Evidence of Wild Boars as a Reservoir of Zoonotic Hepatitis E Virus Genotype 3: Implications for Public Health in Argentina

TL;DR

Wild boars in Argentina carry a zoonotic hepatitis E virus, posing a public health risk due to their proximity to urban and livestock areas.

Contribution

This study confirms the presence of HEV genotype 3 in wild boars in Argentina and identifies its zoonotic potential.

Findings

42.4% of wild boars tested positive for HEV antibodies.

HEV RNA was detected in 9.1% of fecal and 12.5% of liver samples.

Recovered viral sequences clustered within zoonotic HEV genotype 3, closely related to human cases in Argentina.

Abstract

Hepatitis E virus (HEV) is a global public health concern, causing over 20 million infections annually. It is primarily transmitted via the fecal–oral route, with wild boars and domestic swine as major reservoirs involved in zoonotic transmission. Bahía de Samborombón is an important natural reserve in Argentina characterized by a high population of wild boars, located in a livestock-intensive region near major urban centers. As part of a wild boar control program, 11 sampling campaigns were carried out between 2022 and 2023. Fecal, blood, and liver samples were systematically collected from 80 captured animals for the detection and characterization of HEV through antibody and RNA testing. Serological analysis revealed a positivity rate of 42.4%, whereas RT-qPCR detected HEV RNA in 9.1% of fecal samples and 12.5% of liver samples. From the positive samples, seven viral sequences were recovered using RT-nested PCR, including six from ORF1 and one from ORF2. Phylogenetic analysis clustered these sequences within zoonotic HEV genotype 3, showing a close relationship with human sequences from Buenos Aires and neighboring provinces. This study confirms the presence of HEV in wild boars from Argentina, highlighting the circulation of genotype 3, clade abchijklmno and the associated zoonotic risk.

Figures

Tables

Table 1. Primer sequences used in this study.

Target Region Primers/Probe	Sequence (5′ → 3′)	Product Length (bp)	Reference
ORF3 Fw	GGTGGTTTCTGGGGTGAC	69	[18]
ORF3 Rv	AGGGGTTGGTTGGATGAA
ORF3 Probe	FAM-TGATTCTCAGCCCTTCGC-BHQ
ORF1 Fw	CTGGCATYACTACTGCYATTGAGC	418	[20]
ORF1 Rv	CCATCRARRCAGTAAGTGCGGTC
ORF1 nFw	CTGCCYTKGCGAATGCTG	287
ORF1 nRv	GGCAGWRTACCARCGCTGAACATC
ORF2 Fw	AATTATGCYCAGTAYCGRGTTG	731	[19]
ORF2 Rv	CCCTTRTCYTGCTGMGCATTCTC
ORF2 nFw	GTWATGCTYTGCATWCATGGCT	348
ORF2 nRv	AGCCGACGAAATCAATTCTGTC

Full text

1. Introduction

The Hepeviridae family is composed of spherical, non-enveloped or quasi-enveloped viruses characterized by a positive single-stranded RNA genome, with a size ranging from 6.4 to 7.2 kilobases. Hepatitis E virus (HEV) is classified within the subfamily Orthohepevirinae, genus Paslahepevirus, and species Paslahepevirus balayani [1].

Hepatitis E represents a global health concern, with over 20 million infections annually [2]. The virus is predominantly transmitted via the fecal–oral route, often through contaminated water or contact with infected animals [2]. Although most infections remain asymptomatic, HEV typically manifests as an acute disease that resolves over weeks. In immunocompromised individuals, older adults, and pregnant women, HEV infection may progress to chronic hepatitis, severe disease and/or other extrahepatic manifestations [3].

Currently, eight genotypes and multiple clades and subtypes of HEV have been described [4]. Among these, only genotypes HEV-3 and HEV-4 have been detected in humans and several mammalian species including pigs, rabbits, deer and collared peccaries [5,6,7]. Additionally, genotype HEV-7 has been reported as a zoonotic genotype found in humans that consumed camel meat and milk [8].

