Homoharringtonine and Gilteritinib Synergistically Induce Apoptosis and Suppress Viability in FLT3-ITD-Positive AML Cells

TL;DR

Combining Homoharringtonine and Gilteritinib improves treatment of AML with FLT3-ITD mutations by inducing cell death and reducing viability, especially in cells with functional p53.

Contribution

The study reveals a synergistic effect of HHT and gilteritinib in FLT3-ITD AML cells and identifies p53 status as a potential biomarker for treatment response.

Findings

HHT and gilteritinib synergistically induce apoptosis and suppress cell viability in FLT3-ITD AML cells.

The synergistic effect is diminished in cells with p53 mutations or lacking p53.

HHT upregulates p53 through HSPA8 downregulation, while gilteritinib downregulates p53.

Abstract

Background: The FLT3-ITD mutation is associated with a poor prognosis in acute myeloid leukemia (AML), particularly in relapsed or refractory (R/R) cases. Although Gilteritinib has been approved for the treatment of R/R AML with FLT3-ITD mutation, the emergence of resistance in clinical settings remains a major challenge. Homoharringtonine (HHT), a plant-derived alkaloid with antitumor properties, has also been used in AML treatment. However, the combination effects of HHT and gilteritinib have not been investigated. Methods: The cell viability and apoptosis of MV4-11 and MOLM-13 cells in the treatment of HHT, gilteritinib and the combination were assessed by CCK-8 assay and flow cytometry, respectively. Combination index (CI) values were calculated using CompuSyn 1.0. Western blotting was used to investigate the molecule mechanisms of HHT and gilteritinib mediated anti-leukemia effects in time- and dose-dependent experiments. To investigate the role of p53 status in drug responses, MV4-11-p53R248W and MV4-11-p53WT subclones were isolated and MV4-11-p53knockout cells was established through CRISPR/Cas9 system. The cell viability and apoptosis of MV4-11 cells with various p53 status were compared. Moreover, RNA-seq analysis was performed in MV4-11 cells treated with or without HHT. RT-qPCR and Western blotting were conducted to verify the mechanism underlying HHT-induced p53 upregulation. Results: HHT and gilteritinib exerted a significant synergistic effect on cell viability and apoptosis in MV4-11 and MOLM-13 cells, which was markedly diminished in the cells with the p53-R248W muta-tion or without p53. Mechanistically, HHT and gilteritinib both suppressed FLT3 signaling. Interestingly, HHT mediated the upregulation of p53 through HSPA8 downregulation, while gilteritinib downregulated the p53 level. The combination enhanced the p53 expression. Conclusions: Our findings elucidate the mechanism underlying this synergistic interaction and underscore the potential of p53 status as a predictive biomarker for identifying patients most likely to benefit from HHT and gilteritinib combination therapy.

Figures

Full text

1. Introduction

Acute myeloid leukemia (AML) is a heterogeneous hematologic malignancy characterized by the proliferation of myeloblasts or primitive granulocytes that fail to undergo normal differentiation [1]. It is the most common form of leukemia in adults and the second most prevalent type of acute leukemia in children [2,3]. The disease progresses rapidly, with a natural course lasting only a few weeks to a few months. In Europe, the 5-year survival rate for adult patients diagnosed between 2000 and 2007 was as low as 17% [4].

Internal tandem duplication of the FMS-like tyrosine kinase 3 gene (FLT3-ITD) occurs in approximately 30% of AML cases and is associated with a poor prognosis [5]. FLT3-ITD leads to constitutive activation and autophosphorylation of FLT3, which induces downstream phosphorylation of ERK, STAT5, and AKT, resulting in autonomous cell proliferation and contributing to AML pathogenesis [6,7]. Targeted inhibition of FLT3 kinase activity represents a key therapeutic strategy in AML, and numerous FLT3 inhibitors have been developed [8,9,10,11]. To date, the FDA has approved two small-molecule FLT3 inhibitors, midostaurin and gilteritinib, for the treatment of FLT3-mutated AML [12]. Midostaurin is a multi-targeted protein kinase inhibitor targeting c-KIT, PKC, PDGFR, VEGFR, and FLT3 (both ITD and TKD), which has been approved for the application in combination with induction and consolidation chemotherapy for newly diagnosed adult patients with FLT3-mutated AML [13,14]. Gilteritinib, a second-generation type I inhibitor targeting both FLT3 and AXL, is capable of overcoming AML cell resistance to the FLT3 inhibitors midostaurin and quizartinib [15]. In a randomized phase III trial, gilteritinib monotherapy contributed to longer survival and a higher remission rate compared to salvage chemotherapy in patients with relapsed or refractory FLT3-mutated (R/R) AML [16]. Therefore, gilteritinib was approved in November 2018 for the treatment of R/R FLT3-mutated AML, including both ITD and TKD subtypes [17]. However, mutation screening identified FLT3 mutations F691L, Y693C/N, and G697S as conferring moderate resistance to gilteritinib in vitro [18].

