Micromonas commoda N-Acetyl-L-Glutamate Kinase Reflects Specificity in the Control of Arginine Synthesis at the Base of the Green Line

TL;DR

The study explores how the enzyme NAGK in the algae Micromonas commoda functions without a regulatory protein called PII, which is unusual compared to other algae.

Contribution

The paper reveals that M. commoda NAGK is not regulated by PII proteins, a novel finding in the context of arginine biosynthesis control.

Findings

M. commoda NAGK is activated by N-acetyl-L-glutamate and inhibited by arginine but not by PII proteins.

M. commoda PII can relieve feedback inhibition of NAGK in Chlamydomonas reinhardtii.

The enzyme's low sensitivity to arginine may have compensated for the loss of PII regulation.

Abstract

N-Acetyl-L-glutamate kinase (NAGK) catalyzes the first committed step in arginine biosynthesis in organisms that perform the cyclic pathway of ornithine synthesis. In cyanobacteria and most Archaeplastida, the activity of NAGK is controlled by the PII signal transduction protein. During evolution, representatives of the class Mamiellophyceae, Ostreococcus and Bathycoccus lost the gene encoding PII, while Micromonas retained this gene. Here, we perform coupled enzyme and pull-down assays and show that M. commoda NAGK is activated by N-acetyl-L-glutamate and inhibited by arginine but is not controlled by PII proteins. This loss may have been compensated for by the enzyme’s low sensitivity to arginine. In contrast, M. commoda PII relieved Chlamydomonas reinhardtii NAGK from feedback inhibition by arginine. These observations suggest that M. commoda NAGK possesses a unique feature: it has lost the ability to interact with PII protein. The findings are discussed in the context of the relationship between NAGK control and the PII role in Mamiellophyceae.

Figures

Full text

1. Introduction

Arginine (Arg) belongs to a group of 20 amino acids involved in protein synthesis in all organisms. In addition to its structural role as an integral component of proteins, Arg performs several other important functions in plants [1,2,3,4,5,6,7,8,9]. It serves as a precursor for the formation and synthesis of a number of products such as urea, nitric oxide, proline, and polyamines [10,11,12,13,14,15,16]. Thus, Arg is of great importance in nitrogen (N) metabolism, and studying its biosynthesis is critical to understanding N homeostasis in plants.

Plants produce Arg from glutamate in eight steps [17,18,19,20], among which N-acetyl-L-glutamate kinase (NAGK) controls the second, usually the rate-determining step of Arg synthesis [21,22,23,24,25]. NAGK (E.C.2.7.2.8) catalyzes the phosphorylation of N-acetyl-L-glutamate to form N-acetyl-L-glutamyl-5-phosphate. In plants, some bacteria and yeast, NAGK activity is strictly regulated via feedback inhibition by the end product, Arg [26,27,28,29].

In photosynthetic organisms (cyanobacteria, green algae and higher plants), NAGK is a conserved target of the signal transduction protein PII. PII proteins are one of the largest and most ancient families of signaling regulators present across bacteria, archaea, and plants [30,31,32,33,34,35,36]. The binding of PII to NAGK leads to a significant relief from Arg inhibition [22,26,37,38,39]. Considering our data, in green algae and higher plants, unlike cyanobacteria, NAGK activity is additionally controlled by the glutamine (Gln) levels via Gln-dependent PII-NAGK complex formation, which leads to increased enzyme activity [23,40,41,42,43].

During evolution, members of the Asteraceae family, as well as some red and green algae, lost the genes encoding PII proteins [23,40,44]. Among the class Mamiellophyceae, two genera, Bathycoccus and Ostreococcus, lost the PII proteins [23]. But species of the genus Micromonas (Micromonas pusilla and Micromonas commoda) contain the PII proteins [45,46]. Representatives of the genus Micromonas are tiny (<2 mm in diameter) motile unicellular organisms with a single chloroplast and a single mitochondrion that thrive in tropical and polar ecosystems. M. pusilla and M. commoda, whose genomes have been sequenced, demonstrate an oligotrophy-adapted strategy for obtaining nutrients due to their size [47]. Like other green algae, the Micromonas chloroplasts perform important anabolic functions, including amino acid biosynthesis. Despite the fact that the mechanisms regulating arginine biosynthesis in Micromonas have not been studied, an intriguing difference has been found between the M. pusilla PII protein (MpPII) and other plant PII proteins, namely the unusually long T-loop in MpPII [45].

This feature resulted in the loss of interaction of MpPII with MpNAGK. However, there are no reports on the mechanism of interaction between PII and NAGK in a second PII-containing species, M. commoda. The latter fact has limited our knowledge of the biological significance of PII in Mamiellophyceae, which gave rise to the core of Chlorophyta [46] and comprise attractive model systems for exploring the regulation of N metabolism in early-diverging phytoplanktonic green algae.

This work was carried out to compare the regulation of NAGK in M. commoda and other plants. The unique features of McNAGK were revealed and discussed in the context of the specificity in the control of arginine synthesis at the base of the green line.