According to different studies, domestic swine, wild boars and deer are the main reservoirs of HEV and play an important role in the zoonosis of this disease via the direct contact with or ingestion of contaminated meat or water as the source of infection [9,10,11,12]. Wild boars (Sus scrofa) are an introduced, non-native species in Argentina, currently widely distributed across the country. This species poses a serious risk not only to native flora and fauna, but also by acting as a potential reservoir and source of HEV infection. To date, only one previous study has reported the detection of HEV antibodies and RNA in wild boars from serum samples [13], suggesting that they could be a viral reservoir in Argentina, although molecular characterization could not be performed.

Bahía de Samborombón is a 250,000 ha nature reserve located 150 km from Buenos Aires city. Studies conducted in this reserve have estimated wild boar population densities of up to 7.78 individuals per square kilometer [14,15], highlighting the important presence of wild boar in this area. In addition, the reserve is located close to the largest urban center in Argentina and major livestock production zones and is subject to human activities such as tourism, livestock management, and population control programs, which may increase opportunities for context-specific human–wildlife contact.

The present study aimed to investigate the presence and phylogenetic analysis of HEV in the wild boar population in Bahía de Samborombón, an area considered of great interest due to its intensive cattle production, context-specific human–wildlife interactions associated with rural activities, recreational hunting, and seasonal tourism, and the proximity to the most densely populated area in the country.

2. Materials and Methods

2.1. Study Area and Sample Collection

The study was conducted in Bahía de Samborombón, Buenos Aires Province, an area located between Punta Piedras (35°27′ S; 56°45′ W) and Punta Rasa (36°22′ S; 56°35′ W) (Figure 1). This area is the focus of a program overseen by the government to control wild boars, aiming at minimizing their impact on local biodiversity (https://normas.gba.gob.ar/ar-b/disposicion/2019/3/213696) (accessed on 8 January 2026). A total of 11 samplings were conducted between April 2022 and September 2023 in this area, with the capture of 80 adult animals using cages and tracking techniques by park rangers according to a national disposition. Animals were humanely killed according to the American Veterinary Medical Association guidelines, 2020 Edition (https://www.avma.org/sites/default/files/2020-01/2020_Euthanasia_Final_1-15-20.pdf) (accessed on 8 January 2026). Blood, liver and fecal samples were collected for each animal and stored at −20 °C until testing.

2.2. Sample Preparation

Blood samples: Eighty whole blood samples were obtained from the thoracic cavity during necropsy and centrifuged at 1500 rpm for 10 min. As fourteen samples were excluded from the analysis due to hemolysis, sixty-six serum samples were stored at −20 °C until their subsequent use for the detection of anti-HEV antibodies.

Stool samples: Sixty-six fecal samples obtained from the rectal ampulla were diluted 1/10 in phosphate-buffered saline (PBS), followed by vigorous vortexing and centrifugation at 10.000 rpm for 20 min at 4 °C. The resulting supernatant was then utilized for the extraction of viral RNA using the Bosphore Nucleic Acid Extraction Versatile Spin Kit (400 µL sample input, 50 µL output) in accordance with the manufacturer’s instructions. Due to sampling limitations, fecal material could not be collected from the other 14 animals.

Liver samples: Fifty-six liver samples recovered from the abdominal cavity were mechanically disintegrated in a mortar with the addition of sterile sand and 5 mL of PBS. The resulting homogenate was centrifuged at 1500 rpm for 10 min at 4 °C. The obtained supernatant was subjected to RNA extraction, as previously mentioned for stool samples. Twenty-four liver samples were discarded due to their high degree of decomposition, which would have complicated the subsequent recovery of viral RNA.