Homoharringtonine (HHT), a plant-derived alkaloid with antitumor properties, has been used in the treatment of AML and relapsed/refractory (R/R) AML in China [19,20,21]. A multicenter phase III trial found that the HAA regimen (homoharringtonine, cytarabine, and aclarubicin) could serve as an alternative induction therapy for untreated AML, particularly in patients with favorable or intermediate cytogenetics [22]. HHT has demonstrated synergistic effects when combined with FLT3 inhibitors such as sorafenib and quizartinib in the treatment of FLT3-ITD-positive AML [23,24,25]. Additionally, HHT could upregulate the wild-type p53 protein expression and induced cancer cell apoptosis [26,27,28].

Notably, the evolutionarily conserved p53 protein functions as a tumor suppressor [29,30]. Wild-type TP53 is present in 90–92% of adult AML patients, whereas TP53 mutations are associated with complex and monochromosomal karyotypes, specific chromosomal aneuploidies, and an extremely poor prognosis [22,31,32]. FLT3 inhibitors are closely linked to the p53 function [33]. For instance, quizartinib upregulated HDAC8 via FOXO, thereby inactivating p53 and promoting maintenance of FLT3-ITD-positive AML [34]. Another FLT3-inhibitor midostaurin inhibited the sirtuin 1 (SIRT1) protein expression and reactivated the p53 pathway, thus inducing the apoptosis of leukemic blasts [35]. Although various FLT3 inhibitors exert differing effects on p53 activity, upregulation of p53 consistently contributes to the inhibition of leukemic cell survival.

Although gilteritinib has been approved for the treatment of relapsed or refractory AML harboring FLT3-ITD mutations, the emergence of resistance in clinical settings remains a major challenge. Given the excellent efficacy of HHT, the present study tried to combined HHT and gilteritinib to investigate whether HHT can augment the anti-leukemic response of gilteritinib in FLT3-ITD-positive AML. Since previous studies had proved that there was a link between FLT3-ITD signaling and disturbed p53 activity, we also investigated whether the p53 signaling pathway mediated the anti-leukemic effects in this study.

2. Materials and Methods

2.1. Cell Lines and AML Patient Samples

Human AML cell lines carrying the FLT3-ITD mutation (MOLM-13 and MV4-11) were obtained from the Leibniz Institute DSMZ (Braunschweig, Germany) and ATCC (Manassas, VA, USA). The cells were maintained in RPMI-1640 and IMDM respectively (Hyclone, Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% fetal bovine serum (Hyclone, Thermo Fisher Scientific, Waltham, MA, USA), 100 U/mL penicillin, and 100 µg/mL streptomycin (Hyclone, Thermo Fisher Scientific, Waltham, MA, USA) at 37 °C in a humidified 5% CO_2_ incubator. The cell lines were verified by short tandem repeat analysis and tested for mycoplasma contamination. p53-mutant MV4-11 (MV4-11-p53^R248W^) cells were isolated from MV4-11 cells by subcloning in methylcellulose-based medium.

Primary AML cells were isolated from peripheral blood mononuclear cells (PBMCs) of a FLT3-ITD-positive AML patient using density-gradient centrifugation with Ficoll-Paque PLUS (GE Healthcare Life Sciences, Marlborough, MA, USA). Written informed consent was obtained from all patients under a protocol approved by the Institutional Review Board of the Seventh Affiliated Hospital, Sun Yat-sen University, in accordance with the Declaration of Helsinki.

