HTD1265 Disrupts GimC-Dependent Cellular Processes in Saccharomyces cerevisiae

TL;DR

HTD1265 is a new antifungal drug that disrupts GimC-dependent processes in yeast, offering insights into fungal cell biology and potential therapeutic applications.

Contribution

The study identifies HTD1265 as a novel compound targeting GimC-dependent processes rather than tubulin in fungi.

Findings

HTD1265 causes nuclear mispositioning and impairs mitotic spindle elongation in yeast.

The compound induces GimC deficiency-like effects, including chitin accumulation and actin disorganization.

HTD1265 hypersensitizes yeast mutants lacking GimC subunits, supporting its mechanism of action.

Abstract

HTD1265 is a newly identified antifungal compound that displays potent activity against Candida krusei, a clinically challenging non-albicans species. To elucidate its mechanism of action, we applied an integrative phenotypic approach combining high-resolution morphological profiling, pathway inference, and genetic validation in Saccharomyces cerevisiae. Morphological signature extraction revealed a characteristic defect in nuclear positioning upon HTD1265 treatment. Integration of nuclear positioning traits with global morphological similarity highlighted 36 genes enriched for the Gene Ontology term “tubulin complex assembly.” Consistent with this prediction, HTD1265 impaired mitotic spindle elongation without directly inhibiting tubulin polymerization. HTD1265 further induced hallmarks of GimC (prefoldin) deficiency, including aberrant chitin accumulation, actin disorganization, and nuclear mispositioning, and caused hypersensitivity in GimC subunit mutants. These converging observations suggest that HTD1265 exerts antifungal activity by disrupting GimC-dependent cellular processes rather than by directly targeting tubulin. Our findings highlight GimC-dependent cytoskeletal and cell wall regulatory processes as a critical vulnerability for fungal growth and position HTD1265 as a functional tool for dissecting this pathway.

Figures

Full text

1. Introduction

Invasive fungal infections affect approximately 6.5 million people annually and result in 3.8 million deaths worldwide, of which approximately 2.5 million are directly attributable to the infections themselves [1]. While Candida albicans has long been recognized as the most prevalent pathogenic species, infections caused by non-Candida albicans Candida (NCAC) species have been increasingly reported worldwide in recent years. This trend is particularly evident in patients with hematological malignancies and other immunocompromised conditions. In such patients, NCAC species collectively account for 67.3% of infections, including Candida tropicalis (25.0%), Candida parapsilosis (17.3%), Candida krusei (Pichia kudriavzevii) (13.5%), Candida glabrata (9.6%), and Candida dubliniensis (1.9%), whereas C. albicans accounts for 32.7% of cases [2,3]. The rising prevalence of NCAC species has been linked in part to the widespread use of fluconazole prophylaxis, which selects for species with reduced azole susceptibility [4]. Many NCAC species, including C. tropicalis and C. krusei, exhibit intrinsic or acquired resistance to azoles, which inhibit ergosterol biosynthesis, allowing them to persist and cause disease even under prophylactic or therapeutic exposure [5]. As a result, echinocandins, which target fungal cell wall synthesis by inhibiting β-1,3-glucan formation, have become key alternative agents; however, echinocandin-resistant isolates have also emerged [6,7], further constraining available treatment options.

To address this pressing issue, several alternative therapeutic strategies are currently under active investigation. These include combination therapies to enhance antifungal susceptibility [8,9,10], antifungal coatings for medical devices [11], improved modification of existing drugs [12], and the identification of new drug candidates, including metal-based compounds [13,14]. While these approaches offer practical clinical benefits in the short term, many of them remain extensions of existing pharmacological concepts. In contrast, long-term solutions will ultimately require antifungal agents featuring genuinely novel targets and chemical scaffolds.

The fungal cell wall and cytoskeleton have become increasingly important therapeutic targets because both play essential roles in cell growth, morphogenesis, and survival, yet their structural organization is fundamentally distinct from that of mammalian cells [15]. Fosmanogepix—a prodrug of manogepix—targets Gwt1, an enzyme required for the synthesis of glycosylphosphatidylinositol-anchored proteins, and has shown broad antifungal activity [16]. In parallel, several small-molecule agents have been reported to disrupt cytoskeletal components, including actin- targeting and microtubule-targeting compounds such as occidiofungin, vinblastine, and alteramide B [17,18,19]. These efforts have been driven in large part by phenotype-based drug discovery, which integrates comprehensive phenotypic profiling with computational target inference as an alternative to conventional target-based screening.

In general, antifungal target identification strategies fall into two major categories: target-based approaches and phenotype-based approaches [20]. Target-based approaches begin with the selection of a molecular target, typically an enzyme, followed by screening for compounds that modulate its activity. In contrast, phenotype-based approaches prioritize the initial discovery of compounds with antifungal activity, after which their mechanisms of action are elucidated using omics-based approaches [21,22,23,24]. In light of this, phenotype-based strategies are indispensable not only for elucidating drug mechanisms but also for uncovering previously underexplored cellular processes that may serve as next-generation antifungal targets.