2.3. Serological Detection of Anti-HEV Antibodies

Serum samples recovered from whole blood were tested for total antibodies against HEV (IgM, IgG and IgA) using the Dia.Pro commercial ELISA kit (Ultra-Dia.Pro, Milan, Italy) according to the manufacturer’s instructions. This multispecies ELISA has been previously applied for the detection of anti-HEV antibodies in domestic and wild animal species [16,17].

2.4. Molecular Detection

Five microliters of the extracted RNA from stool and liver samples were subjected to real-time polymerase chain reaction (RT-qPCR) for HEV-RNA detection using StepOne™ Real-Time PCR equipment (Applied Biosystems, Foster City, CA, USA). The target was a genomic region within the HEV ORF3 gene, as delineated in the protocol previously described by Jothikumar [18] (Table 1).

Positive RT-qPCR samples were retrotranscribed using random primers and MMLV Reverse transcriptase (Promega, Madison, WI, USA). The obtained cDNA was subjected to nested PCRs to amplify ORF1 and ORF2 genomic fragments, with primers listed in Table 1, following protocols previously described [19,20]. The amplified DNA fragments were identified using agarose gel electrophoresis at 100 V for 30 min, following staining with sybr safe.

2.5. Sequencing and Phylogenetic Analyses

Nested PCR products for both ORF1 and ORF2 fragment amplification were purified using an AccuPrep PCR/Gel purification kit (Bionner Daejeon, Daejeon Metropolitan City, Republic of Korea) and sequenced in both directions utilizing a SeqStudio Genetic Analyzer (Thermofisher, Waltham, MA, USA) sequencer following Sanger technology at the Hospital El Cruce, Buenos Aires.

Two datasets were built: one for each region (ORF1 and ORF2). Each dataset included: (a) reference strains for each genotype and subtype of HEV-3 [4,5,21], (b) sequences obtained during this study, (c) the ten most related strains obtained through BLAST (Basic Local Alignment Search Tool) analysis on the NCBI website (https://blast.ncbi.nlm.nih.gov/), and (d) all previously obtained Argentine sequences (downloaded from GenBank).

Sequences were aligned utilizing MAFFT v7 [22], and phylogenetic trees were constructed using the maximum likelihood (ML) method with the software IQTREE v2.1 [23], employing the best-fit model of nucleotide substitution as selected by Model Finder [24]. The selected model for both regions was GTR + F + R4. The robustness of the phylogenetic grouping was evaluated by the SH-like approximate likelihood ratio test (SH-like)—1000 replicates [25]—and the ultrafast bootstrap (UFB) approximation—10,000 replicates [26]. The obtained sequences were deposited in GenBank under Accession Numbers PV606520-PV606526.

2.6. Comparison of Nucleotide and Amino-Acid Sequences

A comparison of the HEV nucleotide and amino acid sequences obtained from wild boars during this study and the most related sequence was carried out using the online Clustal Omega v1.2.4 multiple sequence alignment (MSA) tool (EMBL-EBI, 2024), available at https://www.ebi.ac.uk/jdispatcher/msa/clustalo (accessed on 27 December 2025).

2.7. Statistical Analyses

Detection frequencies and their 95% confidence intervals (CI) were calculated using the Clopper–Pearson exact method in R, version 4.5.2 (R Core Team, Vienna, Austria, 2025).

3. Results

The complete set of samples collected across the different sampling campaigns, together with the serological and molecular assays performed, is detailed in the Supplementary Table (Supplementary Table S1). Regarding the detection of anti-HEV antibodies using ELISA, 28 of the 66 analyzed samples were positive (42.4%, [95% CI: 30.3–55.2%]). Higher positivity rates were observed generally in the cold season or at the end of winter (Figure S1). On the other hand, 6 out of 66 stool samples (9.1%, [95% CI: 3.4–18.7%]) and 7 out 56 liver samples (12.5%, [95% CI: 5.2–24.1%]) were positive in RT-qPCR, with cycle threshold (Ct) values ranging from 23.3 and 40 (from a total of 45 cycles).