2.2. Chemicals and Antibodies

Homoharringtonine (CGX-635) and gilteritinib (ASP2215) were purchased from Selleck Chemicals (Houston, TX, USA). Antibodies against FLT3 (#3462), p-FLT3 (Tyr589/591, #3464), p-STAT5 (Tyr694, #4322), STAT5 (#94205), AKT (#4691), p-AKT (Ser473, #4060), ERK (#4695), p-ERK (Thr202/Tyr204, #4370), p21 (#29477), HSPA8 (#8444), anti-rabbit IgG (#7074), anti-mouse IgG (#7076), and GAPDH (#8884) were obtained from Cell Signaling Technology (Danvers, MA, USA). Antibodies against p53 (#sc-126) and MDM2 (#sc-965) were purchased from Santa Cruz Biotechnology (Danvers, MA, USA).

2.3. Lentiviral Constructs

A lentivirus packaging system contained two helper plasmids (pSPAX2 and pMD2.G) and a shuttle plasmid LentiCRISPRv2 for TP53 gene knockout, which was purchased from Hanbio (Shanghai, China). The sgRNA sequences were as follows:

Sg 1: CGTCGAGCCCCCTCTGAGTC

Sg 2: AGCGTCGAGCCCCCTCTGAG

Another kind of lentivirus constructed with shRNA for HSPA8 gene knockdown was purchased from General Biol (Chuzhou, China). The target sequence was: GCAACTGTTGAAGATGAGAAA.

2.4. Growth Inhibition Assay and Apoptosis Analysis by Flow Cytometry

For the cell viability assay, 6 × 10^4^ cells per well were seeded in 96-well plates containing complete culture medium and incubated at 37 °C with 5% CO_2_ for 24 h. Cell viability was evaluated using the Cell Counting Kit-8 (CCK-8, Solarbio, Beijing, China) according to the manufacturer’s instructions. In parallel, cell viability was also assessed by trypan blue exclusion assay.

Flow cytometry was used for apoptosis detection as previously described [36,37]. Briefly, 0.75 × 10^6^ cells were seeded in each well of a 24-well plate and cultured for 18 h. Apoptotic cells were stained using the Annexin V-FITC Apoptosis Detection Kit (Dojindo, Cat# AD10-50, Kumamoto, Japan) following the manufacturer’s protocol. Flow cytometric analysis was performed on a CytoFLEX flow cytometer (Beckman Coulter, Indianapolis, IN, USA), and data were analyzed using FlowJo software v10.8.

2.5. Immunoblotting

Immunoblotting was performed as previously described [38,39,40]. Cells treated with various concentrations of HHT and/or gilteritinib were lysed using 1× SDS sample buffer, prepared from a 4× stock solution containing 12.5 mL of 1 M Tris-HCl (pH 6.8), 2 g SDS, 1 mL 2-mercaptoethanol, 20 mg bromophenol blue, 25 mL glycerol, 9 mL deionized water, and 1 mM EDTA. The lysates were clarified by centrifugation at 12,000× g in a microcentrifuge. Equal amounts of total protein were resolved by SDS-PAGE and subsequently analyzed by immunoblotting. The gray value of control group was normalized to 1.0, and the gray values of other groups were compared with the control group.

2.6. Real-Time Quantitative Polymerase Chain Reaction (qPCR)

Total RNA was extracted using the SteadyPure Universal RNA Extraction Kit (Accurate Biology, Changsha, China; #AG21017) and was immediately reverse-transcribed into cDNA using the Reverse Transcription Kit (#AG11706). Real-time qPCR was performed using the SYBR Green PCR Kit (#AG11701) on a CFX Manager system (Bio-Rad, Hercules, CA, USA). Relative gene expression levels were calculated using the 2^−ΔΔCt^ method, with GAPDH as the internal control. The primer sequences were as follows:

TP53 forward: GCCTGAGGTTGGCTCTGA

TP53 reverse: GTGGTGAGGCTCCCCTTT

GAPDH forward: AGGGCTGCTTTTAACTCTGGTAA

GAPDH reverse: TGGGTGGAATCATATTGGAACAT

HSPA5 forward: CATCACGCCGTCCTATGTCG

HSPA5 reverse: CGTCAAAGACCGTGTTCTCG

HSPA8 forward: ACCTACTCTTGTGTGGGTGTT

HSPA8 reverse: GACATAGCTTGGAGTGGTTCG

2.7. RNA-Sequencing (RNA-Seq) Analysis

MV4-11 cells were treated with 10 nM homoharringtonine (HHT) for 6 h, while untreated cells served as the control group. After treatment, cells were frozen in liquid nitrogen. RNA extraction, library construction, sequencing, and subsequent data analysis were performed by GENE DENOVO (Guangzhou, China). The raw and normalized gene expression data have been deposited in the Gene Expression Omnibus (GEO) database under the accession number PRJNA832421.