We constructed a phenotype-based antifungal target identification platform centered on high-resolution morphological profiling of Saccharomyces cerevisiae using the CalMorph system [21,22,23]. This platform enabled the identification of small molecules that act potently at low concentrations against both budding yeast and pathogenic fungal species [25]. To determine their mechanisms of action, we compared dose-dependent morphological responses to each compound with those of a comprehensive panel of yeast deletion mutants. This comparison is based on the principle that compounds targeting a particular gene or pathway generate phenotypic patterns similar to those observed in the corresponding genetic perturbations. While this strategy works well when compounds induce a single major phenotypic signature, it becomes difficult to infer mechanisms when compounds trigger complex or mixed morphological responses. To address this limitation, we recently developed an alternative phenotyping framework that improves mechanistic inference by selectively focusing on distinctive morphological features rather than the entire phenotypic profile. Using this approach, we demonstrated that a core phenotypic signature that robustly represents the essential consequences of ergosterol depletion can be extracted, greatly improving the accuracy of mechanistic inference [26].

In this study, we applied our core signature-based phenotyping framework to elucidate the mechanism of action of HTD1265, a nitrogen-containing heterocyclic compound with antifungal activity. To this end, we combined quantitative morphological profiling, chemical genetic analysis, and cell biological assays in S. cerevisiae to pinpoint the cellular processes affected by the compound. This integrated approach consistently indicated that HTD1265 perturbs the GimC (prefoldin), a cytosolic molecular chaperone required for proper folding of tubulin and actin. Altogether, this work highlights the value of phenotype-based approaches in uncovering cellular pathways with antifungal potential.

2. Materials and Methods

2.1. Strains

The S. cerevisiae strain his3Δ (MATa his3::kanMX4 leu2 met15 ura3), a derivative of BY4741 harboring a kanMX4 cassette at the his3 locus, was used as the wild-type strain unless otherwise indicated. The drug-hypersensitive yeast strain Y13206 (3Δ; MATa snq2::Kl.LEU2 pdr3::Kl.URA3 pdr1::natMX can1::STE2pr*-Sp_his5 lyp1 his3 leu2 ura3 met15 LYS2*) was derived from S288C [25]. A quadruple gene-deleted strain lacking genes important for morphology was prepared from the 3Δ strain [25]. Candida strains (C. albicans ATCC24433, C. krusei ATCC6258, C. tropicalis ATCC750, and C. parapsilosis ATCC22019) were obtained from the National BioResource Project for Pathogenic Eukaryotic Microorganisms (Chiba, Japan). The complete list of strains used in this study is shown in Table S1.

2.2. Media

Yeast cells were grown at 25 °C or 30 °C in yeast extract peptone dextrose (YPD)-rich medium containing 1% Bacto yeast extract (BD Biosciences, San Jose, CA, USA), 2% Bacto peptone (BD Biosciences), and 2% glucose (Fujifilm Wako Pure Chemical Corporation, Osaka, Japan). Candida species was grown at 35 °C on Sabouraud agar medium containing 1% (w/v) Bacto-peptone (BD Biosciences), 4% (w/v) glucose, and 1.5% (w/v) agar. For drug sensitivity assays against Candida species, RPMI-1640 medium (Fujifilm Wako Pure Chemical Corporation) was adjusted to pH 6.9 by the addition of 165 mM 3-(N-morpholino)propanesulfonic acid (MOPS; Sigma-Aldrich, St. Louis, MO, USA).

2.3. Drugs

HTD1265 is a synthetic compound listed in the RIKEN Natural Products Depository (NPDepo) library and cataloged as M010001_YR21118 [25]. For this study, HTD1265 was synthesized in-house following a previously reported procedure [27], and the purified compound (201 mg) was used for all experiments. The identity of the synthesized HTD1265 was verified by nuclear magnetic resonance (NMR) and mass spectrometry (MS) analyses and confirmed to match the NPDepo reference spectrum. The compound was dissolved in dimethyl sulfoxide (DMSO) to prepare a 10 mg/mL stock solution and stored at −20 °C until use. Other compounds used in this study were purchased from commercial suppliers as follows: DMSO (Fujifilm Wako Pure Chemical Corporation), fluconazole (Tokyo Chemical Industry, Tokyo, Japan), resazurin (Fujifilm Wako Pure Chemical Corporation), colchicine (Sigma-Aldrich), and paclitaxel (Fujifilm Wako Pure Chemical Corporation).

2.4. General Methods for Analysis

All chemicals were purchased from commercial suppliers (Tokyo Chemical Industry, Fujifilm Wako Pure Chemical Corporation, and Sigma-Aldrich) and used as received unless otherwise specified. Temperatures are reported in degrees Celsius and are uncorrected. The ^1^H NMR spectrum of HTD1265 was recorded on a JMN-ECZ500R spectrometer (JEOL, Tokyo, Japan). Chemical shifts are expressed in parts per million (ppm, δ) relative to tetramethylsilane, with CDCl_3_ used as the internal standard. Splitting patterns are designated as follows: s, singlet; d, doublet; t, triplet; m, multiplet. Compound purity and characterization were established by a combination of LCMS and NMR analyses. HTD1265 was determined to be ≥95.0% pure by high-performance LC analysis. LCMS analysis was performed using a Waters Acquity ultra performance liquid chromatography (UPLC) analytical system with a diode array detector coupled to a single-quadrupole mass spectrometer, equipped with an Acquity UPLC BEH C18 column (2.1 mm × 50 mm, 1.7 μm). The analytical conditions were as follows: electrospray ionization (ESI) positive mode, flow rate of 0.6 mL/min, 5–95% MeCN in H_2_O containing 0.1% trifluoroacetic acid, total run time of 2 min, detection at λ = 254 nm.