2. Results and Discussion

2.1. Characterization of M. commoda NAGK

The NAGK sequence encoded by the M. commoda MICPUN_87915 gene consists of 332 amino acids, with a molecular mass of 34,344 Da. At the N-terminal end, we identified a putative chloroplast transit peptide (amino acids 1–48), suggesting that the M. commoda NAGK (McNAGK) protein resides in chloroplast with a molecular mass of 29,868 Da.

To analyze the enzymatic properties of McNAGK, the recombinant protein with a His-tag at the N-terminus was overexpressed in E. coli and then subjected to affinity purification (Figure S1a). The mature recombinant McNAGK protein without the transit peptide sequence, His6-MsNAGK-tp, chromatographed as a 201.3 kDa protein during gel filtration implying that, like other NAGK proteins, McNAGK is a hexamer (Figure S2).

The catalytic activity of McNAGK was measured by coupling ATP consumption to the synthesis of a detectable product assay as described [26,36]. The calculated Km value of the purified recombinant McNAGK for NAG was 6.27 ± 1.56 mM (corresponding to a kcat of 30.37 ± 2.38 s^−1^) (Figure 1a, Table S1). This Km value is 7.2-fold higher than that of AtNAGK (0.87 ± 0.11 mM), and is an intermediate between that of Dunaliella salina NAGK (DsNAGK) (4.02 ± 0.70 mM) and Chlamydomonas reinhardtii NAGK (CrNAGK) (7.8 ± 0.8 mm) [36,40].

It is noteworthy that the kcat is very close to the value of the Chlorella variabilis NAGK (CvNAGK) (35.35 ± 1.04 s^−1^) [42].

2.2. Inhibition of McNAGK by Arginine and the Effect of PII Proteins

The McNAGK sequence exhibits a typical N-terminal signature pattern of arginine-sensitive NAGK enzymes and the allosteric site for Arg binding appears to be conserved.

As expected from sequence analysis (Figure 2), Arg impairs M. commoda NAGK activity (Figure 1b). The Arg sensitivity profile of free McNAGK (IC50, 1.94 mM) shows that higher concentrations of Arg are required for inhibiting McNAGK than CrNAGK (IC50, 0.11 mM), MiNAGK (IC50, 0.14 mM), DsNAGK (IC50, 0.29 mM), and AtNAGK (IC50, 1.2 mM) [6,12,15]. Thus, the M. commoda enzyme is less sensitive to Arg than all described NAGKs of cyanobacteria and Chloroplastida.

Since the relief from Arg inhibition by PII-NAGK complex formation is important for the metabolic regulation of the biosynthesis of this amino acid by photosynthetic organisms (cyanobacteria, red and green algae, and higher plants) [40,41,42,43], we were interested in the potential effect of McPII on the McNAGK inhibition profile of Arg.

The PII sequence encoded by the M. commoda MICPUN_61739 gene consists of 186 amino acids with a molecular mass of 20,102 Da and contains a predicted putative chloroplast transit peptide (amino acids 1–42). McPII demonstrated the highest degree of identity with M. pusilla PII (68.57%). However, as shown by the alignment of PII protein sequences from two Micromonas strains, McPII does not contain the extended T-loop observed in MpPII (Figure 3) [45]. At the same time, the alignment of McPII indicates extremely high local identities over two signature patterns that have been defined at the PROSITE (PS00496 and PS00638) across all canonical PII proteins of cyanobacteria and Archaeplastida [40]. Moreover, like the PII homologues of green algae and higher plants, the McPII protein has a Q loop that is responsible for Gln binding (Figure 3). Analysis of the McPII sequence also revealed the amino acid residues necessary for complex formation with NAGK [23,31].

To analyze how McNAGK interacts with PII, we prepared the recombinant McPII protein without N-terminal signal sequence (Figure S1b). Unexpectedly, both in the presence and absence of Gln (10 mM), McPII did not relieve McNAGK from Arg feedback inhibition (Figure 1b). Moreover, Chlamydomonas reinhardtii PII and Physcomitrella patens PII did not mediate activation of McNAGK (Figure 1c,d). In all cases, IC50 values did not differ significantly from those of free McNAGK (Table S1). In contrast, the McPII protein demonstrated attenuation of CrNAGK feedback inhibition by Arg (Figure 1e).

2.3. Analysis of the Interaction of McPII with NAGKs

The enzymatic assays (Figure 1) have shown that the interaction between McPII and McNAGK may be different from all described PII-NAGK complexes [23,40,41,42,43]. Therefore, we tested the possibility of McPII-McNAGK complex formation using the pull-down assays. The data revealed that McPII did not interact with McNAGK but formed a complex with CrNAGK (Figure 4a,b and Figure S3). Taken together, these data indicated that a lack of PII-mediated relief from Arg inhibition is an intrinsic property of McNAGK that can be demonstrated in heterologous assays with other PII proteins.