2.8. Statistical Analysis

Data visualization and statistical analyses were performed using GraphPad Prism 8 software (GraphPad Software, San Diego, CA, USA). Comparisons between two groups were conducted using either paired or unpaired Student’s t-tests, while multiple group comparisons were assessed using two-way analysis of variance (ANOVA) followed by appropriate post hoc tests. p value < 0.05 was considered statistically significant.

3. Results

3.1. HHT and Gilteritinib Exert Synergistic Anti-Leukemia Effects on FLT3-ITD-Positive AML Cells

To evaluate the potential synergistic effects of HHT and gilteritinib in FLT3-ITD-mutated AML, we treated the FLT3-ITD-positive AML cell lines MV4-11 and MOLM-13 with HHT and gilteritinib, either as single agents or in combination, for 24 h. It turned out that the combination of the two agents resulted in a significant reduction in cell viability in both cell lines. In MV4-11 cells, the combination index (CI) values ranged from 0.46 to 0.91, indicating the synergy of HHT and gilteritinib (e.g., 250 nM gilteritinib + 15.6 nM HHT, CI = 0.48; Figure 1A,B). Similarly, CI values ranged from 0.33 to 0.92 in MOLM-13 cells (250 nM gilteritinib + 15.6 nM HHT, CI = 0.34; Figure 1F,G).

Moreover, we investigated the effects of HHT, gilteritinib and their combination on cell apoptosis. Flow cytometry was used to access apoptotic changes. Compared to control, the HHT group and gilteritinib group both exhibited an increase in early apoptosis late apoptosis in MV4-11 (Figure 1E) and MOLM-13 cells (Figure 1J). Notably, the combination group demonstrated a more significant elevation in apoptotic cells (Figure 1E,J), with CI values ranging from 0.31 to 0.65 (e.g., 250 nM gilteritinib + 15.6 nM HHT, CI = 0.46; Figure 1C,D) in MV4-11 cells and CI values ranging from 0.15 to 0.25 (250 nM gilteritinib + 15.6 nM HHT, CI = 0.25; Figure 1H,I) in MOLM-13 cells.

Collectively, these results revealed that HHT and gilteritinib synergistically inhibited cell proliferation and induced apoptosis in FLT3-ITD-positive AML cells.

3.1.1. Cooperative Inhibition of FLT3 Signaling and Differential Regulation of p53 by HHT and Gilteritinib

To verify the molecule mechanisms of HHT- and gilteritinib-mediated anti-leukemia effects, we treated the cells with the two agents in time- and dose-dependent experiments. The Western blotting results showed that HHT and gilteritinib both decreased the protein expression level of FLT3, pFLT3, pSTAT5, pAKT, and pERK in MV4-11 (Figure 2A,B) and MOLM-13 cells (Figure 2C,D). Intriguingly, the expression level of p53 protein was significantly different after the treatment with the two agents. HHT led to the upregulation of p53 while gilteritinib led to the downregulation. Notably, the combination treatment restored and enhanced p53 expression. In both time- and dose-dependent conditions, HHT as well as the combination treatment promoted the expression of p21, a downstream target of p53 (Figure 2C,D). However, HHT appeared to have no significant effects on pSTAT5 expression (Figure 2C), and it did not affect pERK expression (Figure 2D).

To further validate these findings in a more physiologically relevant model, FLT3-ITD-potitive primary AML cells with wild-type p53 (PBMCs) were treated with HHT and gilteritinib. Consistent with the results in cell lines, HHT as well as the combination treatment increased p53 expression in primary cells (Figure 2E).

Taken together, these data suggest that both HHT and gilteritinib modulate the FLT3 signaling pathway, while HHT uniquely activates the p53 pathway. The combination therapy enhances inhibition of oncogenic signaling and restores tumor suppressor function, providing a mechanistic basis for their observed synergistic anti-leukemic effects.

