gga-let-7c-3p Inhibits Chicken Abdominal Adipogenesis by Regulating PPARD Gene

TL;DR

This study shows that the miRNA gga-let-7c-3p reduces fat formation in chickens by targeting the PPARD gene, offering insights for lean broiler breeding.

Contribution

The study identifies gga-let-7c-3p as a novel regulator of chicken abdominal adipogenesis through its interaction with the PPARD gene.

Findings

gga-let-7c-3p inhibits preadipocyte viability, proliferation, and lipid accumulation in chickens.

gga-let-7c-3p directly targets the 3′UTR of the PPARD gene, suppressing its expression.

PPARD gene knockdown mimics the effects of gga-let-7c-3p on lipid metabolism and cell proliferation.

Abstract

MicroRNAs (miRNAs) have been increasingly involved in mammalian lipid metabolism. However, their regulatory roles and molecular mechanisms in abdominal fat deposition in chicken remain largely unexplored. In this study, based on the previous miRNA transcriptome data during chicken abdominal preadipocytes’ adipogenic differentiation, we explored the biological functions and regulatory mechanisms of a differentially expressed miRNA, gga-let-7c-3p, in adipogenesis. Gain- and loss-of-function assays elucidated that gga-let-7c-3p significantly decreased viability, proliferation, cell cycle progression, intracellular lipid droplet accumulation and triglyceride content, as well as the mRNA expression of proliferation- and lipid metabolism-related genes in chicken abdominal preadipocytes. Dual-luciferase reporter assay confirmed that gga-let-7c-3p could directly interact with the 3′UTR of the transcription factor—peroxisome proliferator activated the receptor delta (PPARD) gene and thus inhibited its post-transcriptional expression. The PPARD gene significantly decreased viability, proliferation, and cell cycle progression, while it increased intracellular lipid droplet accumulation and triglyceride content of chicken abdominal preadipocytes, paralleling with the mRNA expression of proliferation- and lipid metabolism-related genes. Collectively, gga-let-7c-3p could inhibit the proliferation and adipogenic differentiation of chicken abdominal preadipocytes, at least by targeting the PPARD gene. These findings reveal the regulatory mechanisms of the gga-let-7c-3p/PPARD axis in chicken abdominal adipogenesis, and could provide potential molecular markers for lean line broiler breeding.

Figures

Full text

1. Introduction

Chickens (Gallus gallus) are a pivotal agriculture animal and directly related to the economic benefits because of their meat yield and egg production. Although intensive selection on chicken growth rate and body weight has remarkably improved their growth performance, it was accompanied by excessive deposition of abdominal fat (AF), which is a waste of carcass processing in the poultry industry. Excessive AF deposition not only reduces feed conversion efficiency and meat quality, but also increases production costs and may lead to metabolic diseases such as fatty liver, thus hindering profitable farming [1,2]. Lean line broiler (low AF deposition) breeding has been a long-term challenge for global poultry breeders. Considering the high heritability of AF weight and AF percentage in chickens, a genetic approach maybe the most effective manner for reduced AF deposition [3]. Therefore, identifying the crucial regulatory factors and studying the molecular regulatory mechanism of AF deposition are of great significance to molecular breeding of lean line broilers [4].

AF expands by increasing the number of abdominal preadipocytes (proliferation) and their maturation into adipocytes with lipid droplet accumulation (adipogenic differentiation) [5]. Preadipocyte proliferation occurs primarily during embryonic and early postnatal development, while adipogenic differentiation dominates at later stages of growth and development. Both proliferation and adipogenic differentiation processes are orchestrated by the sequential regulation of non-coding RNAs (ncRNAs), transcriptional regulators and adipogenesis-related genes [6,7,8]. MicroRNAs (miRNAs) are 22 nt endogenous ncRNAs with high conservation among species and can inhibit post-transcriptional expression by triggering mRNA degradation and translation inhibition through their seed region sequences (2–8 nucleotides), complete or incomplete complementarity to the 3’untranslated regions (UTRs) of the target gene, thus participating in multiple cellular processes such as proliferation, differentiation, apoptosis [5,9,10]. Increasing evidence has supported the strong involvement of miRNAs in chicken AF deposition by mediating the proliferation and adipogenic differentiation of chicken abdominal preadipocytes by post-transcriptionally regulating target gene expression, including miR-106-5p/KLF15 axis [11], miR-122-5p/FABP5 [12], miR-125b-5p/ACSBG2 [13], miR-429-3p/LPINI [14], miR-17-92/MAP3K2 [15], miR-301b-3p/ACSL1 [16], miR-24-3p/FNIP2 [17], miRNA-206/KLF4 [18], miR-200b-3p/SESN1 [19], and miR-20b-3p/TMEM38B [20].