2.5. Synthesis

A mixture of 1-(2-methoxyphenyl)pyrrole-2,5-dione (200 mg, 0.98 mmol) and piperidine (88 mg, 1.03 mmol) in dioxane (2 mL) was stirred at 100 °C for 1 h under a nitrogen atmosphere. After cooling to room temperature, the reaction mixture was evaporated under reduced pressure and purified by silica gel column chromatography (hexane/ethyl acetate = 1:2 to 1:1). Evaporation of the eluent afforded 225 mg (0.78 mmol, 79.3% yield) of 1-(2-methoxyphenyl)-3-(piperidin-1-yl)pyrrolidine-2,5-dione (HTD1265) [27].

NMR (500 MHz, CDCl_3_) δ 1.50 (t, J = 5.8 Hz, 2 H), 1.62–1.66 (m, 4 H), 2.59–2.61 (m, 2 H), 2.84–2.86 (m, 3 H), 2.95–3.10 (m, 1 H), 3.02 (s, 3 H), 3.94–3.97 (m, 1 H), 7.00–7.03 (m, 2 H), 7.09 (d, J = 7.5 Hz, 1 H), 7.37–7.40 (m, 1 H).

LCMS (ESI+): m/z 289.3 [M + H]^+^. LC purity was determined to be 98.9%.

2.6. Antifungal Susceptibility Test Using S. cerevisiae Strains

Antifungal susceptibility was assessed using the S. cerevisiae wild-type his3Δ strain and the drug-hypersensitive strain Y13206 (3Δ), following previously described methods [23]. Yeast cells were grown in YPD at 25 °C with rotation overnight to reach the logarithmic phase. Overnight cultures were diluted with YPD and subsequently inoculated into fresh YPD to obtain a final density of 1 × 10^6^ cells/mL. HTD1265 was dissolved in DMSO, and working solutions were prepared in YPD to achieve final concentrations ranging from 0 to 50 µg/mL (final DMSO concentration, 0.1%). In 96-well flat-bottom plates (Corning Inc., Corning, NY, USA), 10 µL of the cell suspension and 100 µL of YPD containing HTD1265 or vehicle control were dispensed, mixed using a Titramax 1000 rotator (Heidolph, Schwabach, Germany; 1050 rpm for 3 min), and incubated at 30 °C for 18 h. Optical density was measured at 600 nm using a SpectraMax Plus 384 plate reader (Molecular Devices, San Jose, CA, USA). IC_50_ values were calculated from dose–response curves generated in R (v4.2.2; R Core Team, Vienna, Austria) using the four-parameter log-logistic model implemented in the drm function of the drc package (v. 3.0-1) [28].

Additional assays were conducted using 3Δ background mutants lacking tubulin-folding-related genes (cin1, cin2, cin4, pac2, pac10, gim1, gim3, gim4, gim5, and rbl2) and BY4741 background mutants lacking GimC genes (gim1, pac10, gim3, gim4, gim5, and gim6). In these assays, HTD1265 was tested at final concentrations ranging from 0 to 100 µg/mL (final DMSO concentration, 0.1%).

2.7. Antifungal Susceptibility Testing in Candida Species and Resazurin Cell Viability Assay

Susceptibility testing of Candida species was performed in accordance with Clinical and Laboratory Standards Institute document M60 [29]. Briefly, colonies were picked from Sabouraud dextrose agar plates, and a cell suspension with a density of approximately 1–4 × 10^6^ cells/mL was prepared. This suspension was then diluted in RPMI-1640 medium to a final concentration of approximately 5 × 10^3^ cells/mL. Serial dilutions of HTD1265 and fluconazole were prepared to yield final concentrations ranging from 64 to 0 µg/mL, along with a drug-free control (final DMSO concentration ≤ 1.28% in all wells). Diluted cells and DMSO solutions with or without the drug were dispensed into 96-well round-bottom microplates and incubated at 35 °C in a static incubator. Fungal cell killing was evaluated using the resazurin cell viability assay, as described previously [30]. After incubation with the indicated drug concentrations, resazurin was added to each well to a final concentration of 0.01% (v/v), and the plates were further incubated for 24–48 h. Following incubation, cell growth was evaluated visually using the following scoring system: 0, optically clear; 2, slight decrease in turbidity; 3, prominent decrease; and 4, marked turbidity. These scores were used for heatmap visualization. For the resazurin viability assay, the color of each well was assessed visually, with blue or purple indicating the absence of metabolic activity (dead cells) and pink indicating metabolically active, viable fungal cells.