Among the 13 positive samples from RT-qPCR, 7 could be amplified by one of the nested PCRs: 6 for ORF1 and 1 for ORF2. In our investigation, the only sample from which the sequence of both ORFs could be obtained corresponded to the one with the lowest Ct in RT-qPCR (Ct = 26.6). The summary of all serological and molecular positive samples is shown in Table 2.

Phylogenetic analyses of the obtained sequences showed that all of them clustered with HEV-3, within the clade abchijklmno (Figure 2).

Molecular phylogeny shows that the ORF1 and ORF2 sequences of HEV recovered from wild boars are phylogenetically related to sequences recovered from humans, watercourses and domestic pigs in Argentina, grouping together in clades that are visibly separated from the rest of the sequences from other countries (Figure 2).

The ORF1 phylogenetic tree shows that the six sequences recovered from wild boars cluster together and form a distinct clade along with a single human-derived sequence from the Mendoza Province (Figure 2A). The alignment of these six nucleotide sequences revealed that the human-derived sequence harbored 16 mutations compared with wild boar-derived sequences, four of which were non-synonymous and resulted in four amino acid changes (Figure 3, red). These sequences grouped closely together, indicating a high degree of nucleotide similarity and suggesting the circulation of genetically related strains among wild boars.

Regarding ORF2, the wild boar sequence recovered clusters with a sequence recovered from humans from the Buenos Aires Province (Figure 2B). The nucleotide alignment shows 21 nucleotide changes, with only one non-synonymous mutation reflected only in one amino acid change (Figure 3, blue).

4. Discussion

Bahía de Samborombón is an extensive nature reserve located in the Buenos Aires Province, with a high population density of wild boars per square kilometer [14,15]. This area has significant interest in the country as it is a designated protected wetland, with several engineered water channels running through it. Its location is in proximity to major towns and cities, as well as several swine production facilities [27].

An HEV screening study in wild boar populations in our country was performed through opportunistic sampling in several provinces, which did not yield positive results either serologically or molecularly [28]. However, a more extensive study centered exclusively on the southern region of the Buenos Aires Province documented HEV-positive serology and RT-nested PCR results, yet lacked the capacity to sequence and characterize the circulating strain [13].

Our results showed a higher seropositivity value in wild boars from Bahía de Samborombón (42.4%) compared to the value obtained in the southern region of Buenos Aires (19.6%) previously reported [13], which could indicate a higher level of circulation and, consequently, a higher risk of transmission to people given its proximity to major urban centers given its proximity to major urban centers. We also found HEV-RNA in 9.1% and 12.5% of stool and liver samples, allowing us to perform genetic characterization and confirming the circulation of genotype 3 in wild boars in Argentina, positioning this species as an important reservoir in our country.

The discrepancy between serological and molecular positivity could be attributed to the fact that HEV viremia and fecal shedding are typically transient, often lasting only a few weeks after infection, although exceptions have been reported, while antibodies remain detectable for longer periods [29]. Consequently, RNA prevalence is consistently lower than seroprevalence studies. Moreover, differences among sample matrices may also contribute to this discrepancy.

The exclusion of some samples due to advanced decomposition represents a limitation of this study. This limitation is inherent to wildlife surveillance studies, where sample collection is dependent on hunting activities and environmental conditions that cannot always be controlled, and may have affected RNA integrity and HEV detection sensitivity.

HEV has also been detected in wild boars in our neighboring country, Uruguay [30], where, although RNA from serum was detected using qPCR, the ORF1 was not successfully amplified for phylogenetic analyses. This finding, together with the previous mentioned from Argentina, emphasizes the significance of utilizing qPCR for the preliminary detection of HEV (screening method), as this is a sensitive technique [18], followed by the nested PCR detection for sequencing studies and genetic characterization.