The let-7 gene was first identified in the screening of developmental defects in Caenorhabditis elegans [21], and later discovered to encode a miRNA that promoted the differentiation of cellular fates [22]. Increasing evidence has shown that let-7 could affect the mammalian lipid metabolism by targeting adipogenesis-related genes. For example, in mouse macrophages treated with oxidized low-density lipoprotein, let-7c knockdown inhibited lipid accumulation but did not affect cholesterol uptake, and let-7c overexpression promoted lipid accumulation by downregulating the mRNA and protein expression of PGC-1α gene to activate LXRα/ABCA1/G1 axis [23]. Let-7c-3p could significantly reduce lipid accumulation of mouse foamy macrophages by regulating PPAR/RXR [24]. Let-7c could inhibit bovine preadipocytes proliferation and promote their adipogenic differentiation by targeting the PPARGC1B gene [25]. Additionally, let-7c-3p could promote the directed differentiation of human chronic myeloid leukemia cells into monocytes or macrophages by targeting Egr-1 gene [26]. Let-7a-5p could inhibit the proliferation and adipogenic differentiation of rabbit preadipocytes by targeting the Srebf2 and Thbs1 genes [27]. In chicken, the RNA-seq data of breast muscle tissues with high- and low-body weight identified the let-7 family as the dominant miRNAs involved in breast muscle development, including multiple members such as gga-let-7a, -7c, -7f, -7j, -7k, etc., particularly gga-let-7c showing high expression abundance [28]. However, little was known about its regulatory roles in fat deposition, especially in chickens. The previously constructed miRNA expression profiles by RNA-seq for chicken abdominal preadipocytes at different differentiated stages demonstrated that gga-let-7c-3p was differentially expressed and exhibited a significantly decreased expression during chicken abdominal preadipocytes’ adipogenic differentiation, suggesting its potential involvement in chicken AF deposition.

In this study, we investigated the biological functions and regulatory mechanisms of gga-let-7c-3p underlying chicken AF deposition and found that gga-let-7c-3p could inhibit chicken abdominal preadipocytes’ proliferation and adipogenic differentiation by downregulating the post-transcriptional expression of its target peroxisome proliferator activated receptor delta (PPARD) gene, which encodes a transcription factor that subsequently affected the expression of PPARD-responsive genes involved in proliferation and adipogenic differentiation. These findings enhance our understanding of the molecular mechanisms governing AF deposition in poultry, and provide potential genetic markers for lean line broiler breeding.

2. Materials and Methods

2.1. Cell Culture

Immortalized chicken preadipocytes 2 (ICP2) cells were established and provided by the Key Laboratory of Chicken Genetics and Breeding, Ministry of Agriculture (Northeast Agricultural University, Harbin, China) [29]. The chicken embryonic fibroblast (DF1) cell line was purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA). ICP2 cells and DF1 cells were cultured in complete medium comprising in DMEM-F12 basic medium (Gibco, Gaithersburg, MD, USA) with a supplement of 10% fetal bovine serum (Gibco, Gaithersburg, MD, USA) and 2% penicillin streptomycin bispecific (Gibco, Gaithersburg, MD, USA). When they reached 80–90% confluence, ICP2 cells were maintained with differentiation medium containing complete medium with a supplement of 160 μM oleic acid (Solarbio, Beijing, China) dissolved in dimethyl sulfoxide (Solarbio, Beijing, China) to induce adipogenic differentiation.

2.2. RNA Isolation, Reverse Transcription, and Real-Time Quantitative PCR (qPCR)

Total RNA from cells was isolated using TRIzol reagent (Vazyme Biotech, Nanjing, China). Reverse transcription for cDNA synthesis was conducted using the HiScript IIl RT SuperMix for qPCR (+gDNA wiper) (Vazyme Biotech, Nanjing, China). The SYBR Green-based qPCR was performed on the Roche LightCycler 96 system (Roche, Basel, Switzerland) using a 10 μL reaction mixture, including 0.4 μL of forward and reverse primers each (10 μM), 1 μL of cDNA (approximately 100 ng), 3.2 μL RNase-free water, and 5 μL 2 × ChamQ SYBR qPCR Master Mix (Vazyme Biotech, Nanjing, China). β-actin and U6 were used as internal reference genes to normalize the relative mRNA and miRNA expression, respectively. All experiments were conducted in triplicate. The qPCR primers were designed using Primer Premier 5.0 software and synthesized by Qingke Biotechnology Co., Ltd. (Beijing, China). The qPCR primers were listed in Supplementary Table S1. The 2^−ΔΔCt^ method was used for calculating the relative miRNA/mRNA expression.