2.8. Morphological Analysis

Logarithmic-phase wild-type cells were treated with several concentrations of HTD1265 (0, 3.5, 4.0, 4.5, and 6.0 µg/mL, final concentrations). After fixation, cells were stained with fluorescein isothiocyanate–concanavalin A (FITC-ConA; Sigma-Aldrich) for mannoproteins, rhodamine–phalloidin (Invitrogen, Waltham, MA, USA; 200 units/mL in methanol) for actin, and 4′,6-diamidino-2-phenylindole (Fujifilm Wako Pure Chemical Corporation) for nuclear DNA. Images were acquired at room temperature using a fluorescence microscope (Axioplan 2; Carl Zeiss AG, Oberkochen, Germany) equipped with a cooled charge-coupled device camera (CoolSNAP HQ; Roper Scientific Photometrics, Tucson, AZ, USA). Yeast cell image analysis was performed using CalMorph software (version 1.2), as described previously [31]. CalMorph automatically characterizes each yeast cell by calculating 501 morphological parameters based on data obtained from more than 200 cells. A Jonckheere–Terpstra test was applied to the 501 parameters to identify those exhibiting significant drug concentration-dependent changes. Morphological data for 4718 non-essential gene deletion mutants were obtained previously [31]. All statistical analyses were performed using R (http://www.r-project.org/).

2.9. CalMorph-Based Single-Cell Morphological Parameter Extraction and Distribution Analysis

CalMorph outputs coordinate data for individual cells, which serve as raw measurements for the calculation of morphological parameters prior to any averaging. In this study, we focused on nuclear parameters (D128_C, D141_C, D163_C, and D162_C) that exhibited drug dose-dependent changes. For these parameters, pre-averaged values were computed for each individual cell, and histograms were generated based on their distributions. Visualization of single-cell-level parameter values as histograms enabled detailed analysis of trends in dose-dependent morphological alterations. These analyses allowed us to assess variability within each cell population and to compare morphological profiles between drug-treated and untreated samples.

2.10. Gene Ontology (GO) Enrichment Analysis

GO enrichment analysis was performed using the set of 36 genes. Enrichment analysis was conducted with DAVID Bioinformatics Resources (https://davidbioinformatics.nih.gov), and the resulting data were visualized using R. Fold enrichment values were plotted on the x-axis, with higher values indicating stronger enrichment and reflecting a greater proportion of genes associated with a given GO term within the analyzed gene list. GO enrichment was evaluated across three categories: Biological Process (A), Cellular Component (B), and Molecular Function (C). Statistical significance was represented as −log10 (p value), with higher values (pink color) indicating stronger significance and lower values (blue color) indicating weaker significance. The size of each plotted circle corresponds to the number of genes from the input list associated with each enriched GO term.

2.11. Fluorescence-Based Quantification of Tubulin in the Cin8–mNeonGreen (mNG) Strain

The mNG strain was constructed from strain Y13206. Briefly, an mNG fragment followed by a hygromycin resistance cassette was amplified by polymerase chain reaction (PCR) using pYLB10 as the template. The primers used for amplification were as follows. Forward primer (116 bp): 5′-CCAGTGAAAATGTGGACAATGAGGGCTCGAGAAAAATGTTAAAGATTGAAGGTGGAGGAGGTTCTGGAGGAGGTGGTTCCGGTGGTGGAGGATCTATGGTGAGCAAGGGCGAGGAG-3′ (containing a (G_4_S)3 linker); reverse primer (70 bp): 5′-TATTAACCACTAGTTTGAATATATATTCGACTGAAAGGCAATATCAACTACAGTATAGCGACCAGCATTC-3′. PCR validation of Cin8–mNG integration was performed using the following primers: forward, 5′-GGACAAGTGGAAGAATCGGAG-3′; reverse, 5′-CCTTCTCTTCTGTCTTGCCTTC-3′. PCR conditions were as follows. KOD Plus Neo (TOYOBO, Osaka, Japan) was used as the DNA polymerase. PCR was performed with an initial denaturation at 94 °C for 2 min, followed by 35 cycles of denaturation at 98 °C for 10 s, annealing at 58 °C for 30 s, and extension at 68 °C for 90 s, and a final hold at 4 °C. PCR products were analyzed by electrophoresis on a 0.8% agarose gel in 0.5× TAE buffer (Tris–acetate–EDTA). Yeast transformation was carried out with slight modifications to the protocol described in Methods in Yeast Genetics: A Cold Spring Harbor Laboratory Course Manual (2015) [32]. The constructed Cin8–mNG strain was cultured overnight and subsequently inoculated into fresh medium at a density of 2.5 × 10^6^ cells/mL. Drug treatment was performed with HTD1265 at final concentrations of 0, 25, and 50 μg/mL. After incubation at 30 °C for 4 h, cultures were centrifuged, and cells were washed twice with phosphate-buffered saline (PBS). Fluorescence imaging was performed using a confocal laser scanning microscope (FV-3000; Olympus, Tokyo, Japan). Filter set (excitation, 488 nm; emission, 500–550 nm) was used for fluorescence imaging. Quantitative measurements were conducted using a fluorescence microscope (Axioplan 2; Carl Zeiss AG, Oberkochen, Germany) equipped with a Plan-NEO 100× objective lens. A FITC filter set (excitation, 470/40 nm; emission, 525/50 nm; exposure time, 200 ms; intensity, 100%) was used for quantitative analysis. For three independent experiments, the average tubulin length of cells treated with each drug concentration was calculated, and an overall mean value across the three experiments was determined. Statistical analysis was performed using a two-tailed Student’s t-test.