3.1.2. Wild-Type p53 Is Critical for the Synergistic Effect

Prior to the experiments, Sanger sequencing was conducted to determine the mutation status of the FLT3 and TP53 genes. A minor subpopulation of MV4-11 cells was found to carry the p53-R248W mutation (Figure 3A). To investigate the role of TP53 status in drug response, we isolated MV4-11-p53^R248W^ and MV4-11-p53^WT^ subclones using a methylcellulose-based single-cell cloning method (Figure 3B,C).

In MV4-11-p53^R248W^ cells, HHT treatment still decreased the pFLT3 level; however, neither HHT nor gilteritinib—administered individually or in combination—altered the expression of the mutant p53 protein (Figure 3D). In cell viability assays, MV4-11-p53^R248W^ cells demonstrated increased resistance to both monotherapies and the combination treatment (Figure 3E). Apoptosis assays further confirmed that these mutant subclones were less sensitive to the drugs compared to their wild-type counterparts, particularly under HHT monotherapy, high-dose gilteritinib, and combination conditions (Figure 3F). To further confirm the key role of wild-type p53 in the responses to drugs, we deleted TP53 gene in the MV4-11 cells through CRISPR/Cas9 system (Figure 3G). Two sgRNA sequences were designed and integrated into the shuttle plasmid for lentivirus packaging, respectively, and one of them worked effectively for p53 knockout (MV4-11-p53^KO^-1). Then the viability between cells with p53^WT^ and cells without p53 was compared. It turned out that the diminished effect not only existed in the p53 mutant, but also in the TP53 knockout cells (Figure 3H).

3.1.3. HHT Mediated the Upregulation of p53 Through HSPA8 Downregulation

To investigate the pharmacodynamic mechanisms underlying HHT-induced p53 upregulation in MV4-11 cells, we conducted RNA-seq analysis. KEGG enrichment analysis revealed significant enrichment of the apoptosis signaling pathway following HHT treatment (Figure 4A). However, RT-qPCR results showed that the mRNA level of TP53 was not affected by HHT and gilteritinib treatment respectively (Figure 4B), suggesting that the regulation of p53 occurred at the post-transcriptional level.

Gene Ontology (GO) analysis of RNA-seq data further supported the involvement of protein interaction networks in this process. We initially hypothesized that HHT might reduce the expression of MDM2, a key negative regulator of p53, thereby stabilizing p53 protein. However, both MDM2 and p53 protein levels were found to be upregulated following HHT treatment (Figure 4C), implying a possible mechanism in which elevated p53 competes for MDM2 binding, reducing its ubiquitin-mediated degradation.

In addition, RNA-seq analysis revealed significant enrichment of heat shock protein (HSP)-related signaling pathways. Notably, the transcript levels of HSPA5 and HSPA8 were markedly reduced after HHT treatment (Figure 4E,F). Further validation in both MV4-11 and MOLM-13 cell lines confirmed that HSPA8 mRNA expression was consistently downregulated in a time-dependent manner following HHT exposure (Figure 4E,G).

These findings suggest that HHT may promote p53 protein accumulation not through enhanced transcription but via modulation of protein stability, potentially by downregulating HSPA8, a chaperone protein involved in p53 turnover and proteostasis. To confirmed this, we knock down HSPA8 in MV4-11 and MOLM-13 cell lines, and found that the HSPA8 knockdown indeed led to the upregulation of p53 protein, supporting the proposed mechanism that HHT downregulated HSPA8 and thus stabilized p53.

4. Discussion

One of the major therapeutic challenges in AML is its polyclonal and polygenic mutational landscape. Relapse is frequently driven by the persistence of the founding leukemic clone and its genetically distinct subclones, underscoring the clinical need for rational combination therapies that can target multiple oncogenic pathways simultaneously [36,37]. FLT3 mutations, including FLT3-ITD and FLT3-TKD point mutations, represent some of the most common and clinically relevant alterations in AML [41]. Notably, FLT3-TKD mutations often emerge as resistance mechanisms following treatment with FLT3 inhibitors such as sorafenib, quazatrinib and gilteritinib, further complicating disease management and reducing treatment durability [42].