2.3. Recombinant Plasmid Construction and Cell Transfection

To construct the overexpression plasmid of PPARD gene, its coding sequence (CDS) was cloned into the HindIII and EcoRI restriction enzymes (Takara, Kyoto, Japan) double-digested pcDNA3.1 (+) vector (Invitrogen, Carlsbad, CA, USA), termed as pcDNA3.1-PPARD. Short interfering RNAs specifically targeting the PPARD gene (si-PPARD, 5′ CCGCATGAAGCTGGAATAT 3′) and negative control (si-NC) were synthesized by Ribo Biotechnology (Ribobio, Guangzhou, China). gga-let-7c-3p mimics (sense: CUGUACAACCUUCUAGCUUUCC, anti-sense: GGAAAGCTAGAAGGTTGTACAG) and the mimics NC (sense: UUCUCCGAACGUGUCACGUTT, anti-sense: ACGUGACACGUUCGGAGAATT) were synthesized by GenePharma Co., Ltd. (Shanghai, China). The gga-let-7c-3p inhibitor (sense: GGAAAGCUAGAAGGUUGUACAG) and the inhibitor NC (sense: CAGUACUUUUGUGUAGUACAA) were synthesized by GenePharma Co., Ltd. (Shanghai, China).

To validate the direct target of gga-let-7c-3p to the PPARD gene, its 3′UTR with or without the gga-let-7c-3p binding site were cloned into psi-CHECK™-2 plasmid (Promega, Madison, WI, USA) with XhoI and NotI restriction enzymes (Takara, Kyoto, Japan) double digestion, respectively, named as wild-type plasmid (PPARD-3′UTR-WT) and mutant plasmid (PPARD-3′UTR-MuT).

All cell transfection experiments were conducted using Lipofectamine 3000 reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s protocol.

2.4. Determination of Intracellular Triglyceride (TG) Content

ICP2 cells (3 × 10^4^ cells/well) with six replicates in each group (n = 6) were cultured in 12-well plates and maintained in differentiation medium. At 48 h post-transfection, after washing thrice with 1× phosphate-buffered saline (PBS) (Solarbio, Beijing, China). Intracellular TG levels of the differentiated ICP2 cells were measured using a Cellular Triglyceride Content Assay Kit (Applygen, Beijing, China). Intracellular protein content was determined using the BCA protein detection kit (Epizyme, Shanghai, China) to standardized intracellular TG content.

2.5. Oil Red O Staining

ICP2 cells (3 × 10^5^ cells/well) with three replicates in each group (n = 3) were cultured in 6-well plates and maintained in differentiation medium. At 48 h post-transfection, the differentiated ICP2 cells were washed thrice with 1 × PBS (Solarbio), fixed using 4% paraformaldehyde (Solarbio, Beijing, China), and subsequently stained with 40% Oil Red O solution (Sigma, Beijing, China). Images were then acquired by an inverted fluorescence microscope (Olympus, Tokyo, Japan). Quantification of intracellular lipid droplets was performed by eluting the stained Oil Red O stain with 100% isopropanol (Sigma, Beijing, China) and measuring the absorbance at 500 nm using a microplate reader (BioTek, Winooski, VT, USA).

2.6. CCK-8 Assay

ICP2 cells (1 × 10^3^ cells/well) with twelve replicates in each group (n = 12) were cultured in 96-well plates and maintained in complete medium. Cell vitality was evaluated at 12, 24, 36 and 48 h post-transfection using a CCK-8 Cell Counting Kit (Dojindo, Kumamoto, Japan). Following the addition of 10 μL CCK-8 reagent (Dojindo, Kumamoto, Japan) in each well, the plates were incubated for 2 h under dark conditions, and then the absorbance was measured at 450 nm using a microplate reader (BioTek, Winooski, VT, USA).