2.12. In Vitro Fluorescence-Based Microtubule Polymerization Assay

The fluorescence-based microtubule polymerization assay was performed using previously described methods [33]. Porcine brain tubulin (1 mg/mL) was incubated with DMSO or drugs in the presence of 10 μM DAPI and either 0.8 M or 0.2 M glutamate for 20 min at 37 °C. Drug concentrations were used as follows: (A) under assembly-promoting conditions, 5 μM colchicine and 5, 10, or 15 μg/mL HTD1265 in the presence of 0.8 M glutamate; and (B) under non-assembly conditions, 3 μM paclitaxel and 10, 30, or 100 μg/mL HTD1265 in the presence of 0.2 M glutamate. Values represent the mean ± standard deviation of three independent experiments (n = 3).

2.13. Chitin Staining and Quantification

Yeast cells were grown in YPD at 25 °C with shaking at 200 rpm overnight to reach the logarithmic phase (1–4 × 10^7^ cells/mL). Log-phase cells (approximately 2 × 10^6^ cells) were collected by centrifugation and washed once with PBS. The cell pellet was resuspended in 100 µL of PBS, and 5 µL of wheat germ agglutinin-tetramethylrhodamine conjugate (5 mg/mL; Invitrogen) was added. Cells were incubated for 10 min at room temperature and washed twice with PBS. For microscopic observation, washed cells were resuspended in glycerol on a glass slide, and fluorescence images were acquired using a fluorescence microscope (Axioplan 2; Carl Zeiss AG) equipped with a Plan-NEO 100× objective lens and a rhodamine filter (excitation, 550/25 nm; emission, 605/70 nm). More than 200 cells were imaged across three independent experiments, and chitin fluorescence intensity was quantified using Fiji [34].

3. Results

3.1. HTD1265 Is a Novel Antifungal Compound Exhibiting Fungicidal Activity Against C. krusei

HTD1265 is a synthetic nitrogen-containing heterocyclic compound with a unique chemical scaffold (Figure 1A). It is listed in the NPDepo library, and a purified batch was synthesized in-house for this study to secure sufficient material for large-scale phenotypic and mechanistic analyses. HTD1265 was initially identified as a hit in our phenotype-based antifungal screening using S. cerevisiae, in which the compound exhibited strong growth-inhibitory activity even at low concentrations. We then quantified the antifungal activity of HTD1265. In S. cerevisiae, HTD1265 inhibited growth with an IC_50_ of 16.7 μg/mL in the wild-type strain, whereas a drug efflux-deficient mutant (Y13206; 3Δ strain) showed slightly enhanced sensitivity (IC_50_ = 14.8 μg/mL) (Figure S1A). We then tested HTD1265 against four clinically relevant Candida species (C. albicans, C. parapsilosis, C. tropicalis, and C. krusei). Among them, C. krusei exhibited the greatest susceptibility, showing complete growth inhibition at 64 μg/mL (Figure 1B). A resazurin-based viability assay further demonstrated that HTD1265 exerted fungicidal activity against C. krusei at the same concentration (Figure 1C). Fluconazole served as a positive control, and all results met the required quality control standards (Figure S1B,C). Together, these results established HTD1265 as a structurally unique antifungal compound that is effective against C. krusei, thereby justifying subsequent mechanistic investigation.

3.2. Nuclear Positioning Signature Is the Core Cellular Response to HTD1265

To characterize the cellular response to HTD1265, we quantified morphological changes in S. cerevisiae using the CalMorph system. Cells were treated with five concentrations of HTD1265 and triple-stained for the cell wall, actin, and nuclear DNA, followed by fluorescence microscopy and CalMorph-based feature extraction (Figure S2; n = 5 per condition). To identify dose-dependent responses, we applied the Jonckheere–Terpstra trend test with a false discovery rate (FDR) threshold of 0.05 to all CalMorph parameters (Table S2). Among the parameters that passed this criterion, the most prominent concentration-dependent changes were observed in nuclear positioning indices, including distance-based indices (D128_C and D141_C) and angle-based indices (D163_C and D162_C). D128_C and D141_C increased significantly with increasing drug concentration, indicating that nuclei were displaced toward the bud neck rather than establishing normal apical separation (Welch’s t-test, p < 0.05) (Figure 2A,B,E,F; Figures S3 and S4). Similarly, D163_C and D162_C showed a shift from nuclei aligned at 0–10° toward misaligned angles of 15–20°, reflecting angular displacement (Figure 2C,D,G,H; Figures S3 and S4). Representative fluorescence images of HTD1265-treated cells (Figure 2I) were consistent with these quantitative measurements (Figure 2J). These results demonstrated that HTD1265 induces specific and dose-dependent defects in nuclear positioning, suggesting disruption of microtubule-dependent processes.

