit Hiv-1 Virion Production Through Reduced Viral Protein Expression

Since PIM kinases have diverse substrates, PIM1 and PIM3 may exert distinct effects on HIV-1 virion suppression. To address this, we examined whether PIM1 and PIM3 additively reduce virion production (Figure 5a). Consistent with previous results (Figure 1 and Figure 3), the expression of either PIM1 or PIM3 significantly decreased virion production in co-transfection experiments in HEK293T cells (approximately 60% reduction compared to the control without PIM expression). Notably, co-expression of PIM1 and PIM3 further reduced virion production compared to their independent expression (approximately 80% reduction). We next assessed the effect of PIM1 and PIM3 on Gag expression, the main driver of HIV-1 virion assembly. As shown in Figure 5b, while Gag expression was diminished by PIM1 or PIM3 alone, the co-expression of PIM1 and PIM3 markedly reduced Gag expression, correlating with the observed decrease in virion production (approximately 40% vs. 70% reduction for independent expression vs. co-expression). Taken together, these results indicate that suppression of HIV-1 virion production by PIM1 and PIM3 results from their impact on viral protein expression, and that PIM1 and PIM3 act cooperatively to repress virion production.

3.6. Pim1 and Pim3 Act at Distinct Steps of Hiv-1 Virion Production to Exert Inhibitory Effects

PIM1 and PIM3 cooperatively repressed HIV-1 virion production. Since Gag expression levels and virion production were suppressed in parallel by PIM1 and PIM3 co-expression (Figure 5), we hypothesized that PIM1 and PIM3 target distinct steps of viral gene expression. We therefore examined whether PIM1 or PIM3 affects the transcription step, the first stage of HIV-1 gene expression. Interestingly, under conditions where virion production was suppressed in co-transfection experiments, PIM1 expression significantly decreased the levels of all HIV-1 transcripts (Figure 6). In contrast, transcript levels were similar with or without PIM3 expression, showing that PIM3 does not affect transcription (Figure 6). Collectively, these results indicate that PIM1 and PIM3 suppress HIV-1 virion production through distinct mechanisms: PIM1 inhibits the transcription step, whereas PIM3 acts at later stages of viral gene expression.

4. Discussion

In this study, using a gain-of-function approach based on plasmid-mediated co-transfection, we aimed to determine whether PIM kinases influence HIV-1 virion production. Co-transfection experiments revealed that PIM1 and PIM3, but not PIM2, suppress HIV-1 virion production without affecting infectivity. PIM1 and PIM3 also reduced virion production from proviral clones of HIV-1 transmitted/founder and SIV, showing that their inhibitory effects can extend to a broad range of lentiviruses. Consistent with previous reports [15,16,17,18,19,20,21,22,23], this suppression required the kinase activity of PIM1 and PIM3, emphasizing the role of their catalytic function. PIM1 and PIM3 co-expression further enhanced the inhibitory effect, suggesting complementary actions. Indeed, our data indicate that PIM1 and PIM3 act through distinct steps of viral gene expression: PIM1 inhibits HIV-1 transcription, whereas PIM3 acts post-transcriptionally to reduce viral protein expression. PIM1 and PIM3 may act on distinct substrates to exert their inhibitory effects on virion production, indicating functional differences between these kinases. These findings highlight host kinase-mediated control of HIV-1 particle production. Together, these results establish kinase-dependent and cooperative suppression of HIV-1 output by PIM1 and PIM3 in our co-transfection systems.

PIM1 and PIM3 suppressed protein expression driven not only by the LTR promoter of lentiviruses but also by other promoters (SV40 and EF-1α) in the expression vectors tested. Taken together, these results suggest that, in our co-transfection systems, inhibition of protein expression by PIM1 and PIM3 may be mediated by phosphorylation of general cellular factors involved in gene expression rather than viral components. This promoter independence is consistent with the diversity of reported PIM substrates and their roles at multiple layers of gene regulation [21,31].