2.7. 5-Ethynyl-2-deoxyuridine (EdU) Assay

ICP2 cells were seeded into 12-well plates at a density of 3 × 10^4^ cells per well, with three technical replicates in each group (n = 3), and subsequently maintained in complete medium. At 24 h post-transfection, the cells were pulse-labeled with EdU reagent (Ribobio Guangzhou, China; 1:1000 dilution in complete medium) for 2 h under the standard culture conditions (37 °C, 5% CO_2_). EdU-positive cells exhibited red fluorescence, while cell nuclei were counterstained blue with Hoechst 33342 (Ribobio, Guangzhou, China). Fluorescence microscopy images were acquired using an inverted fluorescent microscope (Olympus, Tokyo, Japan).

2.8. Flow Cytometry Analysis

Cells (3 × 10^4^ cells/well) with six replicates in each group (n = 6) were cultured in 12-well plates and maintained in complete medium. At 24 h post-transfection, cells were harvested, washed thrice with prechilled 1× PBS (Solarbio), and fixed in 75% ethanol. Cell cycle was analyzed by a BD AccuriC6 flow cytometer (BD Biosciences, San Diego, CA, USA) using a Cell Cycle Detection Kit (KeyGEN Biotech, Nanjing, China).

2.9. Dual-Luciferase Reporter Assay

To verify the binding of gga-let-7c-3p to the PPARD gene, DF1 cells with 6 replicates in each group (n = 6) were plated into 24-well plates. DF1 cells were co-transfected with 300 ng of PPARD-3′UTR-WT or PPARD-3′UTR-MuT and 50 nM gga-let-7c-3p mimics or mimics NC. At 48 h post-transfection, cells were washed thrice with 1× PBS (Solarbio) and lysed in passive lysis buffer (Promega, Madison, WI, USA). Firefly and Renilla luciferase activities were measured on a microplate reader (BioTek, Winooski, VT, USA) using the Dual-Luciferase^®^ Reporter Assay System (Promega, Madison, WI, USA). Renilla luciferase activity was normalized to firefly luciferase activity.

2.10. Bioinformatics Analysis

The target genes of gga-let-7c-3p were predicted using miRDB [30]. The minimum free energy (MFE) of gga-let-7c-3p and the PPARD gene duplex was calculated using RNAhybrid [31]. The vertebrate PPARD motif matrix was downloaded from JASPAR software (2026) [32]. The 2000 bp promoter sequences upstream from the transcription start site of genes were used for PPARD motif screening by FIMO software (MEME Suite 4.11.4) [33].

2.11. Statistical Analysis

Data are presented as mean ± S.E.M. The statistical significance of differences between two groups was determined using Student’s t-test by SPSS software 23.0 (IBM, Chicago, IL, USA). The statistical significance of differences among three or more groups was determined using the one-way ANOVA combined with Duncan’s Multiple Range Test by SPSS software 23.0 (IBM, Chicago, IL, USA). * p < 0.05 means a significant difference and ** p < 0.01 means an extremely significant difference. All graphical representations were generated by GraphPad Prism 8.0 (GraphPad Software, San Diego, CA, USA).

3. Results

3.1. gga-let-7c-3p Inhibits Chicken Abdominal Preadipocytes Proliferation

To investigate the functions of gga-let-7c-3p in chicken abdominal preadipocytes proliferation, gga-let-7c-3p was overexpressed and knocked down in ICP2 cells by transfection with gga-let-7c-3p mimics and gga-let-7c-3p inhibitor, respectively. Compared to the mimics NC group, gga-let-7c-3p expression displayed an about 95-fold increase in gga-let-7c-3p mimics-treated ICP2 cells (Figure 1A). As determined by qPCR, overexpression of gga-let-7c-3p significantly decreased the mRNA expression of cell proliferation-promotion marker genes, including CCND1 [34], PCNA [34], CCNB2 [35] and CDK2 [34] genes, but significantly increased that of CCNE1 [36] gene (Figure 1B). Flow cytometry analysis clarified that overexpression of gga-let-7c-3p led to a remarkable increase in the population of G0/G1 phase cells and a marked decrease in the population of S phase cells, indicating an inhibition of cell cycle progression from G0/G1 phase to S phase (Figure 1C,D). CCK-8 assay demonstrated that overexpression of gga-let-7c-3p significantly inhibited cell viability at 36 and 48 h post-transfection (Figure 1E). Notably, EdU assay revealed that overexpression of gga-let-7c-3p significantly reduced the EdU-positive cell proportion (Figure 1F,G).

Compared to the inhibitor NC group, gga-let-7c-3p expression displayed an approximately 46% decrease in gga-let-7c-3p inhibitor-treated ICP2 cells (Figure 1H). The qPCR analysis showed that knockdown of gga-let-7c-3p significantly upregulated the mRNA expression of cell proliferation-promotion marker genes including PCNA [34], CCNB2 [35] and CCNE1 [36] (Figure 1I). Flow cytometry analysis indicated that knockdown of gga-let-7c-3p led to an upward trend but not significant promotion of cell cycle progression from G0/G1 phase to S phase, leading to an inapparent decrease in the population of G0/G1 phase cells and an inapparent increase in the population of S phase cells (Figure 1J,K). CCK-8 assay demonstrated that knockdown of gga-let-7c-3p significantly enhanced cell viability at 36 h and 48 h after transfection (Figure 1L). EdU assay revealed that knockdown of gga-let-7c-3p significantly increased the EdU-positive cell proportion (Figure 1M,N). These results suggest that gga-let-7c-3p hinders chicken abdominal preadipocytes’ proliferation.

3.2. gga-let-7c-3p Inhibits Adipogenic Differentiation of Chicken Abdominal Preadipocytes

To investigate the functions of gga-let-7c-3p in adipogenic differentiation of chicken abdominal preadipocytes, ICP2 cells were transfected with gga-let-7c-3p mimics and gga-let-7c-3p inhibitor for gga-let-7c-3p overexpression and knockdown, respectively, and subsequently induced adipogenic differentiation for 48 h. Compared to the mimics NC group, overexpression of gga-let-7c-3p significantly downregulated the mRNA expression of the lipid metabolism-related PPARγ [37], LPL [37] and FABP4 [37] genes (Figure 2A). Furthermore, intracellular TG content and lipid droplet accumulation were markedly decreased upon gga-let-7c-3p overexpression (Figure 2B–D). Additionally, knockdown of gga-let-7c-3p led to a significantly upregulation of the mRNA expression of the lipid metabolism-related PPARγ [37], ACSL5 [38] and APOA4 [39] genes as well as a remarkable intracellular TG content and lipid droplet accumulation (Figure 2F–H). Taken together, these findings suggest that gga-let-7c-3p suppresses chicken abdominal preadipocytes’ adipogenic differentiation.

3.3. Screening of Candidate Target Genes for gga-let-7c-3p

To identify the potential targets of gga-let-7c-3p, we firstly employed miRDB software [30] to predict its target genes and found the 3′UTR of 1145 target genes may directly interact with the seed region of gga-let-7c-3p. The 25 predicted target genes were differentially expressed and showed significantly highly negative expression correlations (r < −0.6, p < 0.05) with gga-let-7c-3p based on the previously reported RNA-seq data of chicken abdominal preadipocytes at 0, 12, 48, 72, and 120 h post-adipogenic differentiation [11] (Figure 3A, Supplementary Table S2). Of these, PPARD mRNA expression showed an overall increased expression during the ICP2 cells’ adipogenic differentiation, opposite to gga-let-7c-3p that exhibited a gradually decreased expression (Figure 3B,C). Notably, there was a significantly highly negative correlation (r = −0.6695 and p = 0.0063) between PPARD and gga-let-7c-3p expression (Figure 3D). The mRNA expression of the PPARD gene was significantly downregulated in the gga-let-7c-3p overexpressed ICP2 cells and significantly upregulated in the gga-let-7c-3p knockdown ICP2 cells (Figure 3E,F). Accordingly, we selected the PPARD gene for gga-let-7c-3p target validation.

3.4. PPARD Gene Is a Direct Target of gga-let-7c-3p

The MFE of the gga-let-7c-3p–PPARD duplex was −19.7 kcal/mol, suggesting strong hybridization stability of gga-let-7c-3p and the 3′UTR of the PPARD gene (Figure 4A). To further validate the binding of gga-let-7c-3p to the PPARD gene, we successfully constructed the wild-type (PPARD-WT-3′UTR) and mutant (PPARD-MuT-3′UTR) plasmids with and without complementary binding site (the 173–146 nt region of the PPARD 3′UTR and the 2–8 nt seed region of gga-let-7c-3p), respectively (Figure 4B,C). A dual-luciferase reporter assay elucidated that gga-let-7c-3p significantly inhibited the relative luciferase activity of PPARD-3′UTR-WT (the wild-type plasmid), but had no significant effect on that of PPARD-3′UTR-MuT (the mutant plasmid) (Figure 4D). These findings demonstrate that the PPARD gene is a direct target of gga-let-7c-3p.

3.5. PPARD Inhibits Chicken Abdominal Preadipocytes Proliferation

To explore the regulatory effect of PPARD gene in chicken abdominal preadipocytes’ proliferation, the PPARD gene was overexpressed and knocked down in ICP2 cells by transfection with the pcDNA3.1-PPARD overexpression vector and si-PPARD for PPARD gene overexpression and knockdown, respectively. Compared to the pcDNA3.1 NC group, the PPARD gene expression level displayed an approximately 3-fold increase in ICP2 cells transfected with the pcDNA3.1-PPARD overexpression vector (Figure 5A). As determined by qPCR, overexpression of the PPARD gene significantly downregulated the mRNA expression of cell proliferation-promotion marker genes PCNA [34], CCNB2 [35], CDK2 [34] and CCND3 [40] (Figure 5B). Among these cell proliferation-promotion marker genes, the 2000 bp promoter sequences upstream transcriptional start site of CDK2 [34], CCND3 [40] and PCNA [34] genes possess the putative PPARD motif (Supplementary Table S3). Flow cytometry analysis further showed that overexpression of PPARD gene inhibited cell cycle progression from G0/G1 phase to S phase, resulting in a remarkable increase in the population of G0/G1 phase cells and a remarkable decrease in the population of S phase cells (Figure 5C,D). CCK-8 assay showed that overexpression of PPARD gene significantly reduced cell viability at 24 h, 36 h and 48 h post-transfection (Figure 5E). Additionally, the EdU assay revealed that overexpression of PPARD gene significantly suppressed the EdU-positive cell proportion (Figure 5F,G).

Additionally, qPCR analysis displayed that the mRNA expression level of the PPARD gene was significantly decreased by about 55% in si-PPARD transfected ICP2 cells compared to the si-NC group (Figure 5H). Knockdown of the PPARD gene significantly upregulated the expressions of the CCND1 [34] and PCNA [34] genes (Figure 5I). Accordingly, knockdown of the PPARD gene promoted cell cycle progression from G0/G1 phase to S phase, characterized by a substantial decrease in the G0/G1 phase and increase in the S phase ICP2 cells (Figure 5J,K). CCK-8 assay showed that knockdown of the PPARD gene significantly enhanced cell viability at 36 h and 48 h post-transfection (Figure 5L). Moreover, EdU assay revealed that knockdown of the PPARD gene significantly increased the EdU-positive cell proliferation proportion (Figure 5M,N). Consequently, these results suggest that the PPARD gene suppresses chicken abdominal preadipocytes’ proliferation.

3.6. PPARD Promotes Adipogenic Differentiation of Chicken Abdominal Preadipocytes

To explore the functions of the PPARD gene in adipogenic differentiation of chicken abdominal preadipocytes, ICP2 cells were transfected with the pcDNA3.1-PPARD overexpression vector and si-PPARD for PPARD gene overexpression and knockdown, respectively, and then induced to undergo adipogenic differentiation for 48 h. Compared to the pcDNA3.1 negative control, overexpression of the PPARD gene significantly upregulated the mRNA expression levels of the lipid metabolism-related PPARγ [37], LPL [37], ACSL5 [38], ELOVL1 [37], DGAT2 [41] and APOA4 [39] genes (Figure 6A). Among these adipogenic differentiation-related genes, the 2000 bp promoter sequences upstream transcriptional start site of ACSL5 [38], ELOVL1 [37], DGAT2 [41] and APOA4 [39] genes possess the putative PPARD motif (Supplementary Table S3). Additionally, intracellular TG content and lipid droplet accumulation were markedly increased upon PPARD overexpression (Figure 6B–D). Knockdown of the PPARD gene significantly downregulated the mRNA expression of the lipid metabolism-related PPARγ [37], LPL [37] and APOA4 [39] genes (Figure 6E). The intracellular TG content and lipid droplet accumulation were also significantly decreased upon PPARD gene knockdown (Figure 6F–H). Collectively, these findings suggest that the PPARD gene promotes the adipogenic differentiation of chicken abdominal preadipocytes.

4. Discussion

As an important regulator of post-transcriptional gene expression, miRNAs have increasingly been proved to play prominent roles in mammalian adipogenesis. However, their biological functions and regulatory mechanisms underlying AF deposition in chickens have been largely unexplored. The previous miRNA and mRNA expression profiles during the adipogenic differentiation of chicken abdominal preadipocytes have revealed a series of differentially expressed miRNAs/mRNAs and the miRNAs-mRNA regulatory network involving adipogenesis, suggesting the crucial roles of miRNA regulation in chicken AF deposition [11]. Based on these findings, we selected a differentially expressed miRNA, gga-let-7c-3p, and confirmed that gga-let-7c-3p could inhibit the proliferation and adipogenic differentiation of chicken abdominal preadipocytes and verified the regulatory mechanisms of gga-let-7c-3p suppressing the post-transcriptional expression of the PPARD gene by directly interacting with its 3′UTR, which encodes a transcription factor with an inhibition of chicken abdominal preadipocytes proliferation and a promotion of their adipogenic differentiation. Our findings not only enrich the molecular regulation of avian adipogenesis, but also provide the potential genetic biomarkers of gga-let-7c-3p/PPARD axis for the genetic improvement of excessive AF deposition in poultry.

The miRNA let-7c-3p belongs to the let-7 family whose members have highly similar and conserved core “seed sequences” [42,43]. Research has shown that the let-7 family could participate in cell proliferation, differentiation, immune response, and glucose metabolism in mammals [42,44,45]. The study on mouse liver revealed that let-7 miRNA targets RNF8 and through the let-7-RNF8-RXRα axis to inhibit the PPARα signaling pathway, thereby promoting the fatty liver occurrence [46]. In chicken, it was reported that let-7a-5p and let-7b repressed the expression of TGFBR1 and LIN28B genes by directly binding to their 3′UTR, which intrinsically controlled blastodermal cell differentiation and maintained pluripotency in early chick embryogenesis [47]. Depressed let-7 expression in chicken embryo primary type II pneumocytes could reduce the adhesion capacity Mycoplasma gallisepticum (MG) as well as MG-induced hyperinflammation and cell apoptosis of through a suppression of mitogen-activated protein kinase (MAPK) signaling pathway [48]. An initial element linking the let-7 family to chicken adipogenesis was that gga-let-7a-3p could inhibit chicken intramuscular preadipocytes’ proliferation and adipogenic differentiation [49]. Our results revealed that gga-let-7c-3p could lead to a conspicuous decrease in viability, proliferation and cell cycle progression of chicken abdominal preadipocytes, which was accompanied by a significant decrease in intracellular triglyceride synthesis and lipid droplet accumulation in differentiated chicken abdominal preadipocytes. This indicates that gga-let-7c-3p can inhibit the proliferation and adipogenic differentiation of chicken abdominal preadipocytes.

It is generally accepted that miRNAs play their regulatory roles by post-transcriptional silencing of their target genes whose 3′UTRs are complementary to the miRNA seed region. Here, the PPARD gene was elucidated as a direct target of gga-let-7c-3p, whose 2–8 nt seed region could recognize and directly bind to the 3′UTR of the PPARD gene, thereby inhibiting the PPARD mRNA expression. The PPARD gene encodes peroxisome proliferator activated receptor delta, which belongs to a member of PPARs, a class of nuclear receptors that act as transcription factors to initiate or suppress the transcription of downstream target genes involved in cell proliferation and lipid metabolism by specifically binding to the PPAR response elements (PPREs) in their genomic DNA sequence [50]. Noteworthily, studies have confirmed that the binding of PPARs to their ligands was the gateway for adipogenic genes’ activation and adipogenesis initiation [51]. In livestock, the PPARD gene could promote fat deposition in pig backfat [52]; the PPARD gene could upregulate the expression of genes involving fatty acid activation (ACSL1), lipid droplet formation (PLIN2), and fatty acid transport (FABP4), thereby promoting lipid secretion and fatty acid breakdown metabolism in goat mammary epithelial cells [53]; PPARD mRNA expression was significantly higher in the longest dorsal muscle Wagyu-sierd cattle with more intramuscular fat content than Angus cattle with lower intramuscular fat content [54]. However, the regulatory functions of the PPARD gene in chickens is still unclear. In this study, the PPARD mRNA expression showed an overall increased trend during the adipogenic differentiation of chicken abdominal preadipocytes, suggesting its potential regulatory role in chicken abdominal adipogenesis. Further gain- and loss-of function assays demonstrated that the PPARD gene could inhibit the cell vitality, proliferation and cell cycle progression of chicken abdominal preadipocytes, and could promote intracellular triglyceride content and lipid droplet accumulation, indicating that PPARD plays an important regulatory role in chicken abdominal adipogenesis. This is consistent with the previous results of another subtype of PPARs-PPARγ gene-mediated cell cycle arrest and suppressive proliferation, together with stimulative adipogenic differentiation of chicken abdominal preadipocytes [55,56]. This led us to hypothesize that PPARD might also bind to the promoter regions of cell proliferation and lipid metabolism-related genes to regulate their transcription activities, thus controlling the proliferation and adipogenic differentiation of chicken abdominal preadipocytes. To verify this, we predicted downstream target genes of PPARD, whose 2000 bp promoters contain putative PPARD binding sites and identified multiple proliferation-related genes (CCNE1 [36], CDK2 [34], CCND2 [57], CCND3 [40], PCNA [34]) and lipid synthesis-related genes (ACSL5 [38], ELOVL1 [37], ACACA [58], FADS6 [59], DGAT2 [41], APOA4 [39], ELOVL3 [60], LPL [37], ELOVL6 [60], FABP3 [61], FABP2 [61], ACAA1 [62], LPIN1 [14], ELOVL2 [60], FABP5 [61]). Of these, the PPARD gene could significantly decrease the mRNA expression of proliferation-related genes (CCNE1 [36], CDK2 [34], CCND3 [40], PCNA [34]) and significantly increase that of lipid synthesis-related genes (ACSL5 [38], ELOVL1 [37], DGAT2 [41], APOA4 [39]), indicating the dynamic expression change of these genes in response to PPARD overexpression or knockdown. CDK2 is a core cell cycle kinase that can phosphorylate many substrates to drive cell cycle progression [63]. CCNE1 is an important regulator of the cell cycle, driving the transition from G1 phase to S phase [64]. CCND3 is a regulatory protein belonging to the highly conserved cyclin D family, which is crucial for the transition from G1 phase to S phase [65]. ACSL5 belongs to long-chain fatty-acid-coenzyme A ligase family and activates long-chain fatty acids into acyl-CoAs, which were responsible for de novo lipid biosynthesis (such as triglycerides) and fatty acid degradation (β-oxidation) [38]. DGAT2 is an essential acyltransferase that catalyzes the terminal and only committed step in intracellular triacylglycerol synthesis and integral to cellular lipid droplet formation, and its overexpression could significantly promote triglyceride accumulation, and lipid droplet formation in bovine preadipocytes [41]. In mammals, ELOVL is the first rate-limiting enzyme in the synthesis of very long chain fatty acids, controlling the rate and direction of lipid synthesis [66,67,68]. It has been revealed that ELOVL1 could activate PI3K/AKT/mTOR signaling, promoting tumor growth in human hepatocellular carcinoma [69]. APOA4 is a plasma lipoprotein that participates in regulating many metabolic pathways such as lipid and glucose metabolism. In vivo studies have shown that APOA4 enhances hepatic triglyceride secretion in mouse [70]. Furthermore, APOA4 could promote hepatic fat deposition during chicken embryonic development [71]. These gene expression changes responding to PPARD dynamics suggested that PPARD serves as a regulator during chicken abdominal adipogenesis by regulate the transcription activities of proliferation- and lipid synthesis-related genes by recognizing and binding to PPREs in their promoters, and such effects could be inhibited by gga-let-7c-3p that suppressed its direct target PPARD gene expression, which needs to be further verified.

It is widely accepted that miRNA can regulate a broad range of biological and PPREs physiological processes by post-transcriptionally triggering target gene silencing, where miRNA often showed the opposite regulatory effects to its target gene. In addition, a single miRNA has the potential to simultaneously regulate more than one target gene, even up to hundreds of target genes [72]. For the regulatory effects of the gga-let-7c-3p/PPARD axis on chicken abdominal adipogenesis, both gga-let-7c-3p and the PPARD gene could inhibit chicken abdominal preadipocytes’ proliferation, which did not align with the miRNA-mRNA regulatory characteristics. This could be explained that, besides the PPARD gene silencing, gga-let-7c-3p also suppressed the post-transcriptional expression of some other target genes which were responsible for cell proliferation promotion, and then counteracted the PPARD gene silence-mediated accelerating effects on chicken abdominal preadipocytes proliferation, ultimately resulting in an overall inhibition of gga-let-7c-3p on chicken abdominal preadipocytes proliferation, which needs further investigation.

5. Conclusions

Collectively, gga-let-7c-3p could inhibit the proliferation and adipogenic differentiation of chicken abdominal preadipocytes, at least by inhibiting the mRNA expression of its direct target PPARD gene (Figure 7). To the best of our knowledge, this study is the first to elucidate the regulatory functions and molecular mechanism of gga-let-7c-3p/PPARD axis in chicken abdominal adipogenesis These findings not only deepen our understanding of the molecular mechanism underlying chicken AF deposition, but also provides potential molecular targets and theoretical basis for lean line broiler breeding.