3.3. Pathway Inference Based on the Extracted Nuclear Positioning Signature

Using the extracted nuclear positioning signature as a mechanistic cue, we next investigated the cellular process perturbed by HTD1265. First, gene deletion mutants exhibiting abnormalities in the nuclear positioning traits defining the core HTD1265 signature were extracted from the CalMorph database (104 genes; Figure 3A). In parallel, mutants showing high global morphological similarity to HTD1265-treated cells were identified based on whole-profile comparisons in a reduced-dimensional feature space (221 genes; Figure 3A). The intersection of these two mutant sets (36 genes), therefore, represents the candidates most consistent with the HTD1265-induced morphological signature, because only the overlap retains genes supported by both independent criteria, thereby minimizing false positives. GO enrichment analysis of these 36 genes revealed a highly significant enrichment for the biological process “GO:0007021 tubulin complex assembly”, highlighting this pathway as mechanistically linked to the HTD1265-induced morphological phenotype (Figure 3B). To genetically validate the involvement of the tubulin complex assembly pathway, we performed drug sensitivity assays using deletion mutants of 10 genes annotated to this process. Seven mutants—cin1Δ, cin2Δ, pac2Δ, pac10Δ, gim1Δ, gim3Δ, and gim4Δ—exhibited significantly higher sensitivity to HTD1265 than the parental strain Y13206 (Figure S5), with cin2Δ and pac10Δ showing the strongest hypersensitivity (Figure 3C). Furthermore, the nuclear morphology of pac10Δ, cin2Δ, and cin4Δ mutants resembled that induced by HTD1265 treatment (Figure 3D), reinforcing the conclusion that disruption of genes involved in tubulin complex assembly reproduces the characteristic nuclear phenotype observed in HTD1265-treated cells. Altogether, the convergence of three independent lines of evidence—highly significant GO enrichment for tubulin complex assembly, hypersensitivity of mutants lacking pathway components, and reproduction of HTD1265-induced nuclear defects in these mutants—supported a mechanistic link between HTD1265 and the tubulin complex assembly pathway.

3.4. HTD1265 Impairs Mitotic Spindle Elongation Without Directly Targeting Tubulin

To determine whether disruption of the tubulin complex assembly pathway leads to defects in microtubule dynamics, we next examined the effects of HTD1265 on microtubule organization. Spindle behavior during mitosis was monitored using cells expressing Cin8–mNG, in which the spindle-associated kinesin Cin8 [35] is fluorescently labeled. Treatment with HTD1265 resulted in markedly shorter spindles compared with untreated cells (Figure 4A), consistent with impaired spindle elongation [36]. Quantitative analysis confirmed a concentration-dependent reduction in spindle length across the tested doses (0, 25, and 50 μg/mL) (Figure 4B; Figure S6). As proper spindle elongation is essential for nuclear division, we next examined whether this defect affects cell cycle progression. CalMorph-based cell cycle classification (Figure S7) revealed a significant reduction in the proportion of M-phase cells in HTD1265-treated populations (Figure 4C). This decrease suggested that HTD1265 induces defects prior to efficient mitotic entry, indicating that its impact extends beyond spindle elongation alone. To assess whether HTD1265 directly affects tubulin polymerization, we performed an in vitro fluorescence-based polymerization assay using purified porcine tubulin. HTD1265 neither inhibited polymerization under polymerizing conditions nor promoted polymerization under non-polymerizing conditions (Figure 5), indicating that tubulin itself is unlikely to be the direct molecular target. Collectively, these findings demonstrated that HTD1265 blocks mitotic spindle elongation without directly affecting tubulin polymerization. Notably, the reduced fraction of M-phase cells further suggested that HTD1265 impairs an upstream process acting before spindle elongation, rather than spindle elongation per se, which likely contributes to the broader cellular abnormalities observed.

3.5. HTD1265 Induces Phenotypes Characteristic of GimC Deficiency

Because HTD1265 does not directly inhibit tubulin polymerization, we next investigated upstream regulators of microtubule assembly to identify candidate pathways underlying its cellular effects. Among these, the six-subunit GimC [37,38]—Gim1/Yke2, Gim2/Pac10, Gim3, Gim4, Gim5, and Gim6/Pfd1—emerged as a strong candidate, as multiple GimC subunits were represented among the genes defining the HTD1265-induced nuclear positioning signature. The GimC functions as a cytosolic molecular chaperone required for the proper folding of both tubulin and actin, raising the possibility that HTD1265 perturbs GimC-dependent cellular processes. To test this hypothesis, we analyzed chitin accumulation, a well-established downstream phenotype associated with impaired GimC function through its effects on actin-dependent cell wall organization [39,40,41,42]. Both pac10Δ cells and HTD1265-treated wild-type cells exhibited pronounced chitin deposition at the bud neck, as confirmed by fluorescence quantification (Figure 6A). Consistent with this observation, increased chitin accumulation was also detected in mutants lacking other GimC subunits (Figure 6B). Moreover, combined cin2Δ mutation and HTD1265 treatment further exacerbated chitin accumulation compared with either condition alone (Figure 6C), indicating that HTD1265 and loss of GimC components exert additive effects within the same pathway rather than acting through a single redundant mechanism. Altogether, these results indicated that HTD1265 functionally converges on the GimC pathway, inducing hallmark phenotypes of GimC deficiency and further aggravating defects in cin2Δ cells rather than acting redundantly. This convergence provides a mechanistic link between the HTD1265-induced morphological signature and multiple downstream consequences of impaired GimC function.