In China, the plant-derived alkaloid homoharringtonine (HHT) has been utilized as a therapeutic agent for acute myeloid leukemia (AML), particularly in cases that are relapsed or refractory (R/R) [19,20,21]. Previous study indicated that HHT combined with sorafenib [25] or quazatrinib [23] cooperatively exhibited anti-leukemia effects. However, both sorafenib and quazatrinib are type II FLT3 inhibitor and specifically inhibit FLT3-ITD mutation. Neither sorafenib nor quazatrinib can inhibit FLT3-TKD mutation at therapeutic concentrations, which may result in the development of secondary resistance of the combined treatment regimen. Moreover, despite promising efficacy in clinical trials, sorafenib and quazatrinib have not been approved by the FDA so far [42]. In contrast, gilteritinib is an FDA-approved type I FLT3 inhibitor in R/R AML with activity against both FLT3-ITD and FLT3-TKD mutations as well as the receptor tyrosine kinase AXL. Compared to sorafenib and quizartinib, gilteritinib exhibited higher selectivity for the FLT3 kinase and a more favorable off-target profile. The suppression of AXL signaling may mitigate the development of secondary resistance [42]. Based on the above findings, we hypothesized that HHT and gilteritinib may represent a more potent and mutation-tolerant therapeutic strategy.

In this study, we systematically evaluated the anti-leukemic effects of combining HHT with gilteritinib in FLT3-ITD-positive AML models. Our results demonstrated that the combination therapy significantly reduced cell viability and promoted apoptosis in a synergistic manner. Mechanistic analyses revealed that both HHT and gilteritinib inhibited pFLT3 and downstream targets and the combination enhanced the inhibition. Moreover, HHT upregulated p53 protein expression, which was essential for the observed synergy, as subclones harboring the p53^R248W^ mutation or p53 knockout showed significant resistance to the drug treatment. Furthermore, transcriptomic analyses suggested that HHT might stabilize p53 at the post-transcriptional level by modulation of chaperone protein HSPA8, which was supported by the experiment result that knockdown of HSPA8 in FLT3-ITD-positive AML cells led to the upregulation of p53 protein. Intriguingly, gilteritinib reduced the p53 expression in both MV4-11 and MOLM-13 cell lines and the combination restored and increased p53 protein expression. Our previous study has proved that gilteritinib promoted the ubiquitination and degradation of p53 in AML cells with FLT3-ITD. This contributed to the downregulation of PUMA and other genes and thus inhibited cell apoptosis, which could result in drug resistance in FLT3-ITD-positive AML [33]. Therefore, the combination of HHT and gilteritinib has significant synergistic effects as HHT not only covered the signal of gilteritinib, but also reshaped the protein homeostasis network of cells at a more upstream and fundamental level, which may overcome secondary resistance caused by gilteritinib.

Previous studies have shown that EP300 promotes p53 acetylation [43], which stabilizes and activates p53 to drive apoptosis and suppress cell proliferation [44]. EP300 also interacts with SET1C and H3K4-methylated histones, thereby enhancing p53 transcriptional activity [45]. In addition, the transcription factor ATF2 has been shown to translocate from the nucleus to mitochondria, where it disrupts the HK1–VDAC1 complex, increases mitochondrial membrane permeability, and triggers apoptosis in a p53-dependent manner [46,47]. Moreover, fibroblast growth factor receptor (FGFR) signaling has been implicated in promoting p53 degradation via the formation of a complex with RACK1 and MDM2; inhibition of FGFR reverses this effect and induces p53-mediated apoptosis [48,49]. These studies provide valuable insights for future exploration into the molecular mechanisms by which HHT regulates p53 protein stability and activity.

In summary, this study elucidates the synergistic anti-leukemic activity of HHT combined with gilteritinib in FLT3-ITD-positive AML cells harboring wild-type p53. However, there are still some limitations in our study. Firstly, our study was primarily involved with preclinical experiments, limited to cell lines and a small number of patient samples. Additional validation in vivo such as the application of xenograft or PDX models would provide a considerable amount of convincing evidence supporting our viewpoint. Secondly, the study focused on FLT3-ITD-positive AML, and while AML with other FLT3 mutations, especially TKD mutations, may show different responses to HHT and gilteritinib combination. Moreover, the safety of the combination of HHT and gilteritinib requires further evaluation despite their potential synergistic effects.