Swine has been pointed out as an important reservoir of HEV [31]. Consequently, numerous reports have documented HEV detection in domestic pigs across Argentina [32,33,34]. Di Cola [33] successfully obtained the sequences of ORF1 and ORF2, thereby classifying HEV strains as genotype 3, clade abchijklm. Marziali et al. [34] detected genotype 3, as did Acosta et al. Furthermore, Acosta [32] demonstrated domestic pig–human transmission.

Finally, HEV has also been detected in wastewater and river water in the northern and central provinces of Argentina, such as Salta, Córdoba, Santa Fe and Mendoza [35,36,37,38,39], thus evidencing viral circulation in the environment.

Wild boars are an invasive species in the environment that is rapidly expanding, with a great multiplicity of diseases that are of importance for human and animal health [14]. Migration patterns have demonstrated distances traveled of up to 300 km for juvenile female wild boars [40], and even genetic studies using microsatellites have exhibited the presence of all these markers in populations more than 200 km away [41]. Consequently, our research constitutes a novel HEV-positive wild boar population in Buenos Aires, the first to be genetically characterized as zoonotic genotype 3.

HEV was detected using both serological and molecular methods. Due to the lack of information on sex and age, no association between viral detection and these variables could be evaluated. Nevertheless, higher positivity rates were generally observed during colder seasons, particularly toward the end of winter. This seasonal pattern may be associated with reduced food availability, which could favor viral infection and/or environmental dissemination through fecal excretion.

The six Argentine ORF1 sequences recovered in this study clustered closely together, indicating a high degree of nucleotide similarity and suggesting the circulation of genetically related strains among wild boars. The high number of synonymous mutations in the HEV genome may be indicative of its broad host range, which involves replication across multiple host species and ecological contexts. This broad host range may favor nucleotide diversification while maintaining conserved protein sequences [42].

Taken together, these findings indicate that all the sequences recovered are phylogenetically closer to human-derived sequences from the same province of Buenos Aires or neighboring provinces, reinforcing the hypothesis of the regional circulation of closely related HEV strains and highlighting the potential zoonotic role of wild boars. In addition, a serological survey conducted in a population from the Buenos Aires Province near Bahía de Samborombón detected HEV antibodies in 4.64% of the 969 serum samples analyzed [43]. A higher seroprevalence was observed among individuals living or working in rural areas and those residing near watercourses, underscoring the role of environmental exposure in HEV transmission [43]. Even though HEV has been detected in deer in Uruguay [5], there are no studies reporting its presence in pampas deer in Argentina. Nevertheless, its populations have been declining and undergoing changes due to negative interactions with wild boars [44].

The nocturnal behavior of wild boars minimizes the probability of human–wild boar encounters [45]. However, their mobilization in search of food and their interaction with farms where food could be stored becomes more feasible. Consequently, given the documented presence of HEV-3 in domestic swine, it could be concluded that wild boars function as a disseminating species of HEV due to their potential for mobilization. Meanwhile, domestic swine would serve as a reservoir for human infection [46].

Consequently, the transmission of HEV to humans through wild boar would be more feasible due to the hunting of these animals and/or consumption of meat derived from them [47]. It is crucial to consider waste from infected domestic pigs, deceased wild boars, and/or feces as potential sources of environmental contamination, given the detection of viral presence in water [37]. It should be considered that Bahía de Samborombón is surrounded by engineered water channels that could act as potential routes for HEV dissemination in the environment, posing a risk for people living in or visiting this natural reserve, including tourists and hunters. Further investigations focused on these sources of water should be performed.

Under immune pressure exerted by three distinct potential hosts, relevant mutations arising across the HEV genome may contribute to more severe disease manifestations and to the emergence of potential antiviral resistance [48].

5. Conclusions

This study provides the first evidence of HEV genotype 3, clade abchijklmno circulating in wild boars from an epidemiologically relevant area of Argentina, emphasizing the importance of implementing effective management and control strategies for this invasive species to mitigate its spread and potential transmission to swine and humans.