3.6. GimC Is Required for Cellular Resistance to HTD1265

To further validate the involvement of GimC in the cellular response to HTD1265, we examined the sensitivity of GimC deletion mutants to the compound. Drug sensitivity assays revealed that all GimC-deficient strains exhibited pronounced hypersensitivity to HTD1265 (Figure 7A, Table S3), supporting the notion that impairment of GimC-dependent processes enhances cellular vulnerability to this compound. In addition, HTD1265-treated wild-type cells displayed marked alterations in actin-related morphological parameters (A7-1_C and A108_C) (Figure 7B, Table S2), which represent hallmark features of GimC dysfunction. Consistent with this observation, CalMorph analysis showed that several gim mutants—most notably gim3Δ—exhibited a similar increase in A7-1_C (size of the actin region in the mother cell; Figure 7C, Table S4), further reinforcing the link between HTD1265 treatment and actin-related defects characteristic of impaired GimC function. Altogether, HTD1265 induced a characteristic set of morphological abnormalities, including nuclear mispositioning, actin disorganization, and aberrant chitin accumulation, closely mirroring the phenotypic spectrum observed in GimC-deficient strains. These converging lines of evidence indicated that HTD1265 functionally converges on the GimC pathway and exerts its antifungal effects through disruption of GimC-dependent cellular processes.

4. Discussion

This study characterized HTD1265 as a previously unreported antifungal compound with potent fungicidal activity against C. krusei. Using S. cerevisiae as a model system, we further show that HTD1265 induces a distinctive morphological signature in S. cerevisiae. Morphology-based profiling identified nuclear mispositioning as the most prominent feature of the core HTD1265-induced phenotype. Consistent with this observation, HTD1265 impaired mitotic spindle elongation without directly affecting tubulin polymerization, indicating that its primary cellular target acts upstream of tubulin assembly. Integrated analyses combining GO enrichment and phenotype similarity strongly implicated GimC as the pathway most plausibly affected by HTD1265. Collectively, these findings position HTD1265 as the first small molecule reported to perturb cellular processes dependent on GimC function and highlight the power of morphology-based profiling to uncover antifungal agents with previously unrecognized mechanisms of action.

4.1. Mechanism of Action of HTD1265

HTD1265 induces multiple intracellular abnormalities, including nuclear mispositioning, actin disorganization, and aberrant chitin accumulation, that collectively point to disruption of GimC-dependent processes. The GimC plays a critical role in the folding and stabilization of newly synthesized cytoskeletal proteins, including both tubulins and actins [44,45,46]. Acting upstream of the CCT/TRiC chaperonin, GimC captures nascent cytoskeletal polypeptides and delivers them to TRiC for productive folding, a process essential for the formation of functional microtubule and actin networks [39,40,46]. Consequently, impairment of GimC function would be expected to cause concurrent defects in both microtubule and actin organization, consistent with the phenotypes observed following HTD1265 treatment.

Aberrant chitin deposition represents a well-established compensatory response to actin dysfunction and impaired cell wall assembly [41,42]. Thus, the pronounced chitin accumulation observed under HTD1265 treatment is likely a downstream consequence of actin network disruption rather than a direct effect on cell wall synthesis. Altogether, these findings support the GimC pathway as a plausible mechanistic target of HTD1265 (Figure 8).

Several non-mutually exclusive mechanistic possibilities remain. First, HTD1265 may directly inhibit GimC activity. Second, the compound may interfere with upstream factors required for efficient cytoskeletal protein folding. Third, HTD1265 may destabilize client proteins of the GimC, thereby indirectly compromising cytoskeletal assembly. Individual GimC subunits are non-essential, indicating that the cellular consequences of HTD1265 treatment cannot be fully explained by a simple genetic loss-of-function model. This distinction suggests that acute chemical perturbation can reveal vulnerabilities in cytoskeletal protein folding that are not apparent in stable gene deletion backgrounds. Discriminating among these possibilities will require future biochemical and structural studies to determine whether HTD1265 directly interacts with GimC components or modulates the stability of cytoskeletal substrates.

4.2. Comparison with Microtubule-Targeting Agents

Although HTD1265 induces microtubule-associated phenotypes, our data indicate that it does not function as a classical microtubule inhibitor. Canonical microtubule-targeting agents, such as nocodazole and related antimitotic compounds, exert their effects by directly binding tubulin, but their clinical utility has been limited by substantial off-target toxicity in human cells [47,48]. In contrast, the microtubule defects observed under HTD1265 treatment arise in the context of broader impairments in cytoskeletal protein folding, consistent with disruption of the GimC pathway. This mechanistic distinction suggests that targeting upstream folding processes—rather than tubulin dynamics per se—may represent a novel strategy for perturbing cytoskeletal organization with greater potential for fungal selectivity.

Recent structural and biochemical studies have identified subtle yet functionally significant differences between mammalian and fungal microtubules [49], supporting the feasibility of exploiting such distinctions for antifungal drug development. Indeed, several benzimidazole-class antifungals selectively target fungal microtubules while sparing mammalian counterparts [50]. Although the direct molecular target of HTD1265 remains to be defined, its indirect impact on microtubule organization suggests that chemical optimization could yield analogs with enhanced fungal selectivity through preferential engagement of fungal cytoskeletal pathways. Importantly, focusing on the GimC pathway offers a conceptual advantage over direct tubulin targeting: the folding and maturation of cytoskeletal subunits involve species-specific sensitivities and cofactor requirements, providing additional molecular distinctions between fungal and mammalian systems. These upstream processes therefore represent an underexplored and potentially more selective intervention point than the highly conserved tubulin binding pocket. Thus, while HTD1265 is mechanistically distinct from conventional microtubule inhibitors, the phenotypes it induces highlight the broader concept that cytoskeletal protein folding and maturation pathways constitute promising yet underappreciated targets for antifungal drug development. It should be noted that the present study was designed to elucidate the cellular mechanism of action of HTD1265 using fungal model systems and did not assess its effects on mammalian cells. Evaluation of host cell toxicity therefore remains an important subject for future investigation.

4.3. Efficacy of the Novel Antifungal Agent HTD1265 Against C. krusei Infections

NCAC species, including C. krusei, have emerged as major opportunistic pathogens and represent an urgent clinical challenge because of their reduced susceptibility to existing antifungal therapies. Infections caused by C. krusei are associated with high mortality rates, reported to range from 40% to 58%, and are particularly difficult to manage due to poor responses to standard antifungal treatments [51]. A principal contributor to this therapeutic limitation is the intrinsic resistance of C. krusei to fluconazole, a first-line agent widely used in the treatment of candidiasis. Notably, more than 95% of clinical C. krusei isolates are fluconazole-resistant, underscoring the critical need for antifungal agents with novel mechanisms of action [51].

Although recent efforts have identified compounds with activity against NCAC species, many candidates, including the fungal CYP51 inhibitors VT-1161 and VT-1129, are derived from established azole scaffolds and therefore remain susceptible to similar resistance mechanisms [52]. As a result, there is increasing demand for antifungal agents that act through fundamentally distinct cellular pathways. HTD1265 addresses this unmet need by exhibiting antifungal activity against C. krusei while operating through a mechanism unrelated to ergosterol biosynthesis or direct microtubule inhibition. The species-specific activity of HTD1265 against C. krusei may be related to its genetic background, as C. krusei is phylogenetically closer to S. cerevisiae than to C. albicans [53]. The higher cell wall hydrophobicity of C. krusei [53] may also have influenced the initial interaction of the compound with fungal cells, potentially contributing to differences in antifungal activity.

Instead, its effects on cytoskeletal protein folding pathways distinguish it mechanistically from all currently approved antifungal drug classes. By targeting an upstream and previously unexploited cellular vulnerability, HTD1265 introduces a new conceptual framework for antifungal drug discovery and represents a promising lead compound for the development of next-generation therapies against intrinsically drug-resistant NCAC infections. Several limitations of the present study warrant consideration. First, the antifungal activity and cellular effects of HTD1265 were evaluated exclusively in fungal systems, including S. cerevisiae and selected Candida species. Accordingly, the safety and toxicity of HTD1265 toward host cells were not assessed in this work, and the possibility of host cell toxicity cannot be excluded based on the current data. Further studies using mammalian cell cultures and in vivo infection models will be necessary to determine whether the mechanistic advantages observed in fungal cells translate into a favorable therapeutic window.

5. Conclusions

This study identified and characterized HTD1265 as a novel antifungal compound with reproducible activity against C. krusei. Integrative phenotypic analyses in S. cerevisiae demonstrated that HTD1265 induces a coordinated spectrum of cytoskeletal and cell wall-associated abnormalities, including defects in nuclear positioning, actin organization, and chitin accumulation. These phenotypes closely mirror those resulting from impaired function of the GimC, implicating disruption of GimC-dependent cytoskeletal protein folding processes as a central feature of HTD1265 activity. Rather than acting as a conventional microtubule inhibitor, HTD1265 perturbs cytoskeletal homeostasis through a mechanism distinct from those of existing antifungal agents. Together, our findings highlight GimC-dependent pathways as a previously underexplored vulnerability in fungal cells and underscore the power of morphology-based phenotypic screening to uncover antifungal compounds with unconventional and potentially more selective mechanisms of action.