The McNAGK analysis (Figure 2) of NAGKs shows that the only significant variables in interaction with PII involve residues in McNAGK in which Glu151 is replaced by Asp and Ile253 is replaced by Val. However, to determine whether these substitutions alter the McNAGK conformation, binding affinity, and hence metabolic properties, further analysis of modified variants of this protein with replacement of Asp151 and Val253 with Glu and Ile, respectively, will be required.

In general, McNAGK exhibits the unique feature: it has lost the ability to interact with PII.

3. Conclusions

Overall, the control of Arg synthesis appears to be readily adaptable to the respective metabolic features of photosynthetic organisms due to the characteristics of PII proteins and PII-dependent regulation of NAGK activity [23,40,41,42,43]. An interesting question concerns the evolution of the PII role in Mamiellophyceae. As mentioned above, O. tauri, O. lucimarinus, and Bathycoccus prasinos lost the genes encoding PII proteins. In M. pusilla, a different scenario emerges: this alga has changed the properties of PII, and as a result, it has lost PII-dependent regulation of Arg formation. Although further investigation into the molecular mechanisms controlling Arg biosynthesis in other members of Mamiellophyceae is needed, this study supports the idea that various green algae in this class optimize NAGK activity independently of PII. However, unlike Asteraceae, Mamiellophyceae have developed various mechanisms to avoid dependence on the PII protein in Arg biosynthesis (Figure 5). In the future, it will be necessary to investigate whether the loss of PII-dependent control is compensated for by the low sensitivity of the enzyme to arginine in other representatives of the Mamiellophyceae. Collectively, our results deepen the existing understanding of NAGK control and the evolution of mechanisms regulating Arg synthesis in Archaeplastida.

4. Materials and Methods

4.1. Cloning Procedure of MsNAGK and MsPII

The sequences for McNAGK and McPII were obtained from UniProt database with sequence ID: for McNAGK this was (C1EFW2) and for McPII (C1FI34). Codon-optimized gene blocks encoding mature McNAGK and McPII for expression in E. coli were ordered from IDT, USA. McNAGK gene was flanked at the 5′ and 3′ ends by the sequences: AGGAGCGGCCTGGTGCCGCGCGGCAGC and TATGCTCGAGGATCCGGCTGCTAACAAGC, respectively. The McPII gene was flanked by BsaI restriction sites. The gene blocks were cloned directly into NdeI-digested pET15b vector (Novagen, Darmstadt, Germany) and BsaI-digested pASK-IBA3 vector (IBA, Munich, Germany), respectively, as described previously [36]. The generated plasmids were verified by sequencing.

4.2. Expression and Purification of Recombinant NAGK and PII Proteins

His-tagged CrNAGK and McNAGK were expressed in E. coli LEMO-21(DE3) and then the recombinant proteins were affinity purified on Ni-NTA columns as described [40]. C-terminal fused strep-tagged PII proteins (McPII, CrPII and PhyscoPII) were expressed in PII-deficient E. coli RB9060 and the proteins were affinity purified on a Strep-Tactin II column (Figure S1) [36,45].

4.3. Coupled NAGK Activity Assay

A total of 3 μg NAGK was added to the reaction mixture containing 50 mM imidazole pH 7.5, 50 mM KCl, 20 mM MgCl_2_, 0.4 mM NADH, 1 mM phosphoenolpyruvate, 5 mM ATP, 0.5 mM DTT, 11 U lactate dehydrogenase, 15 U pyruvate kinase and 50 mM NAG. The substrate concentrations used to calculate Km were 1, 3, 6, 10, 15, 25, 40, 50 mM. The oxidation of one NADH molecule is proportional to the phosphorylation of one NAG molecule; it was measured at 340 nm for 10 min with a SPECORD-spectrophotometer (model-210 PLUS, Analytik Jena GmbH+Co. KG., Jena, Thuringia, Germany). The conversion of 1 µmol of NAG min^−1^ by one unit of NAGK at 37 °C was calculated with the molar absorption coefficient of NADH of 6178 L mol^−1^ cm^−1^ at 340 nm. The enzymatic constants were calculated from the velocity slopes using the GRAPHPAD PRISM software program 8.4.3 (Graph-Pad Software, San Diego, CA, USA).

4.4. Pull-Down Assays

A buffer containing 100 mm Tris-HCl with a pH of 7.8, 150 mm NaCl, 5 mm MgCl_2_, 2 mm ATP, and 10 mm Gln was used for all reactions. Purified recombinant proteins were added for binding analysis: 40 µg McNAGK and 21.3 µg McPII or 40 µg CrNAGK and 20.3 µg McPII. After 1 h of incubation, Strep-Tactin II column was washed with the same buffer. Elution was performed with 100 µL 10 мM desthiobiotin. Eluted samples were analyzed by SDS-PAGE stained with Coomassie blue. As a loading control, a mixture of McPII and the corresponding NAGK was used.