Previous work identified PIM1 as a facilitator of HIV-1 reactivation from latency in T-cell models in which proviral transcription is tightly repressed and reactivation is read out as an LTR-dependent event [22]. By contrast, our study quantified overall protein output and particle production from plasmid-borne proviral clones in highly permissive cells, where transcription is already active. We also employed ectopic PIM expression rather than manipulation of endogenous kinase levels/activities. These axes—latent provirus vs. de novo expression, endogenous/modest vs. ectopic/strong PIM1, and LTR reactivation endpoints vs. total protein/particle output—offer a coherent framework to reconcile the seemingly opposite outcomes. In latent settings, PIM1 activity may facilitate the transition from repressed to transcriptionally competent LTRs; once transcription is active; however, higher or ectopic PIM1 in our system can reduce viral transcript abundance and, together with PIM3, lower protein expression and particle production. Beyond HIV-1, PIM signaling shows directionality across viruses: it enhances EBV EBNA2-driven programs and supports KSHV reactivation (via LANA), whereas it restrains HTLV-I replication by attenuating Tax-driven expression [15,16,23]. In our HIV-1 system, this contextual variability converges on a division of labor: PIM1 constrains transcription, whereas PIM3 acts post-transcriptionally to lower protein output.

In our co-transfection system, PIM1 and PIM3 reduced viral protein expression and virion production by inhibiting transcriptional and post-transcriptional processes of HIV-1 gene expression, respectively. To delineate the step targeted by PIM3, we assessed its effects on viral mRNA and protein stability (Figures S1 and S2) using actinomycin D and cycloheximide. These analyses showed that PIM3 affected neither mRNA decay nor protein stability, indicating that its inhibitory effect is exerted primarily at the level of translation. Together with the transcriptional suppression mediated by PIM1, these findings support distinct yet cooperative roles of PIM1 and PIM3 in limiting HIV-1 gene expression through different substrates. Substrate specificity resources for serine/threonine kinases are now available [31], and PIM1/3 could therefore act on cellular proteins linked to transcriptional and translational regulation. Future mechanistic studies combining endogenous perturbation of PIM1/3 with phosphoproteomic and transcriptome/translatome-level analyses, such as nascent RNA and ribosome profiling, will be required to define the precise transcriptional and post-transcriptional factors under PIM control.

From a therapeutic perspective, PIM effects on HIV-1 differ between latency-reversal contexts (as reported in [22]) and settings with active transcription (as modeled by our plasmid-mediated co-transfection system). Given the pleiotropic, context-dependent nature of PIM signaling across viruses [15,16,21,23], PIM-targeted strategies should be considered with particular caution and in a context-dependent manner.

A limitation of our study is that we relied on gain-of-function analyses in permissive cell lines and did not manipulate endogenous PIM1/3 levels or examine natural HIV-1 infection models. Future work will therefore evaluate (i) endogenous PIM perturbations in primary CD4^+^ T cells and established latency models, (ii) replication-competent infection in natural entry/replication contexts, and (iii) in vivo feasibility where appropriate, to define expression-level thresholds and cell-state conditions that govern the switch between facilitating and inhibitory modes.

Viruses continue to replicate and survive by exploiting host facilitation factors and evading restriction mechanisms in diverse environments. We and others have reported that PIM kinases are involved in infection, replication, and reactivation of HIV-1 and HTLV-I, and that their impact varies across experimental systems. In this context, our findings define kinase-dependent, division-of-labor actions of PIM1 (transcriptional) and PIM3 (post-transcriptional) that cooperatively suppress HIV-1 protein expression and particle production in co-transfection systems, providing a framework to reconcile context-dependent outcomes and to guide future, endogenous-level investigations. Elucidating the biological relevance and mechanisms of PIM kinase action on viral gene expression and latency will help advance our understanding of the virus–